Mutagenesis vol. 19 no. 1 pp. 3±11, 2004
DOI: 10.1093/mutage/geg037
REVIEW
The restriction site mutation (RSM) method: clinical applications1
G.J.S.Jenkins1,*
Swansea Clinical School, University of Wales Swansea, Singleton Park,
Swansea SA28PP, UK
The restriction site mutation (RSM) method has been
developed over the past 13 years as a sensitive mutation
test which can detect mutations in restriction sites in any
gene. Due to the fact that 5/8 of the main mutation hotspots in the TP53 gene fall within restriction sites, RSM
can analyse them for the presence of rare mutations (1
mutation in 10 000 non-mutated copies). After validating
the usefulness of RSM in detecting mutagen-induced
mutations, we recently turned our attention to looking for
TP53 mutations in pre-malignant tissue. We show here
that RSM can detect early TP53 mutations in pre-malignant tissue of the oesophagus, stomach, colon and bladder.
We can also use these clinical mutation data to speculate
as to the causative mutagens involved in these cancer conditions. We here use an example of mutations detected in
gastric tissue and those induced in vitro by hydrogen peroxide.
Introduction
Somatic mutations are induced continually in human cells.
These mutations have the potential to cause disease, including
cancer. In order to induce cancer, the mutation must provide
the cell (and hence clone) with a selective growth advantage.
This growth advantage is exploited during tumour evolution
and is accompanied by the accumulation of further mutations
which aid its further selection. Mutations are accumulated in
such cells due to spontaneous processes as well as by exposure
to exogenous mutagens. Spontaneous mutations arise in every
cell of every animal at a very low level, at a frequency of ~10±9
mutations/base/division (Wabl, 1982). Substantially more
important in mutagenesis and carcinogenesis are induced
mutations, which can be introduced into the DNA of cells at
levels 103 times higher than spontaneous mutations (~10±6).
These induced mutations are believed to be responsible for
cancer development in most cases. Examples of paired culprit
mutagen and tumour type include cigarette smoke and lung
cancer and sunlight and skin cancer. Whether mutations arise
by spontaneous or induced processes, their frequency within
affected tissues is very important in terms of carcinogenesis.
Very rare cancer-related mutations (before clonal expansion)
are probably present in all tissues of all adult individuals (Frank
and Nowak, 2003). It is only when clonal expansion occurs that
phenotypic effects are noted. In the case of carcinogenesis,
these phenotypic effects are life threatening.
Not all mutations are created equal and the differences in
mutations (types and positions) present in clinical tissues can
1Tel:
provide important information on the culprit mutagens.
Mutagens are known to induce characteristic mutation patterns
(mutation ®ngerprints) in DNA, hence allowing their subsequent identi®cation by DNA sequence methods. These characteristic mutation ®ngerprints are a consequence of
preferential DNA adduct sites and the in¯uence of DNA repair
and, in the case of carcinogenesis, the mutation ®ngerprint is
in¯uenced by the selective nature of speci®c mutations. The
tissue-speci®c nature of point mutations as a consequence of
tissue-speci®c mutagens (e.g. skin and UV) has been demonstrated, indeed `concordance' between mutation patterns can
be seen in tissues with similar mutagen exposure potentials
(Lutz et al., 1998).
Methodologies for the detection of mutations in tumour
samples where the mutations have been clonally ampli®ed and
are often present in every cell are numerous and pose no
challenge. However, detecting mutations in pre-malignant
tissues is somewhat dif®cult. Hence, the paucity of mutation
data in pre-malignant tissues. The reason for the lack of early
mutation data is the lack of methodologies capable of detecting
low frequency mutations hidden amongst an excess of nonmutated sequences. Another aspect of mutation detection
involves the gene in which mutations are studied. In mutagenexposed model systems there are many selection-based mutation tests which can detect rare mutations in target genes and,
hence, identify mutagens; examples of these systems include
HPRT (Albertini et al., 1982), Lac I (Kohler et al., 1991), Lac Z
(Gossen et al., 1989) and Sup F (Kraemer and Seidman, 1989).
However, these systems are of little use in detecting mutations
in clinical material, particularly in cancer-related genes such as
TP53 (see below).
Restriction site mutation (RSM) is a methodology which has
been developed by ourselves and others for the detection of low
frequency mutations in any gene (Parry et al., 1990; Jenkins
et al., 1997, 1998, 1999a,b, 2000, 2001). The development of
this methodology has now progressed to the point that we can
detect mutations induced in vitro by exposure to speci®c
mutagens. Importantly, we can now also apply RSM to look for
the same mutations in the clinical material of patients who may
have been exposed to this speci®c mutagen. This may prove a
powerful approach in establishing the origin of clinical
mutational events and may help in providing direct evidence
for mutagen-induced carcinogenesis. Importantly, if mutations
can be detected in cancer-related genes (such as TP53) early in
cancer development, it may be possible to use such early
mutations as prognostic markers of cancer development. This
is particularly true for mutations which drive cancer progression and hence are selected for during tumour evolution. It is
well known that early detection is the key to better survival in
carcinogenesis (Etzioni et al., 2003).
+44 1792 295361; Fax: +44 1792 295447; Email: mailto:[email protected]
*Recipient of the 2002 UKEMS Young Scientist Award and the 2003 EEMS Young Scientist Award
Mutagenesis vol. 19 no. 1 ã UK Environmental Mutagen Society 2004; all rights reserved.
3
G.J.S.Jenkins
Figure 1. Outline of the RSM procedure. Mutant sequences (®lled box) when present in an excess of wild-type sequences (open boxes) can be selectively
ampli®ed by RE digestion and PCR ampli®cation. A second RE digestion removes any ampli®ed wild-type sequences. Gel electrophoresis highlights any
ampli®ed PCR products. These are then sequenced to ascertain the mutation in the RE site.
Figure 2. Sensitivity of RSM. Tumour DNA bearing a codon 175 mutation in TP53 (HhaI) was serially diluted with wild-type DNA. RSM was then applied
and the 1:10 000 dilution was shown to be the highest dilution still bearing a mutant band.
