Tristetraprolin Regulates CXCL1 (KC)
mRNA Stability
This information is current as
of June 16, 2017.
Shyamasree Datta, Roopa Biswas, Michael Novotny, Paul G.
Pavicic, Jr., Tomasz Herjan, Palash Mandal and Thomas A.
Hamilton
J Immunol 2008; 180:2545-2552; ;
doi: 10.4049/jimmunol.180.4.2545
http://www.jimmunol.org/content/180/4/2545
Subscription
Permissions
Email Alerts
This article cites 57 articles, 39 of which you can access for free at:
http://www.jimmunol.org/content/180/4/2545.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2008 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
References
The Journal of Immunology
Tristetraprolin Regulates CXCL1 (KC) mRNA Stability1
Shyamasree Datta,2* Roopa Biswas,2† Michael Novotny,* Paul G. Pavicic, Jr.,*
Tomasz Herjan,* Palash Mandal,* and Thomas A. Hamilton3*
T
issue inflammation involves the infiltration of leukocytes
at sites of injury or infection that is regulated, in part, via
the production of chemoattractant cytokines or chemokines (1–3). Because this process exhibits significant potential for
tissue damage, it requires stringent regulation in both space and
time. The control of chemokine expression may operate at multiple
mechanistic steps, including transcription, mRNA translation, and
ultimately mRNA degradation (4 –7). In this regard, many chemokine mRNAs are known to exhibit short half-lives, and this property is subject to modulation in response to a spectrum of extracellular stimuli, particularly those acting through members of the
Toll/IL-1 receptor (TIR)4 family (7–9).
The features of such mRNAs that confer instability and sensitivity to stimulus-induced stabilization have been the subject of
substantial interest. The importance of adenine-uridine-rich elements (AREs) found in 3⬘-untranslated regions (UTRs) is well
recognized (10 –14); there are ⬎1000 human genes that contain
3⬘-UTR-localized ARE sequences, which exhibit a broad range of
decay rates (15–17). Although AREs are functionally defined on
*Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195; and †Graduate School of Nursing, Uniformed Services
University, Bethesda, MD 20814
Received for publication July 11, 2007. Accepted for publication December 9, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by U.S. Public Health Service Grants CA39621 and
AI50739.
2
S.D. and R.B. contributed equally to this work.
3
Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Cleveland
Clinic Foundation, Lerner Research Institute, 9500 Euclid Avenue, Cleveland, OH
44195. E-mail address: [email protected]
4
Abbreviations used in this paper: TIR, Toll/IL-1 receptor; Act D, actinomycin D;
ARE, adenine-uridine-rich element; CLU, cluster only; Dox, doxycycline; FL, fulllength KC 3⬘-UTR; HA, hemagglutinin; M-MLV, Moloney murine leukemia virus;
TTP, tristetraprolin; UTR, untranslated region.
Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00
www.jimmunol.org
the basis their ability to confer instability to otherwise stable
mRNAs, many ARE-containing mRNAs can be stabilized in response to extracellular stimuli such as IL-1 or LPS (8, 9, 16, 18 –
21). The regulatory function of AREs is apparently mediated, at
least in part, through the action of RNA-binding proteins that recognize the ARE motif (22–25). There are number of such proteins
that have been identified using a variety of experimental strategies.
These include AUF-1 (also known as hnRNP D) (26); HuR, a
member of the embryonic lethal abnormal visual (elav) family
(25); the KH domain containing splicing factor (KSRP) (27, 28);
and the zinc finger protein tristetraprolin (TTP) (22, 29). Multiple
studies support a role for each of these proteins in regulating the
decay of one or more ARE-containing mRNAs in various cell
types and tissues both in cell culture and in intact animals.
Although the ability of TTP to promote enhanced degradation of
several ARE-containing mRNAs is now recognized, the spectrum
of targets that are sensitive is not fully appreciated. Studies in
TTP-deficient mice have shown that TTP is involved in regulating
the half-life of TNF-␣ and GM-CSF mRNAs in vivo (29, 30). A
recent study evaluating the decay of mRNAs in fibroblasts by oligonucleotide microarray analysis identified a set of mRNAs exhibiting differential decay in cells derived from wild-type vs TTPdeficient mice (31). Although CXC chemokine mRNAs are known
to be highly unstable, their half-lives were only modestly different
in wild-type and TTP⫺/⫺ fibroblasts despite the presence of multiple AU-rich sequences that would predict TTP sensitivity. Furthermore, although multiple studies have suggested that TTP is a
target of signaling pathways implicated in the stabilization of
ARE-containing mRNAs, the mechanistic basis for TTP-dependent stabilization is multifactorial and remains to be fully appreciated (32–35). In the present study we have examined the ability
of TTP to regulate the decay of the mouse chemokine KC
(CXCL1) mRNA using both HEK293 cells (which do not express
TTP) and primary macrophages from wild-type and TTP-deficient
mice. The results demonstrate that KC is a significant target for the
destabilizing activity of TTP that operates through multiple
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
mRNAs encoding proinflammatory chemokines are regulated posttranscriptionally via adenine-uridine-rich sequences (AREs)
located in the 3ⴕ untranslated region of the message, which are recognized by sequence-specific RNA-binding proteins. One ARE
binding protein, tristetraprolin (TTP), has been implicated in regulating the stability of several ARE-containing mRNAs, including
those encoding TNF-␣ and GM-CSF. In the present report we examined the role of TTP in regulating the decay of the mouse
chemokine KC (CXCL1) mRNA. Using tetR-regulated control of transcription in TTP-deficient HEK293 cells, KC mRNA half-life
was markedly decreased in the presence of TTP. Deletion and site-specific mutagenesis were used to identify multiple AUUUA
sequence determinants responsible for TTP sensitivity. Although a number of studies suggest that the destabilizing activity of TTP
is subject to modulation in response to ligands of Toll/IL-1 family receptors, decay mediated by TTP in 293 cells was not sensitive
to stimulation with IL-1␣. Using primary macrophages from wild-type and TTP-deficient mice, KC mRNA instability was found
to be highly dependent on TTP. Furthermore, LPS-mediated stabilization of KC mRNA is blocked by inhibition of the p38 MAPK
in macrophages from wild-type but not TTP-deficient mice. These findings demonstrate that TTP is the predominant regulator of KC
mRNA decay in mononuclear phagocytes acting via multiple 3ⴕ-untranslated region-localized AREs. Nevertheless, KC mRNA remains
highly unstable in cells that do not express TTP, suggesting that additional determinants of instability and stimulus sensitivity may
operate in cell populations where TTP is not expressed. The Journal of Immunology, 2008, 180: 2545–2552.
