[CANCER RESEARCH 50. 1596-1600. March 1. 1990)
Expression of Mitochondria! Cytochrome c Oxidase in Human Colonie Cell
Differentiation, Transformation, and Risk for Colonie Cancer1
Barbara G. Heerdt,2 Heidi K. Halsey, Martin Lipkin, and Leonard H. Augenlicht
Monleflore and Albert Einstein Medical Centers. Department of Oncology, Bronx, New York 10467 [B. G. H., H. K. H., L. H. A.], and Sloan-Kettering Cancer Center,
New York, New York 10021 ¡M.L.J
ABSTRACT
In a panel of eight cloned complementary DNA sequences whose level
of expression characterize colon cells as transformed in vivo and in vitro,
one which may also serve as a marker of risk in familial polyposis and
familial colon cancer flat mucosa has been identified as mitochondrial
cytochrome c oxidase subunit 3. Mean level of expression of cytochrome
c oxidase subunit 3 decreases progressively in colon adenomas and
carcinomas relative to normal mucosa in vivo, and returns to higher levels
present in biopsies of normal mucosa when the HT29 human colonie
adenocarcinoma cell line is induced to differentiate with sodium butyrate.
Quantitation of cytochrome c oxidase subunit 3 DNA by dot blots
indicated that these changes in expression were not associated with
alterations in the number of mitochondrial genomes.
INTRODUCTION
Small biopsies of normal appearing flat colonie mucosa can
be obtained by sigmoidoscopy or colonoscopy of patients at
varying risk for developing colorectal cancer. Such human
biopsies yield very small amounts of RNA which are insufficient
for standard Northern or dot blot analysis of gene expression.
However, utilizing a computer scanning and image processing
system which quantitates the relative level of hybridization of
cDNA3 probes made from polyadenylated RNA from such
biopsies to each clone in a reference library, we found that 25%
of 379 sequences screened in the high risk fiat mucosa from
patients with familial polyposis differed in mean level of expres
sion as compared to the flat mucosa of patients at low risk (i.e.,
sequences which increased in expression by >200%, or de
creased by >60%; Ref. l). This pronounced perturbation in
gene expression was much greater than that present in either
adenomas or carcinomas as compared to the normal, low risk
fiat mucosa (1).
The complexity of change at the genetic level makes it diffi
cult to determine which individual sequences are fundamental
to the process of colon cell transformation and which may also
be markers of risk for tumor development. One approach to
identifying such sequences is to investigate those whose level of
expression characterize not only the progression to transfor
mation and/or risk in clinical samples, which is complicated by
the heterogeneity of cell types in the tissue, but those which
characterize the in vitro induction of differentiation of colonie
epithelial cell lines as well. Utilizing this approach, our analyses
identified 8 sequences which exhibited approximately equal but
opposite modulations in mean level of expression during trans
formation in vivo and induced differentiation of colonie carci
noma cells in vitro. In this report, we identify one of these
Received 2/15/89; revised 8/7/89, 11/14/89; accepted 11/15/89.
The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1Supported in part by Grants CA41372, CA40558, and P30-CA13330 from
the National Cancer Institute, Grant SIG-7 from the American Cancer Society,
and a grant from the Aaron Diamond Foundation.
2To whom requests for reprints should be addressed, at Department of
Oncology, Montefiore and Albert Einstein Medical Centers, 111 East 210th St.,
Bronx, NY 10467.
3The abbreviations used are: cDNA. complementary DNA; COI 11,cytochrome
c oxidase subunit 3; GARD, glyceraldehyde-3-phosphate dehydrogenase (ATCC
57090).
sequences as a mitochondrial gene. The in vitro and in vivo data
indicate that expression may be closely linked to normal differ
entiation of colonie epithelial cells, and that reduced expression
may be a marker of risk in the fiat mucosa of patients in two
high risk groups: familial polyposis and familial colon cancer.