RSM, as the name suggests, relies on the sequence
speci®city of bacterial restriction enzymes. These enzymes
cleave DNA at 4±6 base sequences (Pingoud and Geltsch,
2001), but fail to recognize these sequences if a single base is
changed. Hence, if a mutation falls within a restriction enzyme
(RE) site, it will alter the ability of the enzyme to cleave it. By
digesting the DNA with a particular RE, followed by PCR with
primers ¯anking the RE site, only undigested (mutated) DNA
will escape digestion and produce a PCR product. This is the
basis of RSM (see Figure 1). In practice, a second digestion
step removes any non-mutated DNA which may have escaped
the initial digestion (for a review see Jenkins et al., 1999b).
Hence, any PCR products generated can be sequenced to reveal
the RE site mutation. Using a large number of RE sites within a
particular gene allows mutation to be assessed across large
tracts of sequences. RSM can be tailored to suit particular
mutagens/mutagen-exposed tissues, by choosing RE sites that
contain bases prone to speci®c mutations (e.g. RE sites rich in
GC bases or AT bases or containing CpG sites, etc.).
4
Obviously, the main drawback of the RSM approach is that
mutations can only be studied in DNA sequences covered by a
RE site. However, most genomes have RE sites covering ~50%
of the DNA (Cotton, 1989). Hence, despite the fact that a lot of
REs are not suitable for RSM, RE site coverage is still
reasonably good in human genomic DNA.
Initial work in developing RSM focused on determining its
sensitivity by using known mutagenic exposures in vitro and
in vivo. These studies demonstrated that the RSM approach
could detect mutations induced by dimethylhydrazine (Jenkins
et al., 1997), N-methyl-N-nitrosourea (Suzen et al., 1998), 4nitroquinoline-1-oxide (Jenkins et al., 1998), benzo[a]pyrene
(Sueiro et al., 2000), 2-acetylamino¯uorene (Jenkins et al.,
2000), N-ethyl-N-nitrosourea (Jenkins et al., 1999a; Song et al.,
2001) and hydrogen peroxide (Jenkins et al., 2001). These
mutation studies were carried out in a variety of species
(human, mouse, rat and ¯ounder). This allowed optimization of
the methodology and allowed us to gain experience in choosing
suitable REs for RSM analyses. RSM has been shown to be
The restriction site mutation method
Figure 3. Mutation pro®le of TP53 from >13 000 tumours. Obtained from the IARC TP53 mutation database (www.iarc.fr/p53). This pro®le highlights the
hotspot codons of TP53.
capable of detecting mutational events even when the mutation
is present amongst a >10 000-fold excess of non-mutated DNA
(Jenkins et al., 2001). Figure 2 illustrates the sensitivity of
RSM by using tumour DNA bearing a codon 175 mutation in
TP53. A similar methodology developed by the Cerutti group
produced a more sensitive version of the method (1:1 000 000)
by undertaking preparative digestions to increase the gene copy
numbers analysed (Aguilar et al., 1993). However, this
approach was extremely time consuming and complex, hence
we have used a simpler, less time consuming version in our
studies. After extensive development of RSM, we became
aware that RSM was not going to be accepted for standard
genotoxicity testing, which had been our initial aim. This was a
consequence of other established mutation tests being just as (if
not more) effective, e.g. the Ames test (Ames et al., 1973),
HPRT, Lac I and Lac Z. Hence, we made the decision in 1999
to exploit the sensitivity of RSM in examining clinically
important mutations. Due to the fact that RSM can detect rare
mutations in genes such as TP53, it was reasonable to assume
that it could contribute substantially to the understanding of
early mutagenesis in clinical tissues. For the clinical studies,
the quantitative element of RSM, i.e. the determination of
mutation frequencies, was not employed, as we were instead
more interested in the presence or absence of a TP53 mutation.
However, the strength of the mutated band is noted, as strong
bands re¯ect prominent mutations whereas weak bands re¯ect
rarer mutations. In this review, we focus on the use of RSM in
detecting clinically important mutations in pre-malignant
tissues. The RSM method has been employed by other groups
for this purpose and there are published data on its use in
detecting TP53 mutations in in¯ammatory colonic tissue
(Ambs et al., 1999; Perwez Hussain et al., 2000) and in oral
tissues (Mollaoglu et al., 2001).
This review focuses on mutations of the TP53 gene in
particular. Although we have used RSM to analyse mutations
in other cancer-related genes, most of our studies have
concentrated on the TP53 gene. The main reason for this is
the unique role of p53 in cancer development. TP53 is known
to be the most frequently mutated gene in most (if not all)
tumour types (Hainaut and Hollstein, 2000). The TP53 gene is
mutated most frequently in cancer due to its central role in the
control of the cell cycle and apoptosis (Cadwell and Zambetti,
2001). The anti-proliferative properties of p53 are a huge
hurdle to tumour evolution and this is the reason why so many
tumours exist with defective p53 proteins. Indeed, tumours that
lose p53 are known to become genetically unstable, allowing
the accumulation of further cancer-promoting genetic alterations. Speci®cally, p53 loss is linked to increased spontaneous
mutation rates (Havre et al., 1995), increased chromosome
instability (Bouf¯er et al., 1995) and aneuploidy (Fukasawa
et al., 1996). There has been substantial investigation of TP53
mutation induction in tumours such that databases (HernandezBoussard et al., 1999) of the types and positions of these
mutations are now available (www.iarc.fr). This is a huge
bonus for mutation analysis as it indicates the common
positions of induced mutations (so-called hotspots). The
mutation hotspots arise as a consequence of the most effective
inactivating amino acid substitutions which remove p53
function. Figure 3 illustrates the location of TP53 mutations
in all tumour types present in the IARC database, demonstrating their non-random distribution. These data allow the design
of RSM targets (RE sites) that match these hotspots most
closely. The fact that TP53 mutations are not concentrated at
one key codon, but are spread over ®ve or six codons provides
the possibility of determining mutation ®ngerprints in clinical
tissues for comparison with mutagen-induced ®ngerprints
in vitro. However, with RSM this can only be partially
achieved, as only a small number of RE sites and hence DNA
bases are studied. In addition, the TP53 hotspots tend to centre
on those containing CpG sites, thus further affecting the chance
of obtaining an exact mutation ®ngerprint.