2546
AUUUA-sequence motifs. Although TTP appears to be a primary
determinant of chemokine instability in macrophages, other sequences and mechanisms may also operate in cell populations that
do not express TTP.
Materials and methods
Reagents
Mice
Wild-type and TTP⫺/⫺ mice on a C57BL/6 background were generously
provided by Dr. Perry Blackshear (National Institute of Environmental
Health Sciences, Research Triangle Park, NC). Heterozygotes were crossed
and littermate wild-type or TTP⫺/⫺ mice were identified by PCR-based
genotyping. Mice were housed in microisolator cages with autoclaved food
and bedding to minimize exposure to viral and microbial pathogens, and all
procedures were approved by the Institutional Animal Care and Use
Committee.
Plasmids
Radiolabeled cDNA probes for use in Northern hybridization analysis
were prepared from plasmids containing fragments of GAPDH and KC
in the Bluescript vector. Plasmids used to drive expression of different
versions of KC were prepared in pTRE2 (Clontech). The parent clone
was created by insertion of the full KC 5⬘-UTR and coding region
(residues 1–359) into the BamH1-NotI sites of pTRE2, and the 3⬘-UTR
was provided from the rabbit ␤-globin gene. Additional constructs were
created by excising the rabbit ␤-globin region with XbaI and SAP1, and
different versions of the KC 3⬘-UTR sequence were inserted in the
remaining EcoRV site. The full-length KC 3⬘-UTR (designated FL)
contained residues 360 –952. The cluster only (CLU) clone contained
residues 406 – 483 and 868 –950, the ⌬1 clone contained residues 467–
950, the P1P2 construct contained residues 467– 634 and 868 –950, and
the ⌬4 construct contained residues 720 –950. Mutant versions of CLU
and P1P2 were prepared by PCR or oligonucleotide site-directed mutagenesis as described previously (20, 21). The CLUmt was prepared by
substituting the sequence TATTCGATCGAGATATCTCC for residues
445– 470, while the P1P2 mutant had the AUUUA sequence in each
pentamer substituted with AUCGA. A clone containing the full-length
KC 3⬘-UTR in which all AUUUA pentamers were mutated was prepared by site-directed mutagenesis in the context of the wild-type clone
using the substitutions indicated above. A plasmid encoding the fulllength human TTP cDNA containing a hemagglutinin epitope tag under
control of the CMV promoter (pCMV.hTTP.tagHA) was provided by
Dr. Perry Blackshear (National Institute of Environmental Health Sciences, Research Triangle Park, NC).
Cell culture and transfection
HEK293 C6 cells stably expressing human IL-1R1 and the tetR-VP-16
fusion protein (293tetoff) were maintained in DMEM supplemented with
10% FBS, penicillin, streptomycin, G418, and puromycin in humidified
5% CO2 as previously described (8). Transfections were done using
SuperFect Transfection Reagent (Qiagen) according to the manufacturer’s
protocol. Primary thioglycollate-elicited macrophages were prepared and
cultured as described previously (36).
Measurements of RNA stability
Three hours after transfection, pools of 293tet-off were subdivided into
60-mm dishes and rested for 24 h before individual treatments. KC mRNA
transcription was terminated by the addition of Dox (1 ␮g/ml), and total
RNA was prepared at the indicated times using TRI Reagent following the
manufacturer’s instructions. Total RNA preparations were digested with
RNase-free DNase to eliminate residual plasmid DNA before analysis of
specific mRNA content by Northern blot hybridization as described previously (16, 21). The magnitude of TTP expression was modulated by
using different amounts of plasmid for transfection.
RNA binding assays
The ability of TTP to bind to wild-type and mutant versions of KC mRNA
in vivo was conducted as described previously (37). Briefly, cells were
transiently cotransfected with HA-hTTP and TRE-regulated KC expression
vectors as indicated in the text. Twenty hours after transfection, 2 ⫻ 106
cells were trypsynized, washed twice, and resuspended in 10 ml of ice-cold
PBS. Cells were fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH
7.0, 0.25 M). The cells were then washed twice with ice-cold PBS, resuspended in 2 ml of RIPA buffer (50 mM Tris-HCl (pH 7.5), 1% nonidet
P-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM
NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged
(15 min, 4°C, 16,000 ⫻ g), and 1 ml of each supernatant was immunoprecipitated overnight at 4°C, using protein G-agarose beads preincubated
with 20 ␮g of anti-HA Ab. The beads were washed 5 times with 1 ml RIPA
buffer and resuspended in 150 ␮l of elution buffer (50 mM Tris-Cl (pH
7.0), 5 mM EDTA, 10 mM DTT, 1% SDS). Cross-linking was reversed by
incubation at 70°C for 45 min, and RNA was purified from immunoprecipitates with TRI Reagent, treated with RNase-free DNase, and 10% of
the total RNA sample was reverse-transcribed with Moloney murine leukemia virus (M-MLV) reverse transcriptase. Two microliters (10%) of the
reverse transcriptase product was subjected to PCR amplification for 20
cycles. The primers for KC were forward, 5⬘-CTGGCCACAGGGGCGCCTATC; reverse, 5⬘-GGACACCTTTTAGCATCTTT; and for GAPDH
were forward, 5⬘-TCACCATCTTCCAGGAGCGAGAT; reverse, 5⬘-GTTGGTGGTGCAGGAGGCATTGCT. Twenty microliters of each PCR reaction were separated by agarose gel electrophoresis.
Western blot analysis
Immunoblot analyses were performed on S100 extracts by 10% SDSPAGE, and the blots were probed with anti-HA and anti-TTP Abs to detect
the expression levels of transiently expressed HA-tagged TTP. Development of blots was as described previously (38).
Results
Effects of TTP on KC mRNA decay
To determine whether KC mRNA is sensitive to the action of TTP,
we used a HEK293 cell line stably expressing the tetracycline
repressor protein (tetR) fused with the transactivation domain of
the viral transcription factor VP-16 (293tet-off) (8). This cell line
does not express detectable levels of TTP by Western blot (Fig.
