City University of New York (CUNY)
CUNY Academic Works
Dissertations, Theses, and Capstone Projects
Graduate Center
9-30-2015
Exploring chromatin-bound MDM2 functions in
compromised transcriptional regulation of p53
target genes
Melissa Rosso
Graduate Center, City University of New York
How does access to this work benefit you? Let us know!
Follow this and additional works at: http://academicworks.cuny.edu/gc_etds
Part of the Molecular Biology Commons
Recommended Citation
Rosso, Melissa, "Exploring chromatin-bound MDM2 functions in compromised transcriptional regulation of p53 target genes"
(2015). CUNY Academic Works.
http://academicworks.cuny.edu/gc_etds/1112
This Dissertation is brought to you by CUNY Academic Works. It has been accepted for inclusion in All Graduate Works by Year: Dissertations, Theses,
and Capstone Projects by an authorized administrator of CUNY Academic Works. For more information, please contact [email protected].
Exploring chromatin-bound MDM2
functions in compromised transcriptional
regulation of p53 target genes
By
Melissa Rosso
A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the
requirements for the degree of Doctor of Philosophy, The City University of New York
2015
© 2015
Melissa Marie Rosso
All Rights Reserved
ii
This manuscript has been read and accepted by the
Graduate Faculty in Biology in satisfaction of the
dissertation requirement for the degree of Doctor of Philosophy
Dr. Jill Bargonetti, Hunter College
Date
Chair of Examining Committee
Date
Dr. Laurel Eckhardt
The Graduate Center Executive Officer
Supervision Committee
Dr. Benjamin Ortiz, Hunter College- CUNY
Dr. Patricia Rockwell, Hunter College-CUNY
Dr. James J. Manfredi, Mount Sinai School of Medicine
Dr. David Cobrinik, The Saban Research Institute
The City University of New York
iii
Abstract
Exploring chromatin-bound MDM2 functions in compromised transcriptional regulation
of p53 target genes
by
Melissa Rosso
Advisor: Dr. Jill Bargonetti
MDM2 overexpression is a common occurrence in many types of cancer. A single
nucleotide polymorphism (T to G) near the mdm2 promoter, termed mdm2 SNP309, leads to
MDM2 overexpression. This polymorphism is associated with accelerated tumor formation,
decreased sensitivity to DNA damage treatment and compromised p53 transcriptional activity.
Two G/G SNP309 cancer cell lines MANCA and A875, a Burkitts’ lymphoma and melanoma
respectively, express a stable wild-type p53 protein. We previously reported these cells have
DNA damage resistant MDM2-p53 chromatin complexes and hypothesized that MDM2 is the
contributing factor for the compromised p53 transcriptional activity. We created constitutive
mdm2 shRNA cell lines to address MDM2 function. MDM2 knockdown in MANCA and A875
cells moderately increased expression of subsets of p53 target genes in a cell-type specific
manner; although no additive effect was seen with DNA damage. Additionally, MDM2
knockdown did not affect p53 protein stability. We explored the mechanism for compromised
p53 transcriptional activity in G/G SNP309 MANCA and A875 cell lines using chromatin
immunoprecipitation analysis. When compared to fully activated T/T SNP309 ML-1 cells
(myeloid leukemia with functional wild-type p53) treated with etoposide, MANCA and A875
cell lines displayed comparable recruitment of total and initiated RNA polymerase II at
transcription start sites (TSS) for p21 and puma genes. This indicated that G/G SNP309 cells had
iv
functional transcription initiation at p53 target genes after DNA damage treatment. Next, we
assessed transcriptional elongation using H3K36 trimethylation (H3K36me3) as a mark for
active elongation. In ML-1 cells with etoposide treatment, we observed higher H3K36me3 at p21
and puma TSS than in either MANCA or A875 cells at these same regions. This suggested
transcriptional elongation is compromised and also suggests that in G/G SNP309 cancer cells
reactivation of p53 transcriptional activity is difficult. We sought to explain this phenomenon by
examining the other well-known p53 negative regulator, MDMX, which is a homolog of MDM2.
Interestingly, in MANCA cells the knockdown of MDM2 caused a substantial increase in
MDMX protein levels. However, in A875 cells this was not observed. This suggests that for
certain cell types, MDMX may function in some redundant roles for MDM2. Finally, we tested if
inducing p53-independent cell death would be more effective than reactivating the wild-type p53
pathway. We treated the cells with 8-amino-adenosine, an inducer of p53-independent cell death.
Indeed, treatment of MANCA and A875 cells with 8-amino-adenosine reduced cell viability
more effectively than other chemotherapeutics.
v
Acknowledgements
I would like to thank my mentor Dr. Jill Bargonetti. She took a chance on me when I had
little research experience. Her hard work and dedication to everything she does inspire me to
always be better as a person and scientist. I am truly grateful for all her years of mentorship
experience and look to her as a role model in many aspects of life.
I would like to thank my committee members for all of their valuable advice and
feedback throughout the years on my graduate work.
I would like to thank all Bargonetti lab members who made going into work every day a
pleasure. I am grateful for all of their support and friendship throughout my years in the
laboratory. I am also grateful to the MBRS-RISE program for support as a graduate student at
Hunter College. The office was a place of solace for me thanks to Janerie Rodriguez and
Christina Medina-Ramirez.