MATERIALS
AND METHODS
Gene expression was assayed in human biopsies and in HT-29 cells
by using computer driven scanning and image processing as previously
described in detail (1). This consisted of hybridization of cDNA probes
prepared from tissue or cell polyadenylated RNA to a reference HT-29
cDNA library which was stored, replicated, and hybridized in a pat
terned array. Scanning resulted in digitization of the hybridization data
and an image processing program, which smoothed the image and
corrected for background, and produced data on the level of expression
of each cDNA clone in each biopsy or cell preparation assayed relative
to mean hybridization for all clones for that tissue (1).
Northern blots were done with formaldehyde gels as described (2).
Hybridization and washing conditions have been described elsewhere
(3).
A dot blot methodology was developed for quantitation of relative
copy number of DNA sequences. EcoRl digested DNA was denatured
by heating and was applied to nitrocellulose by using a 96-well dot blot
apparatus (Schleicher & Scimeli). Each DNA sample was placed in
duplicate wells on replicate blots, the duplicates being at distant posi
tions on the dot blot grid. Background positions, also at least in
duplicate at distant positions on each blot, contained only enzyme and
reaction buffer. Following hybridization to probe 50F1/COIII insert;
ß-globin,(4); c-myc [pMc41-5pp; (5)]; N-myc [pBe(2)-c-59; (6)]; c-Kirasi [pCDck76; (7)]; v-Ki-ras [HÌHÌ3
(8)], or aldehyde dehydrogenase
(American Type Culture Collection), and autoradiographic exposure,
individual spots were cut from the blot, placed in a scintillation vial
with Hydrofluor (National Diagnostics), and counted in a Packard TriCarb. Mean background cpm were subtracted from the mean cpm of
duplicates on each replicate blot.
Relative levels of hybridization were calculated from these data
following standardization of hybridization to 0-globin: 1 ng of DNA
was applied to each well of replicate blots. One blot was hybridized to
0-globin and used for standardization of DNA content per dot, while
the replicate was hybridized to a target sequence (e.g., 50F1/COIII, cmyc, c-Ki-rai2). Using placenta J as base line, 0-globin hybridization
standardizing factors (S.F.) were calculated for each sample as follows:
S.F. = X corrected cpm 7 DNA
X corrected cpm test DNA
Relative sequence hybridization was then calculated by using:
(A' corrected cpm test DNA) (S.F.)
X corrected cpm J DNA
At least three independent determinations (each in duplicate) were
made for each DNA sample. As a control, blots were also hybridized
to the vector PBR322.
The patient populations from which biopsies were obtained have
been described in detail (1) and consist of 6 low risk individuals with
no colon or other cancer for at least 2 generations; 7 high risk individ
uals with familial polyposis; adenomas from 6 individuals with poly
posis; and 6 individuals with colon carcinoma. In addition, the flat
mucosa of 12 individuals in high risk familial colon cancer families
1596
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.
MITOCHONDRIAL
CYTOCHROME
c OXIDASE IN HUMAN COLONIC CELLS
here, out of an original 4000 analyzed, were chosen because
they exhibit quantitatively equivalent, but opposite, changes in
expression in the progression from normal mucosa to adenoma
to carcinoma in vivo, and induction of differentiation in vitro
(1).
As shown in Fig. 1, top, clones 50F1 and 51C7 (O) lie farthest
from a line indicating equality of expression in comparing low
and high risk tissues. On the other hand, these same 2 clones
are expressed at approximately equal levels in the high risk
tissue as in carcinomas (Fig. I, bottom), as indicated by the fact
that they lie approximately on the line of equality for these two
tissues. We therefore focused further effort on one of these,
clone 50F1.
Sequence analysis revealed that 50F1 exhibits 99% homology
to the 3' end of subunit 3 of human mitochondrial cytochrome
were analyzed (9, 19). Biopsies taken during sigmoidoscopy were prin
cipally of mucosa in normal or flat tissue, but in all tissues contain a
mixture of epithelial and stromal cells, and lymphocytes.
Growth of HT-29 cells and induction of differentiation with 5 mM
sodium butyrate, as originally described by Kim et al. (10), have also
been described elsewhere (1).