1C). When these cells are transiently transfected with a plasmid
encoding the full-length KC cDNA under control of a tetracyclineresponsive promoter (TRE), the transgene is expressed at high levels (see Fig. 1A). In the presence of Dox, transcription is rapidly
terminated and KC mRNA decays with a half-life of ⬃2.5 h. When
the cells are cotransfected with a plasmid encoding TTP, the halflife of KC mRNA is markedly shortened to 1 h (Fig. 1B). The
effect of TTP was sequence specific because a chimeric mRNA
containing the KC 5⬘-UTR and coding region and the 3⬘-UTR
from the rabbit ␤-globin gene was stable and unaltered in TTPexpressing cells. The absence of TTP expression in 293tet-off cells
and its expression following transfection are demonstrated by
Western blot analysis in Fig. 1C.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
DMEM, RPMI1640, Dulbecco’s PBS, and antibiotics were obtained from
Central Cell Services of the Lerner Research Institute (Cleveland, OH).
Neomycin sulfate (G418), formamide, dextran sulfate, MOPS, diethyl-pyrocarbonate, actinomycin D (Act D), TCA, anti-hemagglutinin (HA) Ab,
Brewer’s thioglycollate broth, LPS (prepared from Escherichia coli serotype 0111:B4), and protease inhibitor mixture were purchased from SigmaAldrich. SB203580 was purchased from Calbiochem. FBS was purchased
from BioWhittaker. Doxycycline (Dox) and the vector pTRE2 were obtained from Clontech Laboratories. Random priming kits were
purchased from Stratagene. RNase-free DNase was obtained from
Promega. Nylon transfer membrane was purchased from Micron Separation. SuperFect transfection reagent was obtained from Qiagen, and
TRI Reagent was purchased from Molecular Research Center. Salmon
sperm DNA were obtained from Ambion. Recombinant human IL-1␣
was purchased from R&D Systems. Protein G agarose beads were obtained from Santa Cruz Biotechnology. Ab against TTP was provided
by Dr. Andrew Clark (Kennedy Institute of Rheumatology, London,
U.K.). DuPont-New England Nuclear was the source of [␣-32P]UTP and
[␣-32P]dCPT. ProtoGel, SequaGel (acrylamide, N,N-methylene bisacrylamide, urea), and related buffers were obtained from National Diagnostics. Protein assay reagents were purchased from Bio-Rad Laboratories. Guanidine thiocyanate, sarkosyl, and cesium chloride were
purchased from Fischer Scientific, and restriction enzymes were obtained from Roche Applied Science.
TTP REGULATES KC mRNA DECAY
The Journal of Immunology
2547
FIGURE 1. TTP modulates KC mRNA decay. A, 293tet-off cells were cotransfected with reporter constructs pTRE2/KC(FL) or pTRE2/KC(R␤G) and either
empty vector or the TTP expression plasmid pCMV.hTTP.tagHA (0.5 ␮g/2 ⫻ 106 cells). Three hours after transfection the cells were divided into three individual
Petri dishes and cultured overnight. Dox (1 ␮g/ml) was added and total RNA was prepared following incubation for the indicated time periods. KC and GAPDH
mRNA levels were analyzed by Northern hybridization. B, The autoradiographs from six independent experiments similar to those described in A were quantified
using the National Institutes of Health Image software and the ratio of KC to GAPDH mRNA was used to determine remaining mRNA levels. Values represent
the means ⫾ SEM plotted in semilog fashion. C, Protein extracts prepared from 293tet-off cells mock transfected (pCMV) or from cells transiently expressing TTP
(pCMV.hTTP.tagHA) were analyzed by Western blot using anti-TTP Ab. Similar results were obtained in three separate experiments.
KC mRNA is unstable in TTP-deficient 293tet-off cells, indicating
that this mRNA contains sequence motifs that promote rapid decay
even in the absence of TTP. Nevertheless, expression of TTP
markedly increased the decay of full-length KC mRNA. To identify the regions of the KC 3⬘UTR that are necessary for sensitivity
to TTP, we prepared several deletion mutants of the 3⬘-UTR and
evaluated the half-life of the corresponding mRNAs in 293tet-off
cells cotransfected with vector or TTP cDNA. We have recently
reported that KC mRNA contains two functionally independent
determinants of instability: a 77-nucleotide fragment containing a
cluster of two overlapping pairs of AUUUA pentamers (CLU) located just 3⬘ to the translational termination site, and a 487-nucleotide fragment composing the residual 3⬘ portion of the mRNA
(⌬1) (39). Plasmids containing either of these regions linked with
the KC coding region were separately transfected into 293tet-off
cells either alone or along with the TTP expression vector, and
mRNA decay was assessed by Northern hybridization and quantified by image analysis (Fig. 2). The CLU construct was more
stable than the full-length 3⬘-UTR fragment (t1/2 of ⬎4 h) but
showed marked destabilization in the presence of TTP (t1/2 ⫽ 1 h).
The ⌬1 fragment behaved comparably to the full-length 3⬘-UTR
construct in terms of both instability and TTP sensitivity (t1/2 ⫺
TTP ⫽ 2.4 h, t1/2 ⫹ TTP ⫽ 1.2 h). A subcomponent of the ⌬1
fragment that contains two isolated AUUUA pentamers (P1P2)
behaved comparably to the CLU fragment (t1/2 ⫺ TTP ⫽ ⬎4 h,
t1/2 ⫹ TTP ⫽ 1 h). The ⌬4 fragment, from which all 7 AUUUA
pentamers have been removed, retains very modest instability but
is insensitive to TTP (t1/2 ⫽ ⬎4 h ⫾ TTP).
These findings suggest that TTP targets the AUUUA pentamers present both as overlapping clusters and as isolated motifs.