I would also like to thank all of my friends and extended family, too many to name, who
have been on the sidelines supporting me and cheering me on. I would not even be here without
the unconditional love and support from my parents, Efrain and Maritza Rosso, who have helped
me in ways I cannot even begin to describe. Finally, I would like to thank both of my
grandmothers, Julia Gaudinot Santos and Minerva Torres, for taking care of me and inspiring me
to pursue my goals.
vi
Table of Contents
Chapter 1: Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.1 The role of tumor suppressor p53 protein. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.1.1) p53 protein structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.1.2) Stabilizing p53 for activation via cellular stress . . . . . . . . . . . . . . . . . . . . . . . 3
1.1.3) p53 as a transcription factor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.1.4) Transcriptional regulation of p53 target genes . . . . . . . . . . . . . . . . . . . . . . . . 6
1.2) Eukaryotic transcription of protein-coding genes in cells . . . . . . . . . . . . . . . . . . . . . . 9
1.2.1) Stages of transcription by RNA pol II . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
1.2.2) Regulation of the chromatin landscape during transcription . . . . . . . . . . . . . 11
1.3) MDM2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
1.3.1) MDM2 discovery and regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
1.3.2) MDM2 protein structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
1.3.3) Alternative/aberrant splicing and isoforms . . . . . . . . . . . . . . . . . . . . . . . . . 15
1.3.4) The MDM2-p53 interaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
16
1.3.5) MDM2 chromatin functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
1.4) MDMX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
1.4.l) MDMX discovery and regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
1.4.2) Structural and functional comparison between MDM2 and MDMX . . . . . 20
1.4.3) The MDMX-p53 interaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
1.4.4) Splice variants and isoforms of MDMX . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
1.5) Chemotherapeutics and MDM2 overexpressing cancers. . . . . . . . . . . . . . . . . . . . . . 23
1.5.1) Types of MDM2 overexpressing cancers . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
1.5.2) Chemotherapeutic DNA damage agents used to treat cancer . . . . . . . . . . . . 25
1.5.3) Targeted MDM2 inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
vii
1.5.4) Potential of therapeutics that can induce p53-indepdendent cell death . . . . 27
Chapter 2: Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
2.1 Cell culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.2 Drug treatments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.3 Bacterial culture and molecular cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.3.1) Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.3.2) Bacterial growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.3.3) Mini/maxi preps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.3.4) Plasmid DNA cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.3.5) Digestions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.4 Cellular Protein Extracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.4.1) Whole cell extracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.4.2) Cytosolic and nuclear extracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
2.4.3) Chromatin fractionation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.5 Western Blot analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.6 RNA isolation and quantitative RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
2.7 Immunoprecipitations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
2.8 Chromatin Immunoprecipitation (ChIP). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
2.9 Antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
2.9.1) Western Blot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
2.9.2) ChIP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
2.10 Generation of stable and inducible shRNA cell lines . . . . . . . . . . . . . . . . . . . . . . . . 37
2.10.1) shRNA sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
2.10.2) Transient Transfection of Phoenix packaging cells to make retrovirus. . . .37
2.10.3) Retroviral-mediate gene transfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
viii
2.10.4) Drug selections of retroviral-infected cells . . . . . . . . . . . . . . . . . . . . . . . . . 39
2.11 MTT assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
Chapter 3: G/G mdm2 SNP 309 cells display compromised transcriptional elongation of
p53 target genes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
3.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
3.2.1) G/G SNP 309 MDM2 overexpressing cancer cells display compromised p53
transcriptional activity and increased MDM2- p53 complexes on chromatin . . . . 44
3.2.2) Stable knockdown of MDM2 in G/G SNP 309 cancer cell lines moderately
increases p53 transcriptional activity in a gene-specific manner without affecting p53
degradation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
3.2.3) Regulation of p53 target genes in G/G SNP 309 cancer cells occurs at postinitiation steps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
3.2.4) Reduced H3K36 trimethylation near transcription start sites suggests G/G SNP 309
cancer cells have compromised transcriptional elongation at p53 target genes . . . . 53
3.2.5) Stable knockdown of MDM2 in MANCA cells alters p53 recruitment and
H3K36me3 in a gene and site-specific manner. . . . . . . . . . . . . . . . . . . . . . . . . . . 56
3.2.6) Histone H2B post-translational modifications and cytosolic levels are altered by
MDM2 knockdown in G/G SNP309 MANCA and A875 cells . . . . . . . . . . . . . . . 59
3.2.7) MANCA cells with MDM2 knockdown have changes in RNA pol II posttranslational modifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
3.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
ix
Chapter 4: MDMX regulation in G/G SNP309 MDM2 overexpressing cancer cells. . 69
4.1 Introduction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
4.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
4.2.1) MANCA cells with MDM2 knockdown have increased MDMX protein