DNA sequence analysis by the method of Sanger et al. (11), using
Sequenase (USB Corp.) was done following subcloning of the 50F1/
COIII insert into pGEM-3Z (Promega) or M13mpl9.
RESULTS
Fig. 1 presents a comparison of the mean level of expression
of 8 cloned sequences in biopsies of high risk familial polyposis
flat mucosa as compared to flat mucosa from individuals at low
risk for development of colon cancer. The data were generated
by scanning and image processing of an autoradiogram of an
array of cloned sequences hybridized to a cDNA probe made
from each biopsy as described in "Materials and Methods" and
c oxidase (12) and hence will be referred to as COIII (Fig. 2).
The single mismatch (T/C at position 9698 of the COIII gene)
leaves the amino acid sequence intact (i.e., both CTC and CTT
encode leucine).
Expression of COIII was assayed in the HT29 colon carci
noma cell line induced to differentiate with sodium butyrate
(Fig. 3). The data were generated and calculated as described
in Ref. l. The procedure calculates the data for each clone as
the ratio to the average hybridization of all clones (numbers on
the ordinate and abscissa of Fig. 1). This procedure, therefore,
standardizes the data between experiments in a manner similar
to standardization of hybridization of blots to a control se
quence such as GAPD or actin. However, in this case, stand
ardization is to the average level of expression of a large number
of sequences (379) and is based on quantitation of hybridization
of each. Examples of the autoradiograms from which the data
are obtained have been published (1). The 8 sequences shown
10
20
30
40
50
TCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCA
50F1
60
HUMMT
TCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCA
9633
70
80
90
100
110
CTGCTCATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTC
X
CTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTC
9693
130
140
150
160
170
GAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGC
120
180
0 SOPÌ
GAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGC
9753
190
200
210
220
230
TTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAA
t/J
s
0 51C7
240
TTCCÕCGGÕCTTCACGTCATTÕTTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAA
9813
250
260
270
280
290
CTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGG
/
300
CTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGG
9873
310
320
330
340
350
CATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCT
*
CATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCT
9933
'
Fig. 2. DNA sequence analysis. The nucleotide sequence of clone 50F1 was
compared to the sequence of subunit III of mitochondrial cytochrome c oxidase
(11).
75
o
zZ
60
3
u
0)
O)
51C7/
Ox
45
-
O
:* 30
123456
15
HIGH RISK
Fig. 1. Expression of cloned sequences in high and low risk colonie mucosa
and colon carcinomas. The expression of 8 cloned cDNA sequences were com
pared in high risk flat colonie mucosa (abscissa) to the expression in low risk
normal mucosa (ordinate, top) or colon carcinomas (ordinate, bottom). Expression
was quantitated by using an image scanning and processing system as described
in "Materials and Methods" and in Ref. l. Numbers on the axes are the ratio of
expression of each of the sequences shown to the mean level of expression of all
379 sequences in the data base. These values were calculated for each biopsy or
tissue culture sample.
, theoretical line of equality for expression in the
high risk and low risk mucosa {lupi and the high risk mucosa and carcinomas
(bottom). Each circle represents one of the eight sequences. Sequences of interest
in terms of risk are highlighted as open circles.
20
40
60
80
100
Na Butyrate
(Hrs)
Fig. 3. Expression of 50F1 in vitro. The relative level of 50F1 was determined
in cells by an image processing and scanning system described in "Materials and
Methods" and Ref. 1. Levels of hybridization of clone 50F1/COIII to probes of
polyadenylated RNA from HT29 cells induced to differentiate by exposure to 5
mM sodium butyrate for 24, 48, or 96 h (abscissa). Hybridization (ordinate) is
expressed as a percentage of the untreated control HT29 cells, and were calculated
as described above.
1597
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.