In the absence of TTP, both the CLU and the P1P2 fragments
are quite stable but become highly unstable in the presence of
TTP. The target site for TTP recognition and binding of RNA
has been reported to depend on three to four uridine residues
flanked by adenine (40). We therefore evaluated the importance
of the pentamer sequences using site-specific mutagenesis. Although the wild-type sequences from either the CLU or P1P2
fragments conferred strong sensitivity for TTP-mediated decay,
confirming the results from Fig. 2, mutations eliminating the
pentamer structures in either fragment abrogated the ability of
TTP to promote enhanced degradation (Fig. 3A). To determine
whether the AUUUA pentamers are responsible for all TTP
sensitivity in the KC 3⬘-UTR, 293tet-off cells were transfected
with either the pTRE/KC(FL) or a version in which all seven
pentamer structures had been mutated (pTRE2/KC(FLallPmt))
along with either empty vector or TTP cDNA. Although the
FIGURE 2. Identification of TTP-sensitive regions in the KC mRNA
3⬘-UTR. The 293tet-off cells were transiently cotransfected with the indicated deletion derivatives of pTRE2/KC(FL) along with empty vector (EV)
or pCMV.hTTP.tagHA (TTP) (0.5 ␮g/2 ⫻ 106 cells). Three hours after
transfection the cells were separated into three Petri dishes and cultured
overnight. Dox was added and the incubations were continued for the indicated time periods before the preparation of total RNA and analysis of
KC and GAPDH (not shown) mRNAs by Northern hybridization. The
individual deletion series plasmids are described in detail in Materials and
Methods. Each contains the 5⬘-UTR, the coding region, and a fragment encoding the polyadenylation signal in addition to the indicated regions of the
KC 3⬘-UTR. A cluster of four linked AUUUA pentamers (CLU) and the
isolated AUUUA pentamers (P1, P2, and P3) are indicated. The autoradiographs from three to five independent experiments similar to that described
above were quantified using the National Institutes of Health Image software,
and the ratio of KC to GAPDH mRNA was used to determine remaining
mRNA levels. Values represent the means ⫾ SEM plotted in semilog fashion.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Identification of TTP-responsive elements in the KC 3⬘-UTR
2548
TTP REGULATES KC mRNA DECAY
wild-type construct exhibited TTP sensitivity comparable to
that seen in previous experiments, the decay of the mRNA in
which all pentamers are mutated was insensitive to the presence
of TTP (Fig. 3, B and C). Interestingly, even though mutant KC
mRNA lost sensitivity to TTP, it retained significant instability.
The mutation of all pentamer sequences in the KC 3⬘-UTR also
markedly diminished the ability of TTP to bind with KC mRNA
in vivo. The 293tet-off cells were cotransfected with either
wild-type pTRE2/KC(FL) or the all-pentamer mutant (pTRE2/
KC(FLallPmt)) and the HA-tagged TTP expression plasmid, and,
after overnight culture, the cells were fixed briefly in 0.1% formalin and extracts were used to determine the amount of KC mRNA
bound to TTP by immunoprecipitation with anti-HA Ab as described in Materials and Methods. Although wild-type KC mRNA
was selectively bound to TTP (as compared with GAPDH mRNA),
the binding of TTP to the all-pentamer mutant version was substantially reduced (Fig. 3D).
TTP-mediated KC mRNA decay is insensitive to the stabilizing
effects of IL-1
Unstable ARE-containing mRNAs, including KC, have been
shown to be stabilized following stimulation through members of
the TIR family (19, 41, 42), and TTP has been suggested as a
possible target of this signaling pathway (32, 34, 43). In support of
this hypothesis is the finding that that TTP has several serine and
threonine residues that are phosphorylation sites for the p38-activated downstream kinase MAPKAP2 (43). Moreover, TTP is
phosphorylated in response to the TLR4 ligand LPS (44). The
phosphorylation of TTP promotes its recognition by, and interaction with, one or more 14-3-3 proteins (43). Mutation of these
phosphorylation sites abrogates interaction between TTP and 143-3 and may compromise the ability of TTP to enhance AREdependent mRNA degradation (32, 34). We therefore wanted to
determine whether TTP might be a target for the action of IL-1␣
and whether TTP-mediated degradation of KC mRNA could be
overcome in cells treated with IL-1␣, a potent stimulus for stabilization of KC mRNA (20, 39). To assess the ability of IL-1␣
treatment to stabilize TTP-dependent decay, 293tet-off cells were
cotransfected with the P1P2 construct (see Figs. 2 and 3) and the
cDNA-encoding TTP and were treated with Dox alone or in combination with IL-1␣ before determination of residual KC mRNA
levels. Although TTP expression promoted substantive decay of
mRNA containing the P1P2 fragment, IL-1␣ treatment did not
result in any stabilization (Fig. 4, A and B). In some experiments,
IL-1␣ was added 2 h before Dox to ensure that TTP phosphorylation would be achieved before measuring decay, but these experiments showed identical results (data not shown). HA-tagged
TTP is phosphorylated in untreated 293 cells as indicated by the
electrophoretic mobility shift following treatment of extracts with
alkaline phosphatase (Fig. 4, C and D). Furthermore, the degree of
phosphorylation is enhanced following stimulation with IL-1␣.
Because 293tet-off cells do not express endogenous TTP, we
wanted to assess whether KC expression is regulated by TTP in
cells where both TTP and KC are normally expressed. Several
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 3. TTP sensitivity of KC mRNA requires AUUUA pentamers. A, 293tet-off cells were cotransfected with pCMV or pCMV.hTTP.tagHA (0.5
␮g/2 ⫻ 106 cells) and pTRE2/KC derivatives containing wild-type and mutant versions of the CLU and P1P2 regions as described in Materials and
Methods. After overnight culture, individual dishes were treated with Dox, incubation was continued for the indicated times, and total RNA was prepared
and used to determine levels of KC and GAPDH (not shown) mRNAs by Northern hybridization. B, 293tet-off cells were transfected with wild-type
pTRE/KC(FL) or all-pentamer mutant pTRE/KC(FLallPmt) plasmids alone or with pCMV.hTTP.tagHA (0.5 ␮g/2 ⫻ 106 cells) as described above. After
overnight culture, individual dishes were treated with Dox, incubation was continued for the indicated times, and total RNA was prepared and used to
determine levels of KC and GAPDH (data not shown) mRNAs by Northern hybridization. C, The autoradiographs from B were quantified as described in
the legend to Fig. 1. D, 293tet-off cells were cotransfected with either pTRE/KC(FL) or all-pentamer mutant pTRE/KC(FLallPmt) plasmids and pCMV.
hTTP.tagHA. After overnight rest, the cells were used to determine the level of each KC mRNA associated with TTP as described in Materials and Methods.
The recovered RNA samples were subjected to RT-PCR for 20 cycles. I, input; P, immunoprecipitate pellet. Similar results were obtained in two separate
experiments.