stability. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
4.2.2) MDM2 knockdown regulates MDMX protein levels in different subcellular
compartment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
4.2.3) MDM2 and MDMX protein regulation is linked in MANCA cells. . . . 74
4.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .76
Chapter 5: G/G SNP309 cancer cells are sensitive to p53-independent cell death induction.79
5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .80
5.2 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
5.2.1) G/G SNP309 cancer cells are sensitive to induction of p53-independent cell death. .81
5.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
Chapter 6: Future Directions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
6.1) Future Directions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Chapter 7: Bibliography. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
x
List of Tables
Table 1- Cell lines Examined . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
List of Figures
Figure 1- p53 is activated by varying stressors leading to numerous cellular responses . . . 2
Figure 2- Schematic of p53 protein structure. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Figure 3- Post-translational modifications on p53 protein . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Figure 4- p53 is involved in regulation transcription initiation and elongation . . . . . . . . . . 8
Figure 5 - Stages of transcription by RNA pol II. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .11
Figure 6- Chromatin modifications associated with transcription. . . . . . . . . . . . . . . . . . . .12
Figure 7- Schematic of full-length MDM2 protein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Figure 8- Models for MDM2-p53 Chromatin Complex Function. . . . . . . . . . . . . . . . . . . . 18
Figure 9- Comparison of MDMX and MDM2 protein domains. . . . . . . . . . . . . . . . . . . . . . 21
Figure 10- MDM2 has multiples roles in cancer and cancer therapy . . . . . . . . . . . . . . . . . . . 25
Figure 11 - G/G SNP309 MDM2 overexpressing cells have compromised wild-type p53
transcriptional activity after DNA damage. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Figure 12- G/G SNP309 cells have increased MDM2 and p53 protein globally on chromatin and
increased p53 recruitment at p53RE’s after DNA damage . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Figure 13- Stable knockdown of MDM2 in MANCA and A875 cells moderately increases p53
transcriptional activity in a gene-specific manner without affecting p53 degradation. . . . . . . . . 51
Figure 14- RNA pol II recruitment at p53 target genes indicates functional transcription initiation
in G/G SNP309 cells after DNA damage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Figure 15- Reduced H3K36 trimethylation at transcription start sites in G/G SNP309 cells
suggests an inhibition of transcriptional elongation at p53 target genes . . . . . . . . . . . . . . . . . . 55
xi
Figure 16- Stable MDM2 knockdown in MANCA cells increases p53 recruitment to response
elements. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .57
Figure 17- MDM2 knockdown in MANCA cells increases H3K36 trimethylation after DNA
damage at the puma polyadenylation site. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
Figure 18- Histone H2B is altered by MDM2 knockdown in MANCA and A875 cells . . . . . 61
Figure 19- MANCA cells with MDM2 knockdown appear to have increased RNA pol II
ubiquitin modifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Figure 20- MANCA cells have increased MDMX protein stability with MDM2 knockdown. .72
Figure 21- MDM2 knockdown in MANCA cells alters MDMX protein levels in different
subcellular compartments. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
Figure 22- MDM2 and MDMX protein regulation are linked in MANCA cells. . . . . . . . . . . 75
Figure 23-Knockdown of MDM2 in MANCA cells does not change sensitivity to DNA damage
by etoposide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
Figure 24- G/G SNP309 cancer cells are sensitive to 8-amino-adenosine. . . . . . . . . . . . . . . . 85
Figure 25- Model describing predicted response to p53-dependent and p53-independent
chemotherapeutics in T/T vs. G/G SNP309 cancer cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
xii
Chapter 1: Introduction
1
1.1 The Role of Tumor Suppressor p53 Protein
Since the p53 protein was discovered in 1979 it has become one of the most widely
studied proteins (Linzer and Levine 1979). The p53 protein is well known for its important role
as a tumor suppressor in cancer. This is highlighted by the fact that p53 is mutated in
approximately 50% of all cancers and its pathway is inactivated in others (see reviews (Harris
and Hollstein 1993; Vogelstein et al. 2000; Jin and Levine 2001)). Under non-stress conditions in
cells, the p53 protein is kept at low basal levels due to rapid protein degradation (Haupt et al.
1997). Under stress conditions, such as DNA damage, oncogene activation, and hypoxia, the p53
protein becomes stabilized leading to varying cellular responses including cell-cycle arrest, DNA
repair, apoptosis and senescence (Figure 1) (see reviews (Levine 1997; Jin and Levine 2001;
Vousden and Lane 2007)). The tumor suppressive functions of p53 are generally the result of
cellular responses that decrease cell proliferation and promote cell death. However, p53 has
broader functions in development, metabolism and ageing (Vousden and Lane 2007).
Figure 1: p53 is activated by varying stressors leading to numerous cellular responses
From (Vousden and Lane 2007). Many different cell stressors (Blue) are able to activate p53 signaling leading
to numerous cellular responses (Purple).
2
1.1.1) p53 Protein Structure
The p53 protein consists of 393 amino acids which can be divided into several functional
domains (Figure 2) (see review (Levine 1997)). At the N-terminal region of p53 is a
transactivation domain that interacts with the cellular basal transcription machinery (Fields and
Jang 1990; Lu and Levine 1995; Thut et al. 1995; Farmer et al. 1996). This is followed by the
proline-rich domain shown to have some involvement in mediation of apoptosis and antiproliferative signals (Walker and Levine 1996; Venot et al. 1998). The central domain contains
the DNA binding domain, which binds to sequence specific response elements (Bargonetti et al.