In this review we describe the accumulation of TP53
mutations in four pre-malignant tissues. Importantly, these
tissues were histologically evaluated and found to be free from
cancer. The four tissues are oesophageal, gastric, colon and
bladder tissues. We have detected TP53 mutations in these
tissues for two main reasons. Firstly, to determine how early in
cancer progression TP53 mutations occur and, secondly, to
identify what type of TP53 mutations occur with a view to
comparing these with putative mutagenic exposures.
5
G.J.S.Jenkins
Figure 4. Graphical representation of the accumulation of TP53 mutations in four tissue types of varying histology. (A) TP53 mutations accumulated in
oesophageal tissue; (B) similar data for gastric tissue; (C and D) data for colon and bladder tissue, respectively.
Table I. Details of PCR conditions and restriction enzymes used in the RSM analysis
TP53 exon
Exon
Exon
Exon
Exon
Exon
5,
6,
7,
7,
8,
codon
codon
codon
codon
codon
175
213
248,
249
282
Restriction
enzyme
Digestion
temperature
Forward primer
Reverse primer
PCR product
size
Annealing
temperature
Cycle
number
HhaI GCGC
TaqI TCGA
MspI CCGG
HaeIII GGCC
MspI CCGG
37°C
65°C
37°C
37°C
37°C
ccgcgccatggccatct
gtccccaggcctctgattcctc
ttggctctgactgtaccac
gcgctcatggtggggg
taacccctcctcccagagaccccag
agtgtgcagggtggcaag
75 bp
188 bp
137 bp
60°C
65°C
60°C
31
34
31
cctcttgcttctcttttcctatcc
cttggtctcctccaccgcttcttg
262 bp
60°C
31
Collection of tissue samples
DNA extraction
Tissue samples were collected from patients attending endoscopy/colonoscopy/cystoscopy clinics at Morriston Hospital
Swansea, Singleton Hospital Swansea and the University
Hospital of Wales Cardiff, respectively. The samples were
taken from consenting patients only after ethical approval was
obtained from the local ethics committee. In the case of
oesophageal and gastric biopsies, these were obtained by
endoscopy in Professor J.N. Baxter's clinics at Morriston
Hospital Swansea. As well as biopsies from the affected area
(Barrett's oesophagus, gastritis, etc.), normal biopsies were
also taken from non-affected areas as an internal control.
Biopsies were also taken for concurrent histological analysis.
In the case of the colorectal samples, tissue was obtained
during colonoscopy or surgery for colorectal cancer during Mr
J. Beynon's surgical lists at Singleton Hospital Swansea.
Adjacent normal tissue was also obtained. In the case of the
clam ileocystoplasties, tissue samples were taken during
cystoscopy in Mr T. Stephenson's surveillance clinics at the
University Hospital of Wales Cardiff, for patients who had
previously received a clam cystoplasty. As well as tissue from
the clam cystoplasty, adjacent tissue from the normal bladder
remnant was also taken. The numbers of tissues analysed in
these studies were as follows: 93 oesophageal samples from 42
patients; 52 gastric samples from 52 patients; 75 colon samples
from 55 patients; 76 bladder samples from 38 patients.
DNA was extracted from the biopsies using a high salt method
(Stratagene, Cambridge, UK). The DNA was checked for
quantity and quality by spectrophotometry at 260/280 nm. The
DNA concentration was adjusted to 100 ng/ml and stored at
±20°C.
6
RSM procedure
Mutation analysis was performed at codons 175, 213, 248, 249
and 282 of TP53. Codon 273, which is a major TP53 mutation
hotspot, was not available for mutation analysis as there is no
restriction enzyme coverage. RSM analysis was performed as
previously described (Jenkins et al., 2002, 2003). Mutated
RSM products were sequenced using a CEQ2000 automated
DNA sequencer (Beckman Coulter, High Wycombe, UK).
Both strands of the PCR products were sequenced and
mutations were only accepted if present on both strands.
Helicobacter pylori detection in gastric biopsies
DNA extracted from gastric biopsies with gastritis histology
was subject to PCR determination of H.pylori presence and
subtype. PCR primers designed for the ¯agellin gene were used
to identify H.pylori presence and primers for the CagA
virulence factor were used to assign CagA positivity. Details
The restriction site mutation method
Table II. Breakdown of the TP53 mutations detected in the various stages
of the four different tissues
Table III. Breakdown of the types and positions of the TP53 mutations in
the four different tissues
Tissue
Histological stage
Number and per cent mutated
Tissue
Mutated codon
Mutation type
Oesophageal
Normal squamous tissue
Barrett's metaplasia
Low grade dysplasia
High grade dysplasia
Normal stomach
Gastritis
Intestinal metaplasia
Normal tissue
Polyps
Bladder remnant
Inserted bowel tissue
0/4 (0%)
4/13 (30%)
4/14 (30%)
5/11 (45%)
0/12 (0%)
7/20 (35%)
9/20 (45%)
0/55 (0%)
4/55 (7%)
0/30 (0%)
7/38 (18%)
Oesophageal
248
175
282
248
249
250
175
248
248
250
213
GC®AT 92% (21/21 at CpG site)
GC®TA 8%
Gastric
Colon
Bladder
Shown is the number and percentage of tissues carrying a rare TP53
mutation.
of the PCR conditions were as described elsewhere (Morgan
et al., 2003).
TP53 mutations in pre-malignant oesophageal tissue
Barrett's oesophagus is a pre-malignant condition linked to
chronic re¯ux (heartburn) (Jankowski et al., 1999). Patients
who re¯ux bile and stomach acid for many years (or decades)
may eventually succumb to oesophageal adenocarcinoma, a
highly aggressive tumour with very low survival rates (Shahin
and Murray, 1999). Patients progress to cancer through a
number of distinct histological stages, beginning with in¯ammation (oesophagitis), followed by metaplasia, low grade
dysplasia, high grade dysplasia and, ®nally, adenocarcinoma.