MITOCHONDRIAL
CVTOCHROME
c OXIDASE IN HUMAN COLONIC CELLS
above, expression of COIII in HT29 cells having been stand
ardized to the average level of hybridization of all 379 clones
in the data set. The data are presented as the percent change
from untreated cultures for the butyrate induction of differen
tiation in vitro. Expression of COIII begins to rise by 24 h, and
increases by 35 and 70% at 48 and 96 h, respectively, compared
to untreated controls.
The elevated expression of COIII following butyrate induc
tion was also investigated by using more standard analyses. Fig.
4A presents Northern blot analysis of RNA from HT29 cells
fractionated in a formaldehyde gel and hybridized to the COIII
cDNA. COIII hybridizes to two RNA molecules of distinct size
and both are markedly elevated by sodium butyrate as early as
12 h after induction. The lower band is the size of the mature
message of the 780-base sequence of the human mitochondria!
COIII gene (12). The upper band is unidentified, but its size is
consistent with a previous report (13) showing that mitochon
dria! RNA species 15 (COIII) and 14 can be identified as a
single abundant band in the mitochondria! polyadenylated frac
tion even under denaturing conditions (13).
Fig. 4B is the ethidium bromide stained gel from this exper
iment showing that approximately equivalent amounts of RNA
were loaded for each of the lanes. This observation was repeated
C
12
48
96
C
5 times over 3 separate experiments, with both formaldehyde
gels, as shown, and following denaturation of RNA by glyoxylation. In a fourth experiment, shown in Fig. 4C, a Northern
blot of RNA from control HT29 cells (C) or cells treated for
96 h with sodium butyrate (96) was first hybridized to GAPD
to confirm equivalent loading of RNA (Fig. 4C, left). The blot
was then rehybridized to the COIII probe without stripping the
GAPD probe in order to minimize the potential for differential
loss of RNA from the blot (Fig. 4C, right). COIII is clearly
elevated at 96 h of butyrate treatment relative to GAPD.
The three different ways of standardizing for RNA expression
which we have used (mean level of expression of a large number
of sequences, quantitation of total RNA by staining the blot,
and hybridization to GAPD) emphasize an important point.
Quantitative dot blot analysis of the RNA used in Fig. 4C
demonstrates that relative to GAPD, the elevation of COIII
expression is 4-fold (not shown). In the same experiment, actin
expression was elevated 2-fold relative to GAPD at 96 h, which
is consistent with changes in microvilli and polarization of the
cells following butyrate treatment. Clearly, had we standardized
the blots to actin rather than GAPD, the elevation of COIII
would be about one-half that shown. Therefore, although all
three methods reveal an elevation of COIII expression following
12 48 96
•¿Â»
- com
—¿
GAPD
- con
Fig. 4. Northern blot analysis of RNA. RNA was prepared from control HT29 cells or those induced to differentiate by exposure to sodium butyrate. A, 20 fig of
RNA was fractionated by electrophoresis in a 1.0% agarose gel containing formaldehyde, transferred to nitrocellulose, and hybridized to a BgH-EcoRl insert from the
plasmid SOF1/CO1II labeled with 'Ì*
by nick translation. Arrows indicate the position of migration of 28S and 18S rRNA in this gel. />'.ethidium bromide stained
gel before transfer. C, RNA was fractionated, transferred, and hybridized from control HT29 cells and cells treated for 96 h with 5 mM sodium butyrate. The left side
of the figure shows the blot hybridized to a probe for GAPD; the right side is the same blot rehybridized to the 50F1/COIII probe described above. The GAPD probe
was not stripped before rehybridization of the blot to the 50F1/COIII probe described above.
1598
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.
MITOCHONDRIA!.
CYTOCHROME
c OXIDASE IN HUMAN COLONIC CELLS
butyrate treatment, we believe that the data in Fig. 3, in which
the level of expression is standardized to the mean level of
expression of a large number of polyadenylated sequences, is a
particularly useful quantitation and reflection of the kinetics of
the changes occurring.