The Journal of Immunology
2549
reports have demonstrated that TTP expression is somewhat
restricted in normal tissues and is most abundant in myeloid cell
populations following stimulation through TIR ligands (45). To
FIGURE 5. KC mRNA is differentially expressed in wild-type and TTP⫺/⫺ macrophages. A,
Thioglycollate elicited peritoneal macrophages from
wild type and TTP⫺/⫺ mice were plated at 5 ⫻ 106
cells per 100 mm Petri dish and allowed to adhere
overnight. Cultures were stimulated with LPS (100
ng/ml) for the indicated times before preparation of
total RNA and analysis of KC and GAPDH mRNA
levels by Northern hybridization. The blots were
quantified by National Institutes of Health Image
software. Measurements are in arbitrary units and
are representative of three separate experiments. B,
Thioglycollate-elicited macrophages were plated as
above, and after overnight culture they were stimulated with LPS for 3 or 6 h followed by the addition
of Act D (5 ␮g/ml) alone or in combination with
SB203580 (2 ␮M) for the indicated times before
preparation of total RNA and analysis of KC and
GAPDH mRNA levels by Northern hybridization.
Results are representative of three separate
experiments.
determine whether KC expression is regulated by TTP in primary
macrophages, we examined the expression pattern for KC in
LPS-stimulated, thioglycollate-elicted peritoneal macrophages
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 4. TTP-mediated degradation of KC mRNA is not IL-1 sensitive. A, 293tet-off cells were cotransfected with pTRE2/KC(PIP2) and either pCMV or
pCMV.hTTP.tagHA (0.5 ␮g/2 ⫻ 106 cells). After overnight culture, the cells were treated with Dox (1 ␮g/ml) alone or in combination with IL-1␣ (10 ng/ml),
and total RNA was obtained at the indicated times and used to determine KC and GAPDH (not shown) mRNAs by Northern hybridization. B, The autoradiographs
were quantified as described in the legend to Fig. 1. C, Protein extracts were prepared from 293tet-off cells transiently expressing TTP (pCMV.hTTP.tagHA) treated
or not with IL-1␣ (10 ng/ml) for 2 h. Extracts were subsequently digested as indicated with calf intestinal alkaline phosphatase (CIP) for 30 min before separation
by SDS-PAGE and analysis for TTP protein by Western blot using anti-HA Ab. The bands corresponding to phosphorylated and dephosphorylated forms of TTP
are indicated. D, The films from C were quantified by National Institutes of Health Image software separating each band into TTP or phospho-TTP according to
mobility as indicated in C. The numerical results are presented in arbitrary units, and similar results were obtained in two separate experiments.
2550
from either wild-type or TTP-deficient mice. The time-course for
KC mRNA expression was somewhat similar in macrophages
from both TTP⫹/⫹ and TTP⫺/⫺ mice, although the magnitude of
KC expression was appreciably higher in macrophages from the
TTP⫺/⫺ mice (Fig. 5A). In multiple experiments the average difference at each time point ranged from 2- to 3-fold. This quantitative increase in KC gene expression appears to reflect a reduced
rate of KC mRNA decay in TTP⫺/⫺ as compared with wild-type
macrophages (Fig. 5B). In wild-type macrophages, LPS stabilizes
KC mRNA transiently and this is evident when comparing the
decay at two different time points (t1/2 at 3 h ⬎ 4 h, t1/2 at 6 h ⫽
2.5 h). When the decay of KC mRNA was assessed in TTP⫺/⫺
macrophages, it was highly stable at both times. If the p38 MAP
kinase inhibitor SB203580 is added along with Act D at either the
3 or 6 h time point, the mRNA is dramatically destabilized in
wild-type macrophages, but there is little or no effect of the inhibitor in the TTP-deficient cell population.
Discussion
The ability of proinflammatory stimuli acting through TIR family receptors to promote enhanced stability of some ARE-containing mRNAs is well documented (8, 9, 19). TTP can be phosphorylated on two separate serine residues (52 and 178) via the action
of MAPKAP2, a kinase downstream of p38 MAP kinase and
known to be involved in stimulus-mediated stabilization (43). Furthermore, this modification promotes the formation of a complex
with 14-3-3 proteins that is now thought to regulate the association
of TTP with P bodies, subcellular structures that appear to serve as
the location for at least some components of mRNA decay (34,
49). In consideration of this, several reports have presented evidence indicating that TTP might be a target for the action of proinflammatory agents as an intermediate in the signaling pathway for
stimulus-induced stabilization of selected ARE-containing
mRNAs (32, 43, 44, 50). In macrophages from mice deficient in
MAPKAP2, TIR-induced signals are unable to increase the stability of short-lived mRNAs including KC, whereas in cells from
mice in which both MAPKAP2 and TTP have been deleted, KC
mRNA is highly stable, suggesting that TTP functions downstream
of MAPKAP2 (35, 51). This demonstrates that TTP is the primary
determinant of instability, but it does not unequivocally demonstrate that it is necessarily the only target for TIR-induced mRNA
stabilization. Interestingly, it has also been reported that phosphorylation of 14-3-3 regulates interaction with TTP and ultimately the
control of mRNA decay (52). In contrast, a recent report documented that LPS stimulation was unable to modulate the activity of
TTP (33). Our findings show that while TTP can promote the rapid
decay of KC mRNA, this instability is insensitive to the action of
IL-1␣ even though IL-1␣ treatment can change the phosphorylation state of TTP. The phosphorylation of TTP in response to p38
MAP kinase activity has been shown to regulate not only the interaction with 14-3-3 but also the stability of the protein and its
subcellular localization (53). Furthermore, the activation of p38
MAP kinase and MAPKAP2 are necessary for the synthesis of
TTP (35). Hence, the control of AU-rich mRNA decay and its
modulation by extracellular stimulus appears likely to reflect a
complex series of events that include the synthesis of TTP as well
as regulation of its function.
A number of specific ARE-containing mRNAs, including other
chemokines, have been demonstrated to exhibit sensitivity to TTP
(29, 30, 54, 55). A recent study using oligonucleotide microarray
analysis examined a broader spectrum of transcripts for TTP sensitivity in embryonic fibroblasts from wild-type and TTP⫺/⫺ mice
and identified a relatively small subset of sensitive mRNAs (31).