TP53 abnormalities are known to be involved in the progression of Barrett's tissues to cancer (Jenkins et al., 2002), indeed,
tumours carrying TP53 mutations are thought to be more
aggressive (Schneider et al., 2000). Hence, we studied the
histological progression of this condition for the presence of
early TP53 mutations (Jenkins et al., 2003) using RSM.
Figure 4a shows the results of this investigation and demonstrates the progressive accumulation of TP53 mutations during
the histological progression to cancer (Jenkins et al., 2003),
suggesting that these mutations may be involved in driving
cancer by providing a selective advantage to cells. We are now
aiming to see if TP53-positive patients progress along the
histological path to cancer faster than those without a TP53
mutation. If so, then early TP53 mutation, as detected here by
RSM, may represent a useful prognostic marker in Barrett's
patients. Table I contains the details of the PCR and digest
conditions, whilst Tables II and III contain the TP53 mutation
data from this study. Table II con®rms that these mutations
were detectable early in cancer progression, being present at
the metaplasia stage. The mutation types detected in this study
are discussed below in terms of potential mutagens known to
produce such mutation patterns.
TP53 mutations in pre-malignant gastric tissue
Gastric cancer has been linked to infection of the stomach with
the bacterium H.pylori (International Agency for Research on
Cancer, 1994). Infection with H.pylori leads to a histological
progression starting with gastritis, leading through intestinal
metaplasia and dysplasia to, ®nally, cancer. As with Barrett's
oesophagus, TP53 mutations are known to be involved in
gastric cancer (Uchino et al., 1993) and hence we sought TP53
Gastric
Colon
Bladder
(81%)
(12%)
(8%)
(26%)
(26%)
(26%)
(5%)
(100%)*
(43%)
(43%)
(14%)
GC®AT 79% (9/15 at CpG sites)
GC®TA 5%
AT®GC 16%
GC®AT 100% (4/4 at CpG site)
GC®AT 57% (1/4 at CpG site)
GC®CG 14%
AT®GC 14%
Shown is the codon preference for the TP53 mutations and the particular
type of mutation most frequently induced.
*Only codon 248 studied.
mutations in clinical biopsies of gastric tissue with a range of
histologies. We employed RSM to exploit this technique's
sensitivity to determine the histological stage harbouring the
®rst TP53 mutations. We also aimed to link the TP53 mutations
found in the gastritis samples to concurrent infection with
H.pylori, in order to investigate the role that H.pylori plays in
gastric cancer progression. For the H.pylori association only
gastritis samples were analysed, as it is known that H.pylori
infection is reduced as the tissue histology progresses to
metaplasia and beyond. Figure 4B shows the accumulation of
TP53 mutations during histological progression in gastric
cancer (Morgan et al., 2003). Tables II and III again contain the
data on the TP53 mutations found and show that TP53
mutations were detectable early (gastritis stage). There was no
clear link between TP53 mutation and H.pylori infection. This
may have been due to the fact that most of the gastritis patients
were H.pylori-positive (16/20), hence it may have been
dif®cult to assign a link due to the lack of H.pylori-negative
patients (6/7 TP53-mutated patients were positive for
H.pylori). When the H.pylori-positive patients were broken
down into those carrying the virulence factor CagA (Morgan
et al., 2003) it was found that four of the six patients positive
for H.pylori who contained TP53 mutations also carried this
virulence factor, whereas 2/6 did not; this association was not
statistically signi®cant (P = 0.5) and the samples were too
small to make any ®rm associations. As with the Barrett's
oesophagus patients, we are aiming to determine if the
presence of an early TP53 mutation is a prognostic marker
by following up these sets of patients to monitor their
histological progression.
TP53 mutations in pre-malignant colon tissue
Colorectal cancer is often used as a model of cancer formation,
as its adenoma±carcinoma sequence is well established. In
addition, from Vogelstein's well-known genetic pathway of
colorectal cancer (Fearon and Vogelstein, 1990), it is accepted
that TP53 mutation is a late event in carcinogenesis of the
colon, occurring at the carcinoma stage. However, we aimed to
see if by using a sensitive mutation test we could detect TP53
mutations in a subset of pre-cancerous colon cells prior to
carcinoma formation. Previous studies of TP53 mutation in
colorectal cancer development have used relatively insensitive
techniques to detect mutations, such as DNA sequencing.
7
G.J.S.Jenkins
Figure 6. The TP53 mutation pro®les (actual base changes plus positions)
induced by H2O2 and those mutations present in oesophageal and gastric
tissue. Figure 6 shows a possible similarity between H2O2 and gastric
mutations, whilst oesophageal mutations are not quite so similar to H2O2.
Figure 5. Comparison between the mutation types induced by H2O2 and
those found in oesophageal and gastric tissues. There is a notable similarity
between the three mutation patterns; most of the mutations are GC®AT.
Hence, we analysed colon polyps of varying sizes in order to
examine the stage at which TP53 mutations ®rst arose. Our
results demonstrate that TP53 mutations were indeed detectable in polyps, albeit at a low level (7%), so perhaps TP53
mutations are earlier events than previously thought (Williams
et al., 2002). There was no correlation in this study between the
size or histology of the polyp and the presence of a TP53
mutation. Figure 4C shows the distribution of TP53 mutations
in the colonic tissues analysed. Again, the types and number of
mutations detected are shown in Tables II and III. It should be
noted that this colorectal study was only performed with one of
the codons of TP53, codon 248. This was due to time
limitations in this particular study and due to the fact that in all
other studies this codon accumulated most mutations. Hence,
this study may underestimate the proportion of tissues with a
TP53 mutation by not studying codons 175, 213, 249 and 282
(20±75% of TP53 mutations in the three other tissues were
outside codon 248). Furthermore, a comparison of the codon
preference for TP53 mutations in colon tissue is obviously not
possible.