1991; Bargonetti et al. 1992). Most of the p53 mutations are found within in this domain (Harris
1993). The tetramerization domain allows p53 to form a tetramer thus increasing both the
strength and conformation of p53-DNA complexes (Friedman et al. 1993; Wang et al. 1994;
McLure and Lee 1998). Finally, the C-terminal regulatory domain is reported to regulate the
sequence-specific DNA binding ability of p53 (Hupp and Lane 1994a; Hupp and Lane 1994b;
Yakovleva et al. 2001; Weinberg et al. 2004).
Figure 2: Schematic of p53 protein structure
From (Bell et al. 2002). Represents a schematic of p53 protein structure with is given protein domains.
The N-terminal region has the transactivation domain (TAD) followed by the proline-rich domain (Pro).
The central region has the DNA binding domain (DBD). At the C-terminal region is the tetramerization
domain (TD) followed by the regulation domain (RD).
1.1.2) Stabilizing p53 Protein via Cellular Stress
As described earlier, the p53 protein is kept at low basal levels under non–stress
conditions, but becomes stabilized after cellular stress. Different kinds of cellular stress can lead
3
to stabilization of p53 for activation (Kastan et al. 1991; Graeber et al. 1996; Linke et al. 1996).
The MDM2 protein is mainly involved in p53 stabilization via targeting p53 for ubiquitination
and rapid degradation and will be discussed further in a later section (Haupt et al. 1997; Honda et
al. 1997). The stress pathways usually regulate p53 through post-translational modifications with
the kind of cellular stress determining which modifications are present (see reviews (Appella and
Anderson 2001; Meek and Anderson 2009). The p53 protein can be post-translationally modified
and hence regulated by many different proteins (Figure 3) (see review (Meek and Anderson
2009)).
Figure 3- Post-translational modifications on p53 protein.
Taken from (Meek and Anderson 2009). The figure shows the functional domains of p53 with the sites for posttranslational modifications along modifying and de-modifying enzymes.
There are multiple residues on p53 that can be phosphorylated. In response to DNA
damage, several important protein kinase cascades are activated that in turn are responsible for
4
phosphorylating p53 protein at the N-terminus including ATM, ATR, Chk2 and DNA-PK (see
review (Meek and Anderson 2009)). In particular Serine 15 and 20 phosphorylation on p53, by
the ATM and Chk2 pathway is reported for stabilization and transcriptional activation with
conflicting reports as to whether it inhibits MDM2 binding (Siliciano et al. 1997; Canman et al.
1998; Dumaz and Meek 1999; Nakagawa et al. 1999; Unger et al. 1999; Hirao et al. 2000). The
acetylation of p53 is also promoted as a mechanism for p53 stabilization with several key Cterminal residues that can either be acetylated or ubiquitinated, but not both (Li et al. 2002).
Oncogenic stress signaling can lead to cooperation of ARF and ATM/ATR signaling to p53 for
apoptotic induction (Pauklin et al. 2005). Under hypoxic conditions, p53 can be stabilized by
HIF-1α (An et al. 1998). Ribosomal stress is also reported to stabilize p53 through MDM2
binding to ribosomal proteins preventing p53 degradation (Linke et al. 1996; Choong et al. 2009;
Holzel et al. 2010; van Leeuwen et al. 2011). Overall, the literature shows that p53 is able to
respond to varying stressors through its interactions with numerous proteins.
1.1.3) p53 as a Transcription Factor
The major function for p53 is as a transcription factor of its numerous target genes that
lead to tumor suppressive functions including cell cycle arrest and apoptosis (see reviews (Jin
and Levine 2001; Vousden and Lane 2007; Kruse and Gu 2009; Beckerman and Prives 2010).
The p53 protein binds to DNA at its target genes at sequence specific consensus sites, known as
p53 response elements (p53RE), which consist of two copies of a 10 base pair (bp) motif 5'PuPuPuC(A/T)(T/A)GPyPyPy-3’with 0 to 13 bp separating this sequence (el-Deiry et al. 1992).
This binding activates transcription via interactions with members of the basal transcription
machinery (Lu and Levine 1995; Thut et al. 1995; Farmer et al. 1996). Interestingly, the p53RE
sequence leads to differential transactivation with up to a 1,000 fold difference with the p21
5
5’p53 RE ranked highest and apoptotic gene p53RE’s having lower transactivation activity (Inga
et al. 2002).
In response to stress conditions, the p53 protein is post-translationally modified and
stabilized. The phosphorylation of Serine 15 at the N terminus of p53 is reported as a critical
target for p53-dependent transactivation at p53 response elements (Dumaz and Meek 1999;
Loughery et al. 2014). Acetylation on the C-terminus of p53, including lysines (K)
320,370,372,373 and 383 by p300/CBP and PCAF lead to enhancement of DNA binding activity
(Gu and Roeder 1997; Liu et al. 1999). Additionally, site specific acetylation on p53 can regulate
target gene expression to influence cellular response. For example, acetylation of K320 on p53
allows activation of genes with strong-affinity binding like p21, while p53 K373 acetylation
enhances interaction with lower-affinity apoptotic genes (Knights et al. 2006).