The limited amount of polyadenylated RNA which can be
isolated from human biopsies (<50 ng) precludes standard
Northern blot analysis. However, Fig. 5 presents the data on
expression of COIII in colonie biopsies determined by scanning
and image processing (above). The important observation is
that the mean level of expression decreases progressively in
adenomas and carcinomas compared to the normal mucosa of
low risk individuals, and that in the flat mucosa of two high
risk groups (familial polyposis and familial colon cancer), the
mean level of expression is similar to the carcinoma samples,
not the normal mucosa. The higher levels of expression which
characterize induced differentiation (Fig. 3) are limited to biop
sies of the normal mucosa and adenoma, suggesting that higher
levels of COIII truly characterize well differentiated cells in the
normal mucosa, and that such characteristics are lost in pro
gression to malignancy and in risk.
Alterations in mitochondrial number have been reported in
transformed cells (14). We therefore utilized a method of DNA
quantitation using dot blots (described in "Materials and Meth
ods") to investigate whether modulation in COIII expression
during transformation
and differentiation
was reflecting
changes in the number of mitochondrial genomes. In this
procedure, hybridization is quantitated by cutting out and
counting replicate dots. Standardization is by quantitating hy
bridization to /3-globin. We have shown elsewhere (15) that the
results obtained by this quantitative method are confirmed by
Southern blot analysis.
DNA dot blots indicate that changes in COIII expression are
not due to alterations in mitochondrial genome number. As
shown in Fig. 6, the COIII copy number in control HT29 cells
is comparable to that of cells induced with sodium butyrate for
96 h. The copy number of COIII in DNA prepared from 12
primary colon tumors is comparable to the levels in grossly and
histologically normal colon tissue obtained from 9 of these 12
8 -
CO
V)
ID
cc
I
Q.
X
HI
n-7
4 -
n-7
n-12
LU
T
LU
OC
fee
Tiucosa
Tissue
Fig. 5. Expression of 50F1 in human biopsy tissues. Relative levels of expres
sion of 50F1 in human biopsies was determined and calculated as described in
Ref. 1 and "Materials and Methods," and in the legend to Fig. 1. Snap frozen
biopsies were taken from colon adenomas and carcinomas, from the flat mucosa
of patients at low genetic risk for development of colorectal cancer, and from the
flat mucosa of patients in two high risk groups, familial polyposis and familial
colon cancer. Columns, mean for each group; bars, SEM. n, number of patients
in each group, fee, familial colon cancer.
Fig. 6. Quantitation of gene copy number. EcoRl digested DNA from HT29
cells treated with 5 mivisodium butyrate for 96 h and control cells, and 12 colonie
tumors and normal mucosa adjacent to 9 of these tumors, was denatrued by
heating and was applied to nitrocellulose by using a 96-well dot blot apparatus.
Hybridization to 50F1/CO1II, c-myc, and Kiras of replicate blots was quantitated
and corrected for DNA amount per spot by hybridization to a fi-globin probe and
standardized between experiments by inclusion of a standard placental DNA
preparation on each blot, as described in "Materials and Methods."
, range
of hybridization for 6 different placental DNA preparations did not differ for the
three probes.
patients. Fig. 6 also illustrates that colonie tissues contain
multiple copies of mitochondrial COIII relative to single copy
genomic sequences (human c-myc, and viral Ki-ras; human Nmyc and aldehyde dehydrogenase II; not shown) and approxi
mately 3-fold higher copy number of COIII than in placental
tissue (range of data for 6 different placentas is indicated by the
broken lines in Fig. 6). Further, careful analysis of mitochon
drial DNA with a probe representing the entire mitochondrial
genome does not reveal any deletions in mitochondria in more
than 30 colorectal tumors.4
DISCUSSION
Both transformation and differentiation are brought about
by shifts in patterns of gene expression which determine the
phenotype of the cell. For colon carcinoma, we have demon
strated this in both a chemically induced mouse model system
(16) and in human colon cancer (1). This is consistent with
recent evidence that there is an accumulation of genetic lesions
as colon tumors progress through benign to malignant states
(17, 18). The data presented in this report demonstrate that
changes in expression of a mitochondrial gene, COIII, represent
a marker of progressive transformation in vivo as well as of in
vitro differentiation of colonie epithelial cells, and that low
levels of expression may also characterize high risk polyposis
and familial colon cancer mucosa from normal low risk mucosa.