Interestingly, although CXC chemokine mRNAs such as KC are
known to be unstable and to contain AU-rich regions that would
predict sensitivity to TTP, they showed only limited TTP sensitivity in this study. The present results argue convincingly that KC
mRNA decay is sensitive to TTP and that, in primary mouse macrophages, TTP is the major mediator of KC instability. The difference between our findings and the prior report might reflect the
fact that KC mRNA is highly sensitive to stabilization in response
to the stimuli that also promote its transcription, and this may mask
TTP-dependent instability. Indeed, in macrophages stimulated for
3 h with LPS, there is only modest difference between the decay of
KC in wild-type as compared with TTP-deficient cells. The TTP
dependency is observed more readily, however, in cells treated for
6 h before analysis or in cells where stabilization is inhibited with
SB203580.
It is noteworthy that KC mRNA is highly unstable in cells lines
that do not express TTP, and, furthermore, that the mutation of
sequences that confer TTP sensitivity (all seven AUUUA containing sites) only partially reduces such instability (39). This suggests
that additional ARE-binding proteins participate in regulating the
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
The sequence-specific regulation of mRNA decay is now recognized as a potent mechanism for rapidly changing the pattern of
gene expression. In the context of inflammatory response, posttranscriptional control is one of multiple regulatory steps that must
operate to ensure adequate protective function while preventing
unnecessary or inappropriate tissue damage (46). Although it is
well accepted that AREs can confer this behavior and are recognized by RNA-binding factors specific for such sites, the diversity
of the sequences and the role for specific proteins in regulating
individual mRNAs remain to be fully understood. In the present
report we have evaluated the role of TTP in regulating the decay
of the mouse neutrophil-directed chemokine KC. The results support the following conclusions: (1) TTP is able to enhance the
decay of KC mRNA through both clustered and independent
AUUUA-containing regions in the 3⬘-UTR; (2) Although KC
mRNA can be stabilized in response to treatment with IL-1␣, instability mediated by constitutively expressed TTP is not subject to
this control; and (3) finally, TTP appears to be the primary determinant of KC mRNA instability in mononuclear phagocytes,
although in cells that do not express TTP, this mRNA retains
substantial instability.
TTP was first linked with degradation of ARE-containing
mRNAs in the context of TNF-␣ mRNA (29). The ARE of TNF-␣
contains multiple overlapping AUUUA pentamers, suggesting that
such sequences might be specific targets for TTP recognition and
function. This has been supported by studies directed at defining
the sequence recognition specificity of TTP, in which the highest
affinity recognition sites were demonstrated to contain three to four
uridine residues flanked by at least one adenine, with the highest
affinity being identified for a nonameric sequence element
(UUAUUUAUU) (40, 47, 48). Our deletion analysis of KC 3⬘UTR demonstrates that the clustered as well as isolated pentamercontaining sequences exhibit sensitivity to TTP. In 293 cells,
mRNAs containing these AUUUA sequence fragments are relatively stable but exhibit dramatic decay promoted by the plasmiddriven expression of TTP. The pentamer structure in each case
appears to provide the critical recognition motif because mutation
of two central U residues destroys sensitivity (Fig. 3), and a KC
mRNA in which all seven pentamer sequences are mutated has lost
TTP sensitivity. Because only two of the sensitive motifs (one of
the clustered pentamers and the P3 sequence) contain the consensus nonameric sequence, this structure does not appear to be an
absolute requirement, and the pentamer structures found in P1 and
P2 seem sufficient to promote sensitivity of an RNA sequence to
the action of TTP.
TTP REGULATES KC mRNA DECAY
The Journal of Immunology
posttranscriptional control of KC and similar mRNAs. Although it
is clear that other ARE-binding proteins function in posttranscriptional control processes (56, 57), the degree to which multiple
proteins participate in the regulation of a single mRNA is poorly
appreciated. Moreover, it also appears likely that distinct mechanisms may operate in cell type-restricted patterns such that specific
mRNAs may be regulated by distinct mechanisms in different cell
populations or tissues.
Disclosures
The authors have no financial conflicts of interest.
References
25. Brennan, C., and J. Steitz. 2001. HuR and mRNA stability. Cell Mol. Life Sci. 58:
266 –277.
26. Zhang, W., B. J. Wagner, K. Ehrenman, A. W. Schaefer, C. T. De Maria,
D. Crater, K. De Haven, L. Long, and G. Brewer. 1993. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.
Mol. Cell. Biol. 13: 7652–7665.
27. Chen, C. Y., R. Gherzi, S. E. Ong, E. L. Chan, R. Raijmakers, G. J. Pruijn,
G. Stoecklin, C. Moroni, M. Mann, and M. Karin. 2001. AU binding proteins
recruit the exosome to degrade ARE-containing mRNAs. Cell 107: 451– 464.
28. Gherzi, R., K. Y. Lee, P. Briata, D. Wegmuller, C. Moroni, M. Karin, and
C. Y. Chen. 2004. A KH domain RNA binding protein, KSRP, promotes AREdirected mRNA turnover by recruiting the degradation machinery. Mol. Cell. 14:
571–583.
29. Carballo, E., W. S. Lai, and P. J. Blackshear. 1998. Feedback inhibition of macrophage tumor necrosis factor-␣ production by tristetraprolin. Science 281:
1001–1005.
30. Carballo, E., W. S. Lai, and P. J. Blackshear. 2000. Evidence that tristetraprolin
is a physiological regulator of granulocyte-macrophage colony-stimulating factor
messenger RNA deadenylation and stability. Blood 95: 1891–1899.
31. Lai, W. S., J. S. Parker, S. F. Grissom, D. J. Stumpo, and P. J. Blackshear. 2006.
Novel mRNA targets for tristetraprolin (TTP) identified by global analysis of
stabilized transcripts in TTP-deficient fibroblasts. Mol. Cell. Biol. 26:
9196 –9208.
32. Stoecklin, G., T. Stubbs, N. Kedersha, S. Wax, W. F. Rigby, T. K. Blackwell, and
P. Anderson. 2004. MK2-induced tristetraprolin:14-3-3 complexes prevent stress
granule association and ARE-mRNA decay. EMBO J. 23: 1313–1324.
33. Rigby, W. F., K. Roy, J. Collins, S. Rigby, J. E. Connolly, D. B. Bloch, and
S. A. Brooks. 2005. Structure/function analysis of tristetraprolin (TTP): p38
stress-activated protein kinase and lipopolysaccharide stimulation do not alter
TTP function. J. Immunol. 174: 7883–7893.