TP53 mutations in pre-malignant bladder tissue
Clam ileocystoplasty is an operation that has been traditionally
used to increase bladder volume and reduce bladder pressure in
groups of patients who suffer from incontinence (Bramble,
1982). The operation involves taking a piece of small bowel
and inserting it into the centre of the bladder (hence the coining
of the term `clam'). This operation, whilst reasonably successful at treating incontinence, has led to increased cancer rates in
the inserted bowel region or the anastomosis (stitch line) of
clam cystoplasties (Filmer and Spencer, 1990). The increased
bladder cancer rates in these patients has an unknown basis, but
in order to assess whether this is due to increased genetic
instability in the transplanted tissue, TP53 mutations were
sought in the bowel tissue and bladder remnant of patients who
had undergone clam ileocystoplasties. The results of this
study showed that the inserted bowel/stitch line was indeed
unstable and a number of patients possessed TP53 mutations
(K.D.Ivil, G.J.S.Jenkins, E.M.Parry, S.A.Jenkins, J.M.Parry
and T.P.Stephenson, in preparation). Figure 4D illustrates the
accumulation of TP53 mutations in the clam ileocystoplasty.
The types and locations are again shown in Tables II and III. As
8
mentioned earlier, the ®nding of TP53 mutations in premalignant bladder tissues raises the possibility of using these
data to predict cancer progression in such patients.
Genetic stability of histologically normal tissue
Interestingly, in all four tissue types studied, there were no
detectable TP53 mutations in the histologically normal tissue
(101 normal tissue samples analysed). Despite the sensitivity of
RSM (1 mutant sequence in >10 000 non-mutated sequences),
no such mutations were detectable. This suggests that TP53
mutations, if present at all, must be present at frequencies
beyond the scope of RSM analysis (<10±5) before clonal
expansion has occurred. This suggests that normal tissues do
not accumulate TP53 mutations frequently and hence should be
genetically stable.
Types and prevalence of TP53 mutations in clinical
specimens
The TP53 mutations identi®ed in these studies show some
similarities as well as some interesting differences. As alluded
to earlier, analysis of the mutation patterns in clinical material
offers the possibility of identifying the causative mutagenic
exposure. Most of the mutations induced in these four tissues
were GC®AT transitions (Table III). The highest level of
transversions was seen in the bladder tissues (14% GC®CG),
which may represent exposure to a mutagen capable of causing
bulky DNA adducts which are more prone to transversion
events (Denissenko et al., 1998). Nitrosamines have been
implicated in bladder carcinogenesis (Mirvish, 1995), in
particular in those receiving a clam cystoplasty (Nurse and
Mundy, 1989). Hence, they may play a role in inducing the
mutations described here, but they tend to induce more
GC®AT mutations rather than transversions (Mirvish, 1995).
The involvement of an exogenous mutagen in the bladder
mutations is supported by the fact that only 25% of the bladder
GC®AT mutations were at CpG sites, as opposed to 60±100%
in the other three tissues (Table III).
Due to the high levels of CpG mutations in the three tissues
of the gastrointestinal tract studied here, it is possible that these
mutations may have been induced spontaneously as a consequence of increased proliferation of the pre-malignant tissue
(even normal gastrointestinal tracts are hyperproliferative in
order to replace the gut lining regularly). The high level of
GC®AT mutations at CpG sites in the gastrointestinal tract
The restriction site mutation method
tissues is particularly evident in the oesophageal and colon
tissues (Table III). CpG sites are known to be genetically
unstable (when methylated) and readily lead to GC®AT
mutations, especially in proliferating tissues, where there is
less time for DNA repair. However, it should be borne in mind
that CpG sites are also preferential binding sites for some
mutagenic chemicals (Denissenko et al., 1997; Chen et al.,
1998), hence, these CpG site mutations could be produced by
mutagen exposure. Indeed, it has been suggested that CpG sites
are preferential targets for reactive oxygen species (ROS)
(Harris, 1998), known to be produced during in¯ammation and
in¯ammation-mediated carcinogenesis (Jackson and Loeb,
2001). Indeed, nitric oxide (NO), produced in in¯amed tissues,
has been implicated in CpG mutagenesis in the TP53 gene
(Ambs et al., 1999). However, in a previous study of ours, only
20% of H2O2-induced mutations were found at CpG sites
(Jenkins et al., 2001), therefore, we believe that these CpG
mutations are probably spontaneous in origin.
Determining the association between mutagen exposure and
clinical mutation is complicated due to several factors,
including the overlapping speci®cities of spontaneous mutations and mutagen-speci®c mutations (often GC®AT mutations). However, the pro®les of the mutations (type plus
position) may be informative in suggesting links between
mutagens and clinically manifested mutations. As an example,
Figure 5 shows a comparison between the TP53 mutations
detected in the oesophageal and gastric tissue to those induced
by H2O2 in vitro. This comparison was made due to the
in¯ammatory origin of the two cancer-prone conditions
(Perwez Hussain and Harris, 2000), hence, the possible role
for in¯ammation-mediated ROS such as H2O2 and NO. From
Figure 5 it is possible to see that the types of mutations induced
by H2O2 and those seen in gastric and oesophageal tissue are
somewhat similar (mainly GC®AT transitions). However,
when the actual mutation pro®les are compared (Figure 6),
distinct differences appear between the two tissues and the
in vitro study. Whilst in theory it is possible to link mutations in
clinical material to those induced by suspect carcinogens
in vitro, as mentioned earlier, selection may cloud the issue.
The issue of mutation selection has previously been well
discussed (Cooper and Krawczak, 1993; Krawczak and
Cooper, 1996). Clinically important TP53 mutations will
represent those that alter p53 function. However, mutations
induced in vitro represent the mutation pattern minus selection.
An example of this can be seen in Figure 6; a major hotspot for
H2O2-induced mutations is the third base of codon 247.
However, this will not normally cause amino acid substitutions
and, hence, will be neutral; this is presumably the reason why
this mutation is not detected in the clinical samples. In Figure 6,
once the codon 247 hotspot for H2O2 is removed, there appears
to be a possible similarity between gastric TP53 mutations and
those induced by H2O2. The oesophageal mutations differ
somewhat from the other two due to the lack of mutations at
codon 249. Further study of the clinical mutations and those
induced by ROS other than H2O2 would aid in understanding
the contribution of in¯ammation-mediated ROS to upper
gastrointestinal tract carcinogenesis.