It is unlikley that the altered expression reflects gains or losses
of mitochondrial DNA, since sequence quantitation by DNA
dot blots did not detect any changes in COIII copy number in
the colonie tissues and cells, and was sensitive enough to detect
increased copies in colonie tissue relative to placenta.
Consistent with the pattern of expression reported here,
expression of mitochondrial COI has also been found at higher
levels in cell lines from well differentiated human colon carci
nomas as compared to those from moderately and poorly
differentiated colon carcinomas.5 However, human biopsies
consist of heterogeneous
and variable cell populations.
4 Manuscript submitted.
5 L.B. Chen et al., personal communication.
1599
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.
This
MITOCHONDRIA!.
CYTOCHROME
c OXIDASE IN HUMAN COLON1C CELLS
may contribute to the overlap between groups reflected in the
error bars of Fig. 5. It remains to be determined whether assay
of COIII activity in individual cells within biopsies can be used
as an effective way to monitor progression of disease or distin
guish flat mucosa of varying relative risk.
The relationship between these alterations in COIII expres
sion and differentiation/transformation
of colonie epithelial
cells is unknown. The most direct interpretation is that modu
lations in expression of a mitochondrial sequence are related to
energy metabolism by the tissue. However, if this is the case,
then it is unclear whether the changes represent an aspect of
the pleiotropic response of the cells to differentiation and
transformation signals or are more fundamental to initiating
these processes. For example, the short chain fatty acid sodium
butyrate is a natural product of colonie microflora (20) present
in very high concentrations in the gut (21 ), where it is a principal
energy source for colonie epithelial cells (22). Sodium butyrate
has also been implicated experimentally in ruminants as a
promotor of colonie cell differentiation (23, 24). It is, therefore,
possible that an intimate biochemical relationship has evolved
between the utilization of various energy sources by colonie
epithelial cells and their ability to differentiate normally. This
is consistent with the fact that in inducing differentiation of
colon carcinoma cells by glucose deprivation (25-27), associ
ated structural and functional alterations of the mitochondria
have been reported (28).
Mitochondria of tumor cells, although similar to mitochon
dria from normal cells when isolated, differ markedly from
normal in colon and other tumors, as well as in cells trans
formed by v-fos, when assayed for a variety of structural and
functional features (29-31). The mitochondrial genome is di
rectly modified by chemical carcinogens to a far higher degree
than are nuclear sequences (32-34), and it will be of interest to
determine if effects on mitochondria such as those reported
here and previously reported (29-31) are due to direct interac
tion of carcinogens and inducers of differentiation with the
mitochondrial genome.
REFERENCES
1. Augenlicht, L. H., Wahrman, M. Z., Halsey, H., Anderson, L.. Taylor. J..
and Lipkin. M. Expression of cloned sequences in biopsies of human colonie
tissue and in colonie cells induced to differentiate in vitro. Cancer Res., 47:
6017-6021, 1987.
2. Maniatis, T., Fritsch, E. F., and Sambrook. J. Extraction, purification, and
analysis of mRNA from eukaryotic cells. In: Molecular Cloning: A Labora
tory Manual, pp. 187-210, Cold Spring Harbor. NY: Cold Spring Harbor
Laboratory, 1982.
3. Yander, G., Halsey, H., Kenna, M., and Augenlicht, L. H. Amplification and
elevated expression of c-myc in a chemically induced mouse colon tumor.
Cancer Res.. 45: 4433-4438, 1985.
4. Collins, F. S.. and Weissman. S. M. The molecular genetics of human
hemoglobin. Prog. N. Acids Res. Mol. Biol., 31: 315-462. 1984.
5. Dalla Pavera, R., Gelmann, E. P., Martionotti. S., Franchini. G., Papa. T.
S.. Gallo, R.C., and Wong-Staal, F. Cloning and characterization of different
human sequences related to the one gene (v-myc) of avian myelocytomatosis
virus (MC-29). Proc. Nati. Acad. Sci. USA. 79: 6497-6501, 1982.