1.1.4) Transcriptional Regulation of p53 Target Genes
The chromatin landscape of p53 target genes plays a fundamental role in their
transcription. Analysis of the chromatin structure of promoter regions of p53 target genes
p21,14-3-3α and KARP-1, by DNase I hypersensitivity assays, revealed that transcription start
sites for these genes exist in an open conformation irrespective of p53 activation while the
downstream elements are closed (Braastad et al. 2003). These genes all have p53 response
elements localized near promoter regions. The P2 promoter region of the p53 target gene mdm2,
which has p53 response elements localized closely upstream, exists in a nucleosome-free region
(Xiao et al. 1998). Additionally, the chromatin structure of the p53 target gene gadd45 is not
significantly altered upon transactivation (Graunke et al. 1999). This suggests that transactivation
of p53 target genes does not massively change the chromatin structure at p53 response elements
near promoter regions (Braastad et al. 2003).
6
Several histone modifying enzymes are known to interact with p53 protein. Histone
acetyltransferases (HAT) including p300 and CBP along with co-activator TRRAP are recruited
by p53 promoting acetylation of the surrounding histones at promoter regions of target genes
(Lill et al. 1997; Barlev et al. 2001; Espinosa and Emerson 2001). Histone methyltransferases,
PRMT1 and CARM1, interact with p53 and cooperate with p300 during transcription (An et al.
2004). Histone H3 and H4 acetylation increase at p53 target genes when p53 becomes activated
by DNA damage (Kaeser and Iggo 2004). Therefore, p53 interaction with these histone
modifying enzymes is implicated in transcriptional activation. p53 also recruits histone
deacetylases, such as HDAC 1, for repressed transcription at specific genes (Juan et al. 2000).
Transcription initiation of p53 target genes varies depending upon the gene and the type
of stress given for activation. The p53 protein assists in the recruitment several components of
the pre-initiation complex including TFIID, TBP, TFIIA, and TFIIH (Lu and Levine 1995; Thut
et al. 1995; Farmer et al. 1996; Ko and Prives 1996; Xing et al. 2001). The p21 gene has higher
basal p53 recruitment and high levels of poised RNA pol II, while the fas promoter has low
levels of poised RNA pol II before activation allowing these genes to respond differently upon
DNA damage treatment (Espinosa et al. 2003). Therefore, specific genes can be more readily
activated dependent upon whether there was p53 recruitment and initiated RNA pol II before
addition of stress, which can directly contribute to the cellular response.
Factors involved in transcriptional elongation can also be directly linked to p53. The
transcriptional elongation factor ELL, known to increase transcription rates of RNA pol II,
interacts with p53 via binding to the C-terminal domain negatively regulating p53 transcriptional
activity (Shinobu et al. 1999). The H3K36 methyltransferase SETD2, which trimethylates
H3K36 for a transcriptional elongation mark, interacts with the p53 transactivation domain and
7
is implicated to selectively regulate the transcription of a subset of p53 target genes (Xie et al.
2008).
Figure 4: p53 is involved in regulation of transcription initiation and elongation.
From (Beckerman and Prives 2010). The p53 protein is involved in regulation of transcription initiation and elongation
since it interacts with general transcription factors (GTFs) in the pre-initiation complex, histone acetyltransferases (HATs),
histone methyltransferases (HMTs) and elongation factors (EFs).
The p53 protein also directly interacts with HEXIM1 via the C-terminal domain to increase p53
stability by preventing MDM2-mediated degradation (Lew et al. 2012). HEXIM1 is a protein
that negatively regulates the positive elongation factor-b (P-TEFb) to maintain it in an inactive
state (Dulac et al. 2005). MDM2 ubiquitinates HEXIM1 leading to greater inhibition of P-TEFb
transcriptional activity (Lau et al. 2009). There is an obvious interplay between p53, MDM2 and
HEXIM1 for P-TEFb regulated transcription (see review (Lew et al. 2013)).
8
As seen in this preceding section, a fundamental understanding of eukaryotic
transcription is necessary to see how p53 functions as a transcription factor. Additionally, p53 is
involved in multiple steps of the transcription process (Figure 4). The following section
addresses the basics of transcription for protein-coding genes and will provide important
background information.
1.2 Eukaryotic Transcription of Protein-Coding Genes in Cells
1.2.1) The Stages of Transcription by RNA pol II
Transcription is an evolutionary conserved process that occurs in most known living
organisms. At the most basic level, transcription is described as a process where a particular
DNA sequence is complementarily made into RNA by the enzyme RNA polymerase, which for
protein-coding genes in most eukaryotic cells starts with RNA polymerase II (RNA pol II).
Transcription is divided up into several stages to include: pre-initiation complex (PIC) formation,
promoter clearance, elongation and termination (Figure 5) (see reviews (Lemon and Tjian 2000;
Peterlin 2006)).