TP53 mutation as a prognostic marker of cancer
development
It has been demonstrated here that TP53 mutations arise early
in cancer development in these tissues. From Figure 4 it is
possible to rank the tissues for TP53 mutation accumulation.
This shows that gastric tissue accumulates more TP53 mutations than oesophageal, whilst oesophageal tissue accumulates
more mutations than bladder and colon, respectively. In
addition, the mutation data show that gastric tissue samples
display the earliest TP53 mutations, with 35% of gastritis
tissues (i.e. merely in¯amed tissue) carrying mutated TP53
genes in at least 1 in 10 000 cells (the detection limit of RSM).
Hence, clonal expansion of the TP53-mutated clone must have
already occurred in this in¯amed tissue in order to be
detectable by RSM. The fact that TP53 mutations are present
in in¯amed gastric tissue con®rms previous cytogenetic data
from our laboratory, showing the unstable nature of gastric
tissue in general (Williams et al., 2003). This also begs the
question, do patients with TP53-mutated cells progress to
cancer faster than patients devoid of TP53 mutations? Only
close follow-up of these cohorts of patients over 5 years will
answer this question. This follow-up takes the form of
monitoring the histological progression correlated with TP53
mutation data. Hence, a patient with gastritis who progresses to
intestinal metaplasia (the next histological step) will be
assessed for the presence of a TP53 mutation. If a TP53
mutation is shown to be linked to cancer progression in any of
these tissues studied here, it may become useful to monitor the
presence of TP53 mutations in pre-malignant tissues of a wide
variety of tissue types. RSM is certainly a convenient method
of assessing the presence of such mutations. It may prove to be
that the cut-off point for mutation detection with RSM (~1 in
10 000) may adequately separate high risk (post-expansion)
cancer patients from low risk (pre-expansion) patients.
Conclusions
The studies described in this review have demonstrated that
RSM can detect some of the hotspot TP53 mutations in premalignant tissues. This is important for several reasons. Firstly,
it may identify high risk cancer patients and represent a useful
prognostic marker. Secondly, the pro®les of the TP53 mutations may allow speculation as to the causative mutagenic
exposures which may ultimately lead to reduced exposures in
the future.
RSM has been shown here to detect mutations in situations
where previous studies have failed. This is a consequence of
the sensitivity of RSM being much greater (1000-fold) than the
sensitivity of standard methods used to detect DNA sequence
changes (sequencing, SSCP, etc.). Hence, RSM may be a
suitable tool for cancer research. Here we have described the
detection of TP53 mutations, but one advantage of RSM is that
it is readily applicable to other genes and, hence, early
mutation detection in the APC gene (in colorectal cancer), Ras
genes (in colorectal and pancreatic cancer), etc. is eminently
possible. The data illustrated here on TP53 mutation detection
may underestimate the total number of TP53 mutations in these
tissues, due to the fact that mutations at codon 273, a frequent
event in tumours (Figure 3), cannot be studied by RSM due to
the lack of a RE site at this position. Extension of RSM analysis
to this codon, either by the introduction of arti®cial RE sites at
codon 273 or by the availability of new REs in the future,
would increase the power of RSM to detect tumour-speci®c
TP53 mutations.
We have shown here similarities between upper gastrointestinal tract TP53 mutation patterns and those induced
experimentally by H2O2. This similarity was more marked for
9
G.J.S.Jenkins
gastric tissue samples. Hence, this may suggest that the early
stages of gastric cancer may be caused by ROS due to
in¯ammation of the stomach, in part perhaps through infection
with H.pylori. In the bladder, we can suggest that the lack of
CpG mutations and the presence of transversions found here
indicate exogenous mutagens, possibly nitrosamines. In the
case of the colon tissues, not enough data are available to make
any speculative estimates as to mutagen exposure.
The idea of pre- and post-expansion mutated cells explaining
the detection rate of TP53 mutations by RSM is particularly
interesting. It has recently been suggested that spontaneous
mutations may be induced during the early growth and
development phases of animals, as a consequence of their
higher proliferation rates (Frank and Nowak, 2003), hence
leaving young people with a clutch of pre-expansion mutations
ready for clonal evolution. These early life mutations (which
are an inevitability) do not pose a risk for cancer development,
whereas once expansion occurs, leading to a large clone of
mutated cells, there is a palpable risk. Given that DNA
mutations can only be detected (even by sensitive methods like
RSM) after clonal expansion, the threshold of detection (1:10
000) of RSM may prove to be useful in separating the expanded
mutant cells that correlate with increased risk from preexpansion cells, which pose a lower risk. This will only be
shown after further studies are complete. Therefore, the fact
that mutation systems are not sensitive may not be important so
long as they can separate pre- and post-expansion mutations
which directly modulate an individual's cancer risk.
Acknowledgements
I wish to thank Professor J.M. Parry for his help and advice over the course of
these studies. In addition I would like to thank Claire Morgan, Gethin Williams
and Ken Ivil who carried out the gastric, colon and bladder studies,
respectively. Finally, thanks to the clinicians who provided the clinical
samples, Professor J.N. Baxter, Mr J. Beynon, Dr A.P. Grif®ths and Mr T.
Stephenson.
References
Aguilar,F., Hussain,S.P. and Cerutti P. (1993) A¯atoxin B1 induces the
transversion of G to T in codon 249 of the p53 tumor suppressor gene in
human hepatocytes. Proc. Natl Acad. Sci. USA, 90, 8586±8590.
Albertini,R.J., Castle,K.L. and Borcherding,W.R. (1982) T-cell cloning to
detect the mutant 6-thioguanine resistant lymphocytes present in human
peripheral blood. Proc. Natl Acad. Sci. USA, 79, 6617±6621.