6. Michitisch, R. W., Montgomery, K., and Melera, P. W. Expression of the
amplified domain in human neuroblastoma cells. Mol. Cell. Biol., 4: 23702380. 1984.
7. McCoy, M. S., Bargmann, C. I., and Weinberg, R. A. Human colon carci
noma Ki-ras2 oncogene and its corresponding protooncogene. Mol. Cell.
Biol., 4: 1577-1582, 1984.
8. Ellis, R. W.. Lowy, D. R., and Scolnick, E. M. The viral and cellular p21
(ros) gene family. Adv. Viral Oncol.. /: 107-126. 1982.
9. Lipkin, M., Friedman, E., Winawer, S. J., and Newmark, H. Colonie epithe
lial cell proliferation in responders and nonresponders to supplemental
dietary calcium. Cancer Res., 49: 248-254. 1989.
10. Kim. Y. S., Tsao, D., Bader, S., Whitehead, J. S., Arnstein, P.. Bennett, J.,
and Hicks, J. Effects of sodium butyrate and dimethyl sulfoxide on biochem
ical properties of human colon cancer cells. Cancer (Phila.). 45: 1185-1192,
1980.
11. Sanger. F., Nicklen. S., and Coulson, A. R. DNA sequencing with chainterminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977.
12. Anderson, S., Bankier, A.T., Barrell, B. G., Bruijn, D. E., Coulson, A. R.,
Drouin, J.. Eperon, I. C., Nierlich, D. P., Roe. B. A.. Sanger. F., Schreier,
P. H., Smith. A. J. H.. and Staden. R. Sequence organization of the human
mitochondrial genome. Nature (Lond.), 290:457-465. 1981.
13. Montoya, J., Ojala, D., and Attardi, G. Distinctive features of the 5 '-terminal
sequences of the human mitochondrial mRNAs. Nature (Lond.). 290: 465474. 1981.
14. Pedersen, P. L. Tumor mitochondria and the bioenergetics of cancer cells.
Prog. Exp. Tumor Res., 22: 190-274. 1978.
15. Heerdt, B. G., and Augenlicht, L. H. Changes in the number of mitochondrial
genomes during human development. Exp. Cell Res.. 186. in press, 1990.
16. Augenlicht, L. H., and Kobrin, D. E. Cloning and screening of sequences
expressed in a mouse colon tumor. Cancer Res.. 42: 1088-1093, 1982.
17. Vogelstein, B.. Fearon, E. R., Hamilton. S. R., Kern, S. E., Preisinger, A.
C., Leppert, M., Nakamura, Y., White. R.. Smits. A. M. M., and Bos, J. L.
Genetic alterations during colorectal tumor development. N. Engl. J. Med.,
319: 525-532, 1988.
18. Law, D. J., Olschwang, S., Monpezat, J-P., Lefrancois, D., Jagelman. D..
Petrelli, N. J., Thomas, G., and Feinberg. A. Concerted nonsyntenic allelic
loss in human colorectal carcinoma. Science (Wash. DC), 241: 961-964,
1988.
19. Lipkin. M., and Newmark. H. Effect of added dietary calcium on colonie
epithelial cell proliferation in subjects at high-risk for familial colon cancer.
N. Engl. J. Med., 313: 1381-1384, 1985.
20. Englyst, H. N., Hay, S., and Macfarlane, G. T. Polysaccharide breakdown
by mixed populations of human faecal bacteria. FEMS Microbiol. Ecol., 95:
163-171. 1987.
21. Cummings, J. H.. Pomare. E. W.. Branch, W. J., Naylor, C. P. E., and
Macfarlane, G. T. Short chain fatty acids in human large intestine, portal,
hepatic and venous blood. Gut, 28: 1221-1227, 1987.
22. Roediger, W. E. W. Utilization of nutrients by isolated epithelial cells of the
rat colon. Gastroenterology. 83: 424-429, 1982.