Activation of transcription usually starts with binding of a transcription factor to a
sequence-specific region of DNA that recruits general transcription factors (GTFs) and RNA pol
II to form the pre-initiation complex in the promoter region of the given gene (see reviews (Sims
et al. 2004; Geng et al. 2012)). A heptad repeat sequence on the C-terminal domain (CTD) of
RNA pol II is post-translationally modified to signal for initiation and allow transcription
elongation to occur (see reviews (Sims et al. 2004; Buratowski 2009)). One of the GTFs of the
initiation complex, TFIIH, phosphorylates the CTD of RNA pol II on Serine-5 (S5) at this heptad
repeat sequence (see reviews (Peterlin 2006; Buratowski 2009)). Due to being found primarily in
the promoter regions of genes, the phosphorylated Serine-5 CTD of RNA pol II is linked to
9
transcription initiation (Komarnitsky et al. 2000). These post-translational modifications on RNA
pol II leads to promoter clearance and a small amount of messenger RNA (mRNA) made near
the transcription start site (see reviews (Peterlin 2006; Buratowski 2009)).
After promoter clearance, the RNA pol II is paused by the negative elongation factor
(NELF) and DRB sensitivity inducing factor (DSIF) so that other elongation factors are recruited
to form the transcription elongation complex (TEC). Additionally, mRNA capping enzymes are
recruited to put a 5’ methylated cap on the RNA that was initially made (see reviews (Sims et al.
2004; Peterlin 2006)). The positive elongation factor complex-b, P-TEFb, transitions RNA pol II
into its elongating form by phosphorylating DSIF and Serine-2 (S2) on the CTD of RNA pol II
causing NELF to dissociate and allow for productive transcriptional elongation (see reviews
(Sims et al. 2004; Peterlin 2006; Buratowski 2009)).
The transition from Serine-5 to Serine-2 phosphorylation on the CTD of RNA pol II
represents signaling associated with early to later stages of transcriptional elongation because the
Serine-2 modifications are found in coding regions of genes (Komarnitsky et al. 2000;
Buratowski 2009). Phosphorylated serine-2 CTD RNA pol II increases with productive
elongation of the transcript. Additionally, during this elongation phase there is recruitment of
machinery necessary for splicing and polyadenylation of the resulting mRNA (see reviews (Sims
et al. 2004; Peterlin 2006; Buratowski 2009)).
10
Figure 5: Stages of Transcription by RNA pol II
From (Peterlin 2006): The stages of transcription shown as 1) Pre-initiation complex (PIC) formation, 2) promoter
clearance by phosphorylation of S5 on the CTD of RNA pol II by TFIIH, 3) recruitment of pausing factor NELF and
DISF and human capping enzymes (HCE) to methylate the 5’ cap of the nascent transcript and 4) phosphorylation of
DSIF and S2 CTD RNA pol II for productive elongation and recruitment of splicing (SR) and polyadenylation (pA)
machinery.
1.2.2) Regulation of the Chromatin Landscape during Transcription
Chromatin is a highly structured mixture of DNA and proteins found in the nucleus of
cells. The basic subunit is the nucleosome composed of histones H2A, H2B, H3 and H4 formed
in an octamer surrounded by approximately 150 bp of DNA (see reviews (Luger et al. 1997;
Strahl and Allis 2000; Jenuwein and Allis 2001)). The amino-terminal region or “tail” of
histones, and the DNA is subject to modifications associated with either gene activation or gene
silencing (see review (Jenuwein and Allis 2001)). During the multiple stages of transcription,
many changes occur to the chromatin landscape of the gene being transcribed.
When a transcription factor binds to a promoter region it signals for the recruitment of
general transcription factors, histone modifying enzymes, and RNA pol II for transcription
initiation (see reviews (Lemon and Tjian 2000; Zhang and Dent 2005; Berger 2007)). Total H3
and H4 acetylation by histone acetyl transferases (HATs), mainly p300/CBP, at promoter regions
11
of genes is associated with activation of transcription initiation (see reviews (Santos-Rosa and
Caldas 2005; Zhang and Dent 2005)). The initiated phospho-Serine 5 CTD RNA pol II is able to
recruit histone methyltransferases (HMTs) that cause H3 K4 and K79 methylation, modifications
also associated with transcription initiation (Figure 6) (see reviews (Santos-Rosa and Caldas
2005; Berger 2007; Buratowski 2009). The elongating phospho-Serine 2 CTD RNA pol II
recruits SETD2, a HMT that trimethylates H3K36 (H3K36me3), a chromatin modification
associated with active transcriptional elongation (Figure 6) (Morris et al. 2005; Sun et al. 2005;
Berger 2007; Edmunds et al. 2008; Buratowski 2009). The histone modification, H2B K120
ubiquitination and subsequent deubiquitination, are critical for the transition between initiation
and elongation during transcription (see reviews (Henry et al. 2003; Berger 2007; Geng et al.
2012)).
Figure 6: Chromatin Modifications associated with Transcription
From (Berger 2007). A) Represents Histone post-translational modifications (PTMs) associated with transcription
initiation and early transcription elongation at transcription start sites and in the open reading frame (ORF). H2B
K123 represents the yeast version of H2B K120 seen in mammalian cells. B) Represents Histone PTMs
associated with later elongation and attenuation of transcription. Abbreviations: ac-acetylated, dac-deacetylated,
me-methylated, ub-ubiquitinated, dub-deubiqutinated.
