HBS
1st Semester Exam Study Guide
Atkinson
You may need to look at the diagrams below to answer some of the
following questions.
Diagram A
2
1
Diagram B
2
1
1. The abdominal area is superior to the tibia.
a. True
b. False
2. Which region of the body is blood normally drawn?
a. antecubital
c. brachial
b. olecranal
d. cephalic
1
3
3. Which structure(s) is/are lateral to the coccyx?
a.
sacrum
c. ilium
b.
symphysis pubis
b. vertebrae
4. What structure are the true ribs attached to on the anterior side of the body?
a.
sternum
c. scapula
b.
clavicle
d. vertebral column
5. A patient complains of pain in her face. What anatomical region of the body
is painful?
a.
brachial
c. thoracic
b.
cephalic
d. cervical
6. A small child falls out of bed and suffers a broken metatarsal. The child has a
broken
a. foot
c. ankle
b. hand
d. wrist
7. A doctor tells a patient that they might have broken their #4 lumbar bone.
Which bone is likely broken?
a.
a rib
c. the coccyx
b.
a vertebra
d. a clavicle
8. A person has a tear in a muscle very close to their popliteal region. What
symptoms would this person most likely experience?
a.
b.
c.
d.
e.
back pain when bending over to lift an object
pain when taking deep breaths
pain when bending the knee
pain when bending the arm
none of these
9. What is 1 pointing to in diagram A?
a.
tarsal region
c. digital region
b.
femoral region
d. sternal region
10. What is 2 pointing to in diagram A?
a.
carpal region
c. oral region
b.
occipital region
d. scapular region
11. How many thoracic vertebrae are there?
a.
12
c. 16
b.
10
d. 24
12. Which of the following are bones in the axial skeleton?
a. skull, ribs, coxal bones, vertebrae
b. sternum, clavicle, scapula, pubis
c. skull, humerus, sacrum, ribs
d. sternum, ribs, skull, vertebrae
13. Which of the following groups of bones would make up the hip or coxal bone?
a. ilium, ischium, pubis
b. sacrum, coccyx, pubis
c. ilium, ischium, symphysis pubis
d. ischium, sacrum, symphysis pubis
14. In the anatomical position, which forearm bone is medial?
a. radius c. humerus
b. ulna d. fibula
15. The floating bone found anterior to the popliteal region is the?
a. calcaneous c. coccyx
b. patella
d. sacrum
16. The most proximal bone of the leg would be the
a. tibia
c. femur
b. metatarsals d. humerus
17. What is 1 pointing to in diagram B?
a. radius
b. metatarsals
c. patella
d. humerus
e. none of these
18. What is 2 pointing to in diagram B?
a. frontal bone
b. mandible
c. maxilla
d. pubis
e. ilium
19. What is 3 pointing to in diagram B?
a. sagittal suture
b. parietal bone
c. coccyx bone
d. occipital bone
e. none of these
20. The scapula is medial to the axillary region.
a. true
b. false
21. It feels like you broke your ankle, but the doctor says you tore a ligament
instead. You tore the connective tissue that
a. joins two bones
b. joins a muscle to a bone
c. contains osteocytes
d. contains adipose cells
e. none of these
22. The anterior union of the two coxal bones is the
a. pubis
b. coccyx
c. sacrum
d. symphysis pubis
23. Which type of tissue is shown above?
a. connective
c. nervous
b. epithelial
d. muscle
24. A person is suffering from overactive bladder. They are constantly having to
pee because their bladder is contracting? Which type of tissue is to blame?
a. skeletal muscle
c. epithelial
b. smooth muscle
d. connective
25. Which type of tissue has a high rate of cancer because it is found in areas of
the body that are in direct contact with the outside environment?
a. skeletal muscle tissue
b. nervous tissue
c. epithelial tissue
d. ligaments
e. adipose tissue
26. You see a person winking at you. Which muscle is the person using?
a. orbicularis oris
b. ocularis orbuli
c. orbicularis oculi
d. temporalis
e. parietalis
Look at the picture of the tissue shown above. Answer the question below.
27. What is most likely a function of this tissue?
a. the beating of the heart
b. energy storage and insulation
c. secretion and absorption
d. protection of vital organs
e. none of these
28. In the picture above, where would you find the bone cells?
a.
b.
c.
d.
e.
inside the Haversian canal
bone cells are not found in this type of tissue
inside of the lacunae
all over
none of these
29. What is the arrow pointing to in the picture below?
a. cell membrane
b. nucleus
c. cytoplasm
d. striation
e. intercalated disk
30. When a bipedal organism is standing up, the anterior/ventral side and
dorsal/posterior side has the same meaning, but as soon as the animal crouches
down on all fours, the meaning of dorsal and ventral changes.
a. true
b. false
31. Which of the following is NOT a function of your skeleton?
a. it houses minerals for storage
b. it helps you to move with the help of muscles
c. it protects vital organs
d. it makes your blood cells
e. it produces your neurons
Matching: Match the answers below with the statements following. You may use
an answer more than once, but there is only one answer per statement.
a. Epithelial Tissue
b. Connective Tissue
c. Muscular Tissue
d. Nervous Tissue
32. Attach muscle to bone
33. Needed for sensory reception
34. Protects, sometimes can absorb and secrete
35. Fat is a type of this tissue
36. Bone is a type of this tissue
37. Some types are striated
You are a forensic anthropologist who is tasked to identify human remains found
buried in the woods. Answer the following two questions.
38. Which bone is most useful for determining ethnicity?
a. femur
c. humerus
b. skull
d. pelvis
39. You were not able to make a conclusive gender determination. Which two
bones were most likely missing from the remains?
a. the pelvis and foot
b. the skull and the pelvis
c. the hand and the pelvis
d. the humerus and the ulna
40. Why is determining the race of a skeleton sometimes hard to do?
a. because most people are not 100% of a pure race; we are a mingling of
races most of the time
b. it is highly quantitative
c. the humerus bone is often times the wrong length
d. you really need the entire skeleton present to determine race
e. none of these
41. Which two bones, when used together, are excellent indicators of
height?
a. the femur and the humerus
b. the femur and the ulna
c. the humerus and the fibula
d. the skull and the femur
e. all of these
42. Which bone is the best bone to help determine age?
a. the pelvis
b. the ulna
c. the skull
d. the vertebrae
e. all of these
43. Which of the following bone features would be used to collect data for
determining ethnicity?
a. sub-pubic angle
b. shape of the pelvis
c. length of the femur
d. width of the nasal cavity
44. Which of the following bone features would be used to collect data for
determining gender?
a. nasal index
b. length of the phalanges
c. sub-pubic angle
d. prognathism
45. Analyzing the extent of fusion of bones is helpful in determining
a. age
c. race
b. gender
d. all of these
46. RFLP gel electrophoresis is used
a. by forensic anthropologists to classify bone features from DNA
b. to create DNA fingerprints for identification
c. to determine a person’s height based on results from bone DNA
d. to create large samples of DNA taken from human remains
47. A student runs an RFLP gel electrophoresis experiment. The results show
several lanes with multiple banding patterns and one lane with one large band of
DNA that did not move out of the loading well. What procedural step did the
student most probably forget to do?
a. use restriction endonucleases on the DNA sample
b. run the polymerase chain reaction (PCR) on the DNA sample
c. turn on the electrophoresis equipment
d. put the DNA on the negative end of the chamber
48. Restriction endonucleases are useful as biological tools because they can be
used to
a. cut up viral DNA in people who suffer from a viral infection
b. cut up DNA which will ultimately help to create different RFLP
fragment lengths thus helping to identify missing people or nab a
suspect in a case
c. amplify DNA in the polymerase chain reaction (PCR)
d. create palindromes
49. DNA is ___________ and will move through the gel toward the
_____________ end of the electrophoresis chamber.
a. neutral, negative
c. positive, negative
b. negative, neutral
d. negative, positive
50. Which biometric is the most accurate and has the least chance of being
beaten?
a. retina scan
c. facial recognition
b. voice recognition
d. fingerprints
51. Biometrics is
a. a biological metric system used by forensic anthropologists
b. field of science that uses physical and behavioral characteristics of
people for identification purposes
c. separating DNA fragments according to length
d. a technique used in molecular biology to analyze a person’s physiology
Evaluate the following segment of DNA using the knowledge that EcoRI
recognizes the sequence 5’ GAATTC 3’ and cuts between the G and the A base
creating single strand “sticky ends”.
GGAATTAAGCTTATTGAATTCTTAAAGCTTTAGAATTCGGGGCCCACATGAATTCAATT
CGTTAATTCGAATAACTTAAGAATTTCGAAATCTTAAGCCCCGGGTGTACTTAAGTTAA
a. Draw lines through the DNA to show the action of EcoR1.
b. List the size of the fragment from largest to smallest and then find the
answer below.
52. What are the sizes of the fragments from largest to smallest?
a. 16, 13, 13, 5
b. 18, 16, 14, 7
c. 16, 13, 15, 5
d. 16, 14, 13, 6
53. What does RFLP stand for?
a. Restriction Fragment Length Palindromes
b. Ribose Fragment Lactose Phosphates
c. Restriction Fragmentation Ligase Polymorphs
d. Restriction Fragment Length Polymorphisms
54. How many RFLPs are there in the DNA strip that you cut?
a. 2
b. 0
c. 3
d. 4
e. 5
55. Which is the correct order of process for gel electrophoresis?
a. amplifying or copying DNA, cutting the DNA with restriction enzymes or
restriction endonucleases, gel electrophoresis
b. gel electrophoresis, PCR (polymerase chain reaction), adding restriction
endonucleases
c. PCR, gel electrophoresis, cutting DNA with enzymes
d. none of the above
56. Where do restriction endonucleases come from?
a. viruses
b. people
c. bacteria
d. anything with DNA
57. Nerves carry impulses toward the brain are
a. sensory neurons
c. motor neurons
b. efferent neurons
d. interneurons
58. A simple spinal reflex goes along which of the following reflex arcs?
a. efferent neuron, interneuron, afferent neuron
b. afferent neuron, efferent neuron, interneuron
c. afferent neuron, interneuron, efferent neuron
d. efferent neuron, afferent neuron, interneuron
59. An automatic response to a stimulus that often does not pass through the
brain is called
a. synapse
c. reflex
b. reaction
d. action potential
60. Brain disorder in which a person looses neurons that release acetylcholine.
a. ALS - Lou Gehrig’s disease
c. Parkinson’s disease
b. Alzheimer’s disease
d. Epilepsy
61. Brain disease/disorder that progressively destroys the myelin sheaths of the
neurons of the central nervous system is called
a. Parkinson’s disease
c. Multiple sclerosis
b. Lou Gehrig’s disease
d. Huntington’s disease
62. Which membrane protein is responsible for restoring the orginial
concentration of ions during the action potential?
a. Na channel
c. Ca channel
b. K channel
d. Na/K pump
63. __________ secretes hormones of the posterior pituitary and releasing
factors, which regulate the anterior pituitary.
a. hippocampus
c. endocrine gland
b. thallumus
d. hypothallumus
64. Which protein hormone is produced by the pancreas to promote the increase
in the sugar content of the blood by breaking down glycogen in the liver?
a. glucose
c. thyroxine
b. glucagon
d. insulin
65. An endocrine gland that stores and releases two hormones produced by the
hypothallumus is called the
a. pancreas
c. pituitary
b. hippocampus
d. thyroid
Matching
a.
b.
c.
d.
Frontal Lobe
Parietal lobe
Temporal Lobe
Occipital Lobe
e. Cerebellum
f. Brain Stem
g. Sensory Cortex
66. inferior lobe of the cerebrum; specific activities include hearing and short term
memory.
67. sides of the superior part of the brain
68. controls consciousness and self-awareness
69. dorsal projection of the brain; controls muscle coordination
70. control touch
71. regulates reflexes and involuntary actions
72. controls sight and vision.
a. Hypothallumus
b. Thallumus
c. Pons
d. Medulla Oblongata
e. gyrus
f. sulcus
73. convoluted ridge between anatomical grooves
74. shallow furrow on the surface fo the brain
75. long term memory
76. controls hunger and thrist
77. acts as the relay station for sensory information
78. inferior portion of the brain stem.