34. Franks, T. M., and J. Lykke-Andersen. 2007. TTP and BRF proteins nucleate
processing body formation to silence mRNAs with AU-rich elements. Genes Dev.
21: 719 –735.
35. Hitti, E., T. Iakovleva, M. Brook, S. Deppenmeier, A. D. Gruber, D. Radzioch,
A. R. Clark, P. J. Blackshear, A. Kotlyarov, and M. Gaestel. 2006. Mitogenactivated protein kinase-activated protein kinase 2 regulates tumor necrosis factor
mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol. Cell. Biol. 26:
2399 –2407.
36. Mandal, P., and T. Hamilton. 2007. Signaling in lipopolysaccharide-induced stabilization of formyl peptide receptor 1 mRNA in mouse peritoneal macrophages.
J. Immunol. 178: 2542–2548.
37. Niranjanakumari, S., E. Lasda, R. Brazas, and M. A. Garcia-Blanco. 2002. Reversible cross-linking combined with immunoprecipitation to study RNA-protein
interactions in vivo. Methods 26: 182–190.
38. Ohmori, Y., and T. A. Hamilton. 1997. IL-4-induced STAT6 suppresses IFN-␥stimulated STAT1-dependent transcription in mouse macrophages. J. Immunol.
159: 5474 –5482.
39. Novotny, M., S. Datta, R. Biswas, and T. Hamilton. 2005. Functionally independent AU-rich sequence motifs regulate KC (CXCL1) mRNA. J. Biol. Chem. 280:
30166 –30174.
40. Brewer, B. Y., J. Malicka, P. J. Blackshear, and G. M. Wilson. 2004. RNA
sequence elements required for high affinity binding by the zinc finger domain of
tristetraprolin: conformational changes coupled to the bipartite nature of Au-rich
MRNA-destabilizing motifs. J. Biol. Chem. 279: 27870 –27877.
41. Winzen, R., M. Kracht, B. Ritter, A. Wilhelm, C. Y. Chen, A. B. Shyu,
M. Muller, M. Gaestel, K. Resch, and H. Holtmann. 1999. The p38 MAP kinase
pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J. 18:
4969 – 4980.
42. Neininger, A., D. Kontoyiannis, A. Kotlyarov, R. Winzen, R. Eckert, H. D. Volk,
H. Holtmann, G. Kollias, and M. Gaestel. 2002. MK2 targets AU-rich elements
and regulates biosynthesis of tumor necrosis factor and interleukin-6 independently at different post-transcriptional levels. J. Biol. Chem. 277: 3065–3068.
43. Chrestensen, C. A., M. J. Schroeder, J. Shabanowitz, D. F. Hunt, J. W. Pelo,
M. T. Worthington, and T. W. Sturgill. 2004. MAPKAP kinase 2 phosphorylates
tristetraprolin on in vivo sites including Ser178, a site required for 14-3-3 binding. J. Biol. Chem. 279: 10176 –10184.
44. Mahtani, K. R., M. Brook, J. L. Dean, G. Sully, J. Saklatvala, and A. R. Clark.
2001. Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor
alpha mRNA stability. Mol. Cell. Biol. 21: 6461– 6469.
45. Lu, J., and R. Schneider. 2004. Tissue distribution of AU-rich mRNA-binding
proteins involved in regulation of mRNA decay. J. Biol. Chem. 279:
12974 –12979.
46. Anderson, P., K. Phillips, G. Stoecklin, and N. Kedersha. 2004. Post-transcriptional regulation of proinflammatory proteins. J. Leukocyte Biol. 76: 42– 47.
47. Blackshear, P. J., W. S. Lai, E. A. Kennington, G. Brewer, G. M. Wilson,
X. Guan, and P. Zhou. 2003. Characteristics of the interaction of a synthetic
human tristetraprolin tandem zinc finger peptide with AU-rich element-containing RNA substrates. J. Biol. Chem. 278: 19947–19955.
48. Worthington, M. T., J. W. Pelo, M. A. Sachedina, J. L. Applegate,
K. O. Arseneau, and T. T. Pizarro. 2002. RNA binding properties of the AU-rich
element-binding recombinant Nup475/TIS11/tristetraprolin protein. J. Biol.
Chem. 277: 48558 – 48564.
49. Garneau, N. L., J. Wilusz, and C. J. Wilusz. 2007. The highways and byways of
mRNA decay. Nat. Rev. Mol. Cell Biol. 8: 113–126.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
1. Rot, A., and U. H. von Andrian. 2004. Chemokines in innate and adaptive host
defense: basic chemokinese grammar for immune cells. Annu. Rev. Immunol. 22:
891–928.
2. Moser, B. 2003. Chemokines: role in immune cell traffic. Eur. Cytokine Network
14: 204 –210.
3. Sallusto, F., and C. Mackay. 2004. Chemoattractants and their receptors in homeostasis and inflammation. Curr. Opin. Immunol. 16: 724 –731.
4. Wilusz, C. J., M. Wormington, and S. W. Peltz. 2001. The cap-to-tail guide to
mRNA turnover. Nat. Rev. Mol. Cell Biol. 2: 237–246.
5. Guhaniyogi, J., and G. Brewer. 2001. Regulation of mRNA stability in mammalian cells. Gene 265: 11–23.
6. Zhang, T., V. Kruys, G. Huez, and C. Gueydan. 2002. AU-rich element-mediated
translational control: complexity and multiple activities of trans-activating factors. Biochem. Soc. Trans. 30: 952–958.
7. Hamilton, T. A., Y. Ohmori, and J. Tebo. 2002. Regulation of chemokine expression by antiinflammatory cytokines. Immunol. Res. 25: 229 –245.
8. Datta, S., M. Novotny, X. Li, J. Tebo, and T. A. Hamilton. 2004. Toll IL-1
receptors differ in their ability to promote the stabilization of adenosine and
uridine-rich elements containing mRNA. J. Immunol. 173: 2755–2761.
9. Holtmann, H., R. Winzen, P. Holland, S. Eickemeier, E. Hoffmann, D. Wallach,
N. L. Malinin, J. A. Cooper, K. Resch, and M. Kracht. 1999. Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from
at least three different cytokine- or stress-activated signal transduction pathways.