Ambs,S., Bennett,W.P., Merriam,W.G. et al. (1999) Relationship between p53
mutations and inducible nitric oxide synthase expression in human
colorectal cancer. J. Natl Cancer Inst., 91, 86±89.
Ames,B.N., Lee,F.D. and Durston,W.E. (1973) An improved bacterial test
system for the detection and classi®cation of mutagens and carcinogens.
Proc. Natl Acad. Sci. USA, 70, 782±786.
Bouf¯er,S.D., Kemp,C.J., Balmain,A. and Cox,R. (1995) Spontaneous and
ionizing radiation induced chromosomal abnormalities in p53 de®cient
mice. Cancer Res., 55, 3883±3889.
Bramble,F.J. (1982) The treatment of adult enuresis and urge incontinence
with enterocystoplasty. Br. J. Urol., 54, 693.
Cadwell,C. and Zambetti,G.P. (2001) The effects of wild type p53 tumour
supressor activity and mutant p53 gain of function on cell growth. Gene,
277, 15±30.
Chen,J.X., Zheng,C.Y., West,M. and Tang,M. (1998) Carcinogens
preferentially bind at methylated CpG in the p53 mutational hotspots.
Cancer Res., 58, 2070±2075.
Cooper,D.N. and Krawczak,M. (1993) Human Gene Mutation. Bios Scienti®c
Publishers, Oxford, UK.
Cotton,G.H. (1989) Detection of single base changes in nucleic acids.
Biochem. J., 263, 1±10.
Denissenko,M.F., Chen,J.X., Tang,M. and Pfeifer,G.P. (1997) Cytosine
methylation determines hot spots of DNA damage in the human p53
gene. Proc. Natl Acad. Sci. USA, 94, 3893±3898.
Denissenko,M.F., Pao,A. and Pfeifer,G.P. (1998) Slow repair of bulky DNA
10
adducts along the nontranscribed strand of the human p53 gene may explain
the strand bias of transversion mutations in cancers. Oncogene, 16, 1241±
1247.
Etzioni,R., Urban,N., Ramsey,S., McIntosh,M., Schwartz,S., Reid,B.,
Radich,J., Anderson,G. and Hartwell,L. (2003) The case for early
detection. Nature Rev. Cancer, 3, 243±252.
Fearon,E.R. and Vogelstein,B. (1990) A genetic model for colorectal
carcinogenesis. Cell, 61, 759±767.
Filmer,R.B. and Spencer,J.R. (1990) Malignancies in bladder augmentations
and intestinal conduits. J. Urol., 143, 671.
Frank,S.A. and Nowak,M.A. (2003). Developmental predisposition to cancer.
Nature, 422, 494.
Fukasawa,K., Choi,T., Kuriyama,R., Rulong,S. and Vande Woude,G.F. (1996)
Abnormal centrosome ampli®cation in the absence of p53. Science, 271,
1744±1747.
Gossen,J.A., de Leeuw,W.J.F., Tan,C.H.T, Zwarthoff,E.C., Berends,F.,
Lohman,P.H.M., Knook,D.L. and Vijg,J. (1989) Ef®cient rescue of
integrated shuttle vectors from transgenic mice: a model for studying
mutations in vivo. Proc. Natl Acad. Sci. USA, 86, 7971±7975.
Harris,C.C. (1998) Tumor suppressor genes: at the crossroads of molecular
carcinogenesis, molecular epidemiology and cancer therapy. Lung Cancer,
18, 113.
Havre,P.A., Yuan,J., Hedrick,L., Cho,K.R. and Glazer,P.M. (1995) p53
inactivation by HPV16 E6 results in increased mutagenesis in human
cells. Cancer Res., 55, 4420±4424.
Hainaut,P. and Hollstein,M. (2000) p53 and human cancer: the ®rst ten
thousand mutations. Adv. Cancer Res., 77, 81±137.
Hernandez-Boussard,T., Rodriguez-Tome,P., Montesano,R. and Hainaut,P.
(1999) IARC p53 mutation database: a relational database to compile and
analyse p53 mutations in human tumors and cell lines. Hum. Mutat., 14, 1±8.
International Agency for Research on Cancer (1994) IARC Monographs on the
Evaluation of the Carcinogenic Risks to Humans. Vol. 61, Schistosomes,
Liver Flukes and Helicobacter pylori. IARC, Lyon.
Jackson,A.L. and Loeb,L.A. (2001) The contribution of endogenous sources of
DNA damage to multiple mutations in cancer. Mutat. Res., 477, 7±21.
Jankowski,J.A., Wright,N.A., Meltzer,S.J., Triada®lopoulos,G., Geboes,K.,
Casson,A.G., Kerr,D. and Young,L.S. (1999) Molecular evolution of the
metaplasia±dysplasia±adenocarcinoma sequence in the esophagus. Am. J.
Pathol., 154, 965±973.
Jenkins,G.J.S. and Parry,J.M. (2000) Restriction Site Mutation (RSM) analysis
of 2-acetylamino¯uorene (2-AAF) induced mouse liver mutations and
comparison with the measurement of in vivo micronucleus induction in the
bone marrows of (2-AAF) treated mice. Teratog. Carcinog. Mutagen., 20,
107±117.
Jenkins,G.J.S., Mitchell,I.deG. and Parry,J.M. (1997) Enhanced restriction site
mutation analysis of 1,2-dimethylhydrazine induced mutations, using
endogenous p53 intron sequences. Mutagenesis, 12, 117±123.
Jenkins,G.J.S., Chalestori,M.H., Song,H. and Parry,J.M. (1998) Mutation
analysis using the restriction site mutation (RSM) assay. Mutat. Res., 405,
209±220.
Jenkins,G.J.S., Takahashi,N. and Parry,J.M. (1999a) A study of ENU induced
mutagenesis in the mouse using the restriction site mutation (RSM) assay.
Teratog. Carcinog. Mutagen., 19, 281±292.
Jenkins,G.J.S., Suzen H.S., Sueiro,R.A. and Parry,J.M. (1999b) The Restriction
Site Mutation (RSM) assay. A review of the methodology development and
the current status of the technique. Mutagenesis, 14, 439±448.