12
The nucleosomes are critically involved in transcription. In order for RNA pol II to move
through a gene that is transcribed, the histones ahead of the elongating complex need to move
out of the way, known as nucleosome/histone eviction, otherwise transcription may be blocked
(Schwabish and Struhl 2004; Workman 2006). Histones are in a state of flux during
transcription. There is continuous partial or total disassembly/reassembly of H2A/H2B dimers
and H3/H4 tetramers of the nucleosome during elongation (Thiriet and Hayes 2006; Workman
2006). In fact, some highly transcribed genes experience nucleosome loss and/or replacement
with histone variants, such as histone H3.3, that are more easily moved during transcription (see
reviews (Hake et al. 2006; Workman 2006; Park and Luger 2008)). Chromatin remodeling
complexes including SWI/SNF and FACT, with the help from histone chaperones such as
nucleoplasmin and nucleolin, assist in removing H2A/H2B dimers and H3/H4 tetramers so the
elongation complex can pass through the given gene (Laskey et al. 1993; Chen et al. 1994;
Saunders et al. 2003; Angelov et al. 2006; Workman 2006; Schwabish and Struhl 2007; Eitoku et
al. 2008; Park and Luger 2008). Now we will focus our attention on the main negative regulators
of the p53 protein.
1.3 MDM2
1.3.1) MDM2 Discovery and Regulation
The mdm2 gene was originally discovered in the 3T3DM cell line, a spontaneously
transformed line derived from mice, whereby increased copy number of the gene provided a
growth advantage to cells (Cahilly-Snyder et al. 1987; Fakharzadeh et al. 1991). MDM2 is
mainly characterized as the E3-ubiquitin ligase for p53 (Haupt et al. 1997). In many human
cancers, MDM2 protein can be found overexpressed by three different mechanisms: gene
amplification, increased transcription and enhanced translation (Oliner et al. 1992; Bueso-Ramos
13
et al. 1993; Landers et al. 1994). The human mdm2 gene spans a region of approximately 33kb
and has 12 exons under regulation by two different promoters (Oliner et al. 1992; Iwakuma and
Lozano 2003). The P1 promoter gives basal levels of mdm2 transcript and the P2 promoter is
inducible increasing levels of mdm2 transcript when the cells are exposed to stress (Barak et al.
1994; Zauberman et al. 1995). Multiple binding sites exist in the P2 promoter comprising
Ets/Ap-1, E-box, RXR, p53, Smad binding sites and GC boxes (see review (Manfredi 2010)).
This allows numerous transcription factors to regulate the P2 promoter including p53, estrogen
receptor (ER), Smad 2/3, MYCN, RXRγ and Sp1 (Zauberman et al. 1995; Bond et al. 2004;
Slack et al. 2005; Bond et al. 2006; Xu et al. 2009; Araki et al. 2010). Interestingly, mdm2
transcripts derived from the P2 promoter have more translation potential (Barak et al. 1994).
1.3.2) MDM2 Protein Structure
The full length MDM2 protein consists of a 491 amino acid polypeptide with a calculated
mass of 54kDa (Figure 7) (Fakharzadeh et al. 1991; Chen et al. 1993). However, products of
larger sizes exist as seen through the use of human mdm2 full length cDNA and in vitro
translation experiments (Chen et al. 1993). The MDM2 protein is divided up into several
domains. At the N-terminal region of MDM2, there is a p53-binding domain which binds to the
p53 transactivation domain (Chen et al. 1993). In addition, the N-terminal region of MDM2 has
sequence homology to the SWIB domain present in the SWI/SNF chromatin remodeling
complex (Riccardo Bennet-Lovsey 2002). The central region contains nuclear localization and
export signals involved in MDM2 nuclear-cytoplasmic shuttling (see review (Lozano and
Montes de Oca Luna 1998; Roth et al. 1998)). There are also acidic and zinc finger domains that
can bind many proteins including ribosomal proteins (see review (Chen et al. 2007; Manfredi
2010; Zhang et al. 2010)). The C-terminal region has a RING finger domain that is mainly
14
responsible for its ubiquitination activity (Boddy et al. 1994; Honda et al. 1997). There is also a
cryptic nucleolar localization signal in the C-terminal region (Lohrum et al. 2000). The functions
of some of these domains are known to be evolutionarily conserved. (Marechal et al. 1997). The
important conserved regions throughout various species include the central acidic domain,
known to interact with ribosomal proteins, zinc finger and RING finger domains and the Nterminal p53 binding domain (Marechal et al. 1997).
Figure 7: Schematic of full-length MDM2 protein
Adapted from (Okoro et al. 2012). Schematic represents full-length MDM2 protein. At the N-terminal region is the p53
transactivation domain, which has SWIB domain homology. In the central region is the nuclear localization signal (NLS)
and nuclear export signal (NES). This is followed by the Acidic and Zinc Finger domains. At the C-terminal region is the
RING finger domain and also a nucleolar localization signal (NoLS). The corresponding exons are found above the
specified domains.
1.3.3) Alternative/Aberrant Splicing and Isoforms
The mdm2 gene can produce mRNA in variously spliced forms from either alternative or
aberrant splicing (Bartel et al. 2002). Over 40 mdm2 transcripts have been identified (Bartel et al.
2002). Stressful conditions promote increased alternative splicing of mdm2 transcripts and
alternatively spliced variants are seen in many late stage and aggressive tumors (Sigalas et al.
1996; Lukas et al. 2001; Weng et al. 2005; Chandler et al. 2006; Dias et al. 2006; SánchezAguilera et al. 2006; Lents et al. 2008). Interestingly, the most commonly found and studied
mdm2 variants, mdm2-a,-b and –c, are missing exons that encode the p53 binding domain
(reviewed in (Okoro et al. 2012)). This implies that these variants have p53-independent
functions. Five splice variants, mdm2 A-E, are able to form protein by in vitro translation
experiments (Sigalas et al. 1996). However, it is unknown whether all mdm2 splice variants are
15
able to form protein in vivo. Recently, the MDM2-C isoform was detected as endogenously
expressed protein in cancer cells and tissue with a newly developed antibody against the exon 410 splice junction amino acid sequence (Okoro et al. 2013). Future work regarding the functions
of these endogenous MDM2 isoform proteins may give a more thorough understanding of
MDM2 functions in the cell.
1.3.4) The MDM2-p53 Interaction
The high significance of the MDM2-p53 interaction was first discovered using a
knockout mouse model. Loss of MDM2 expression leads to embryonic lethality (Jones et al.
1995; Montes de Oca Luna et al. 1995). However, loss of the p53 gene in mice that have had the
mdm2 gene knocked out is able to rescue the embryonic lethal phenotype demonstrating that
MDM2 is required for p53 regulation (Jones et al. 1995; Montes de Oca Luna et al. 1995).
MDM2 is able to regulate p53 at both the mRNA and protein level (Honda et al. 1997; Naski et
al. 2009). Interestingly, the MDM2-p53 mRNA interaction can enhance or repress translation
dependent on the stress applied to the cell via direct binding by the RING finger domain or
through the ribosomal protein RPL26 (Candeias et al. 2008; Ofir-Rosenfeld et al. 2008; Naski et
al. 2009; Gajjar et al. 2012).
The MDM2 protein is mainly characterized as a negative regulator of the p53 tumor
suppressor protein. The most well-known function of MDM2 is its E3-ubiquitin ligase activity
responsible for the ubiquitin-mediated degradation of p53 via the proteasome (Haupt et al. 1997;
Honda et al. 1997). A delicate balance exists between MDM2 and p53. The p53 protein functions
as a transcription factor for the mdm2 gene forming a negative feedback loop (Juven et al. 1993;
Wu et al. 1993; Zauberman et al. 1995). The levels of both proteins have been described in a
16
mathematical model where MDM2 and p53 oscillate allowing a coordinated response to various
cellular stresses regulating the feedback loop (Lev Bar-Or et al. 2000).
MDM2 is also characterized to negatively regulate p53 by inhibiting p53 transcriptional
activity (Momand et al. 1992; Thut et al. 1997). The well-characterized interaction between the
p53 binding domain of MDM2 with the p53 transactivation domain at the N-termini of both
proteins is believed to inhibit p53-mediated transactivation (Momand et al. 1992). Additionally,
earlier work also suggested a dual mechanism for MDM2 inhibiting p53 transactivation by
binding directly to TFIIE and interacting with the p53 transactivation domain to inhibit
recruitment of basal transcription machinery (Thut et al. 1997). Pharmacological inhibitors have
been made targeting the interaction between the p53 binding domain of MDM2 and the p53
transactivation domain. Nutlin-3, a well-known small-molecule inhibitor, can reactivate p53
signaling in numerous cancer types with MDM2 overexpression (Vassilev et al. 2004; Tovar et
al. 2006).
MDM2 co-localizes with p53 on chromatin at p53 target genes (Minsky and Oren 2004).
It has been proposed that at p53 REs, cells with basal MDM2 expression have MDM2-p53
complexes on the chromatin that are disrupted with DNA damage treatment to allow
transcriptional activation (White et al. 2006). However, transcriptional repression is recovered
when the complex is reformed (Figure 8A) (White et al. 2006). Cells that overexpress MDM2
due to a single nucleotide polymorphism (T to G) near the P2 promoter (mdm2 SNP309) have
MDM2-p53 complexes on chromatin that are unaffected by DNA damage treatment (Arva et al.
2005). Therefore, it was hypothesized that continued presence of these MDM2-p53 chromatin
complexes may block transcription of important downstream apoptotic and cell cycle arrest p53
target genes (Figure 8B) (Arva et al. 2005).
17
Figure 8: Models for MDM2-p53 Chromatin Complex Function
A
B
Adapted from (Arva et al. 2005; White et al. 2006). A model for MDM2-p53 chromatin complex function at
p53REs. The left shows MDM2-p53 chromatin complexes in cells with basal MDM2 expression. The
complexes are disrupted in the presence of DNA damage to facilitate transcriptional