Mol. Cell. Biol. 19: 6742– 6753.
10. Winzen, R., G. Gowrishankar, F. Bollig, N. Redich, K. Resch, and H. Holtmann.
2004. Distinct domains of AU-rich elements exert different functions in mRNA
destabilization and stabilization by p38 mitogen-activated protein kinase or HuR.
Mol. Cell. Biol. 24: 4835– 4847.
11. Chen, C.-Y. A., and A.-B. Shyu. 1995. AU-rich elements: characterization and
importance in mRNA degradation. Trends Biochem. Sci. 20: 465– 470.
12. Saklatvala, J., J. Dean, and A. Clark. 2003. Control of the expression of inflammatory response genes. Biochem. Soc. Symp. 70: 95–106.
13. Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shimer, and A. Cerami.
1986. Identification of a common nucleotide sequence in the 3⬘-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad.
Sci. USA 83: 1670 –1674.
14. Shaw, G., and R. Kamen. 1986. A conserved AU sequence from the 3⬘ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:
659 – 667.
15. Bakheet, T., B. R. Williams, and K. S. Khabar. 2003. ARED 2.0: an update of
AU-rich element mRNA database. Nucleic Acids Res. 31: 421– 423.
16. Tebo, J., S. Der, M. Frevel, K. S. Khabar, B. R. Williams, and T. A. Hamilton.
2003. Heterogeneity in control of mRNA stability by AU-rich elements. J. Biol.
Chem. 278: 12085–12093.
17. Frevel, M. A., T. Bakheet, A. M. Silva, J. G. Hissong, K. S. Khabar, and
B. R. Williams. 2003. p38 mitogen-activated protein kinase-dependent and -independent signaling of mRNA stability of AU-rich element-containing transcripts. Mol. Cell. Biol. 23: 425– 436.
18. Stoeckle, M. Y. 1991. Post-transcriptional regulation of gro␣, ␤, ␥, and IL-8
mRNAs by IL-1␤. Nucleic Acids Res. 19: 917–920.
19. Dean, J. L., M. Brook, A. R. Clark, and J. Saklatvala. 1999. p38 mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J. Biol. Chem. 274:
264 –269.
20. Tebo, J., S. Datta, R. Kishore, M. Kolosov, J. A. Major, Y. Ohmori, and
T. A. Hamilton. 2000. IL-1-mediated stabilization of mouse KC mRNA depends
on sequences in both 5⬘ and 3⬘ untranslated regions. J. Biol. Chem. 275:
12987–12993.
21. Biswas, R., S. Datta, J. D. Gupta, M. Novotny, J. Tebo, and T. A. Hamilton. 2003.
Regulation of chemokine mRNA stability by lipopolysaccharide and IL-10. J. Immunol. 170: 6202– 6208.
22. Carrick, D. M., W. S. Lai, and P. J. Blackshear. 2004. The tandem CCCH zinc
finger protein tristetraprolin and its relevance to cytokine mRNA turnover and
arthritis. Arthritis Res. Ther. 6: 248 –264.
23. Wilson, G. M., and G. Brewer. 1999. The search for trans-acting factors controlling messenger RNA decay. Prog. Nucleic Acid. Res. Mol. Biol. 62: 257–291.
24. Dean, J. L., G. Sully, A. R. Clark, and J. Saklatvala. 2004. The involvement of
AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell. Signal. 16: 1113–1121.
2551
2552
50. Schmidlin, M., M. Lu, S. A. Leuenberger, G. Stoecklin, M. Mallaun, B. Gross,
R. Gherzi, D. Hess, B. A. Hemmings, and C. Moroni. 2004. The ARE-dependent
mRNA-destabilizing activity of BRF1 is regulated by protein kinase B. EMBO J.
23: 4760 – 4769.
51. Ronkina, N., A. Kotlyarov, O. Dittrich-Breiholz, M. Kracht, E. Hitti, K. Milarski,
R. Askew, S. Marusic, L. L. Lin, M. Gaestel, and J. B. Telliez. 2007. The mitogen-activated protein kinase (MAPK)-activated protein kinases MK2 and MK3
cooperate in stimulation of tumor necrosis factor biosynthesis and stabilization of
p38 MAPK. Mol. Cell. Biol. 27: 170 –181.
52. Gringhuis, S. I., J. J. Garcia-Vallejo, B. van Het Hof, and W. van Dijk. 2005.
Convergent actions of I␬B kinase ␤ and protein kinase C␦ modulate mRNA
stability through phosphorylation of 14-3-3␤ complexed with tristetraprolin. Mol.
Cell. Biol. 25: 6454 – 6463.
53. Brook, M., C. R. Tchen, T. Santalucia, J. McIlrath, J. S. Arthur, J. Saklatvala,
and A. R. Clark. 2006. Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein ki-
TTP REGULATES KC mRNA DECAY
54.
55.
56.
57.
nase and extracellular signal-regulated kinase pathways. Mol. Cell. Biol. 26:
2408 –2418.
Sauer, I., B. Schaljo, C. Vogl, I. Gattermeier, T. Kolbe, M. Muller,
P. J. Blackshear, and P. Kovarik. 2006. Interferons limit inflammatory responses
by induction of tristetraprolin. Blood 107: 4790 – 4797.
Ogilvie, R. L., M. Abelson, H. H. Hau, I. Vlasova, P. J. Blackshear, and
P. R. Bohjanen. 2005. Tristetraprolin down-regulates IL-2 gene expression
through AU-rich element-mediated mRNA decay. J. Immunol. 174: 953–961.
Sully, G., J. L. Dean, R. Wait, L. Rawlinson, T. Santalucia, J. Saklatvala, and
A. R. Clark. 2004. Structural and functional dissection of a conserved destabilizing element of cyclo-oxygenase-2 mRNA: evidence against the involvement of
AUF-1 [AU-rich element/poly(U)-binding/degradation factor-1], AUF-2, tristetraprolin, HuR (Hu antigen R) or FBP1 (far-upstream-sequence-element-binding
protein 1). Biochem. J. 377: 629 – 639.
Lu, J. Y., N. Sadri, and R. J. Schneider. 2006. Endotoxic shock in AUF1 knockout mice mediated by failure to degrade proinflammatory cytokine mRNAs.
Genes Dev. 20: 3174 –3184.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017