23. Sanders, E. G., Warner, R. G.. Harrison, H. N., and Loosli, J. K. The
stimulatory effect of sodium butyrate and sodium propionate on the devel
opment of rumen mucosa in the young calf. J. Dairy Sci.. 42: 1600-1605,
1959.
24. Sakata, T., and Tamate, H. Rumen epithelial cell proliferation accelerated
by rapid increase in intraluminal butyrate. J. Dairy Sci., 61: 1109-1113,
1978.
25. Pinto, M.. Appay. M. D., Simon-Assmann, P., Chevalier, G., Dracopoli, N.,
Fogh, J., and Zweibaum, A. Enterocytic differentiation of culture human
colon cancer cells by replacement of glucose by galactose in the medium.
Biol. Cell., 44: 193-196, 1982.
26. Zweibaum, A., Pinto, M., Chevalier, G., Dussaulx, E., Triadou, N., Lacroiz,
B.. Haffen. K.. Brun, J. L.. and Rousset. M. Enterocytic differentiation of a
subpopulation of the human colon tumor cell line HT-29 selected for growth
in sugar-free medium and its inhibition by glucose. J. Cell. Physiol.. 122:
21-29, 1985.
27. Wice, B. M., Trugnan. G.. Pinto. M., Rousset, M., Chevalier, G., Dussaulx,
E., Lacroix, B., and Zweibaum, A. The intracellular accumulation of UDPyV-acetylhexosamines is concomitant with the inability of human colon cancer
cells to differentiate. J. Biol. Chem., 260: 139-146, 1985.
28. Denis-Pouxviel, C., Riesinger. L, Buhler, C., Brdiczka, D., and Murai, J-C.
Regulation of mitochondrial hexokinase in cultured HT-29 human cancer
cells. An ultrastructural and biochemical study. Biochim. Biophys. Acta. 902:
335-348, 1987.
29. Chen, L. B., Summerhayes, I. C.. Nadakavukaren, K. K., Lampidis, T. J.,
Bernai, S. D., and Shepherd, E. L. Mitochondria in tumor cells: effects of
cytoskeleton on distribution and as targets for selective killing. ///. A. J.
Levine, G. F. Vande Woude, W. C. Topp, and J. D. Watson (eds.), Cancer
Cells 1. The Transformed Phenotype, pp. 75-86. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory. 1984.
30. Davis, S., Weiss, M. J., Wong, J. R.. Lampidis, T. J., and Chen, L. B.
Mitochondrial and plasma membrane potentials cause unusual accumulation
and retention of rhodamine 123 by human breast adenocarcinoma-derived
MCF-7 cells. J. Biol. Chem., 260: 13844-13850, 1985.
31. Zarbl, H., Latrielle, J., and Jolicoeur, P. Revenants of v-yoi-transformed
fibroblasts have mutations in cellular genes essential for transformation by
other oncogenes. Cell, 51: 357-369, 1987.
32. Backer, J. M.. and Weinstein, I. B. Mitochondrial DNA is a major cellular
target for a dihydrodiol-epoxide derivative of benzo[a]pyrene. Science (Wash.
DC), 209: 297-299, 1980.
33. Allen, J. A., and Coombs, M. M. Covalent binding of polycyclic aromatic
compounds to mitochondrial and nuclear DNA. Nature (Lond.), 287: 244245. 1980.
34. Niranjan, B. G., Bhat, N. K., and Avadhani. N. G. Preferential attack of
mitochondrial DNA by aflatoxin Bl during hepatocarcinogenesis. Science
(Wash. DC), 215: 73-75, 1982.
1600
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.
Expression of Mitochondrial Cytochrome c Oxidase in Human
Colonic Cell Differentiation, Transformation, and Risk for
Colonic Cancer
Barbara G. Heerdt, Heidi K. Halsey, Martin Lipkin, et al.
Cancer Res 1990;50:1596-1600.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/50/5/1596
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1990 American Association for Cancer Research.