Jenkins,G.J.S., Morgan,C., Parry,E.M., Baxter,J.N. and Parry,J.M. (2001) The
detection of mutations induced in vitro in the human p53 gene by a model
Reactive Oxygen Species (ROS) employing the Restriction Site Mutation
(RSM) Assay. Mutat. Res., 498, 135±144.
Jenkins,G.J.S., Doak,S.H., Parry,J.M., D'Souza,F.R. Grif®ths,A.P. and
Baxter,J.N. (2002) Barrett's oesophagus: the genetic pathways involved in
its progression to adenocarcinoma. Br. J. Surg., 89, 824±837.
Jenkins,G.J.S., Doak,S.H., Grif®ths,A.P., Baxter,J.N. and Parry,J.M. (2003)
Early p53 mutations in non-dysplastic Barrett's tissues detected by the
restriction site mutation (RSM) methodology. Br. J. Cancer, 88, 1271±
1276.
Kohler,S.W., Provost,G.S., Fieck,A. Kretz,P.L., Bullock,W.O., Sorge,J.A.
Putman,D.L. and Short,J.M. (1991) Spectra of spontaneous and mutagen
induced mutations in the lac I gene in transgenic mice. Environ. Mol.
Mutagen., 18, 316±321.
Kraemer,K.H. and Seidman,M.M. (1989) Use of supf, an Escherichia-coli
tyrosine suppressor transfer-rna gene, as a mutagenic target in shuttle-vector
plasmids. Mutat. Res., 220, 61±72.
Krawczak,M. and Cooper,D.N. (1996) Single base pair substitutions in
pathology and evolution: two sides to the same coin. Hum. Mutat., 8, 23±31.
Lutz,W.K., Fekete,T. and Vamvakas,S. (1998) Position and base pair speci®c
The restriction site mutation method
comparison of p53 mutation spectra in human tumors: elucidation of
relationships betweens organs for cancer etiology. Environ. Health
Perspect., 106, 207±211.
Mirvish,S.S. (1995) Role of N-nitroso compounds (NOC) and N-nitrosation in
etiology of gastric, esophageal, nasopharangeal and bladder cancer and
contribution to cancer of known exposures to NOC. Cancer Lett., 93, 17±48.
Mollaoglu,N., Wilson,M.J. and Cowpe,J.G. (2001) Extraction of DNA from
cytological samples by scraping and smear method suitable for restriction
site mutation analysis: a pilot study. Diagn. Cytopathol., 25, 83±85.
Morgan,C., Jenkins,G.J.S., Ashton,T., Grif®ths,P., Baxter,J.N., Parry,E.M. and
Parry,J.M. (2003) The detection of p53 mutations in pre-cancerous gastric
tissue using the RSM assay. Br. J. Cancer, 89, 1314±1319.
Nurse,D.E. and Mundy,A.R. (1989) Assessment of the malignant potential of
cystoplasty. Br. J. Urol., 64, 489.
Parry,J.M., Shamsheer,M. and Skibinski,D. (1990) Restriction site mutation
analysis, a proposed methodology for the detection and study of DNA base
changes following mutagen exposure. Mutagenesis, 5, 209±212.
Perwez Hussain,S. and Harris,C.C. (2000) Molecular epidemiology and
carcinogenesis: endogenous and exogenous carcinogens. Mutat. Res., 462,
311±322.
Perwez Hussain,S., Amstad,P., Raja,K. et al. (2000) Increased p53 mutation
load in noncancerous colon tissue from ulcerative colitis: a cancer prone
chronic in¯ammatory disease. Cancer Res., 60, 333±337.
Pingoud,A. and Jeltsch,A. (2001) Structure and function of type II restriction
endonucleases. Nucleic Acids Res., 29, 3705±3727.
Schneider,P.M., Stoeltzing,O., Roth,J.A. et al. (2000) P53 mutational status
improves estimation of prognosis in patients with curatively resected
adenocarcinoma in Barrett's esophagus. Clin. Cancer Res., 6, 3153±3158.
Shahin,W. and Murray,J.A. (1999) Esophageal cancer and Barrett's
esophagus: how to approach surveillance, treatment and palliation.
Postgrad. Med., 105, 111±127.
Song,H., Jenkins,G.J.S., Ashby,J. and Parry,J.M. (2001) The application of the
RSM assay to compare 1-ethyl-1-nitrosourea induced mutations between
the endogenous p53 gene and the transgenic LacZ gene in MutaMouse
testes. Mutagenesis, 16, 59±64.
Sueiro,R.A., Jenkins,G.J.S., Lyons,B.P., Harvey,J.S. and Parry,J.M. (2000)
Benzo[a]pyrene induced mutagenicity depends on the sequence context in
the ¯ounder p53 gene. Mutat. Res., 468, 63±71.
Suzen,S., Jenkins,G.J.S. and Parry,J.M. (1998) The application of the
restriction site mutation technique to N-methyl-N-nitrosourea induced
mutations in the rat. Teratog. Carcinog. Mutagen., 18, 171±182.
Uchino,S., Noguchi,M. and Ochiai,A. (1993) P53 mutation in gastric-cancerÐ
a genetic model for carcinogenesis is common to gastric and colorectalcancer. Int. J. Cancer, 54, 759±764.
Wabl,M., Burrows,P.D., von Gabain,A. and Steinberg,C. (1982)
Hypermutation at the immunoglobulin heavy chain locus in a pre-B cell
line. Proc. Natl Acad. Sci. USA, 82, 479±482.
Williams,G.L., Jenkins,G.J.S., Parry,J.M. and Beynon,J. (2002) The detection
of early p53 mutations in colorectal polyps using the RSM method. Br. J.
Surg., 86, S73.
Williams,L.,
Williams,J.G.,
Grif®ths,A.P.,
Brown,T.,
Doak,S.H.,
Jenkins,G.J.S., Parry,E.M. and Parry,J.M. (2003) Interphase FISH to
detect chromosomal abnormalities in gastric cancer progression. Gut, 52,
A50.
Received on June 23, 2003; revised and accepted on September 25, 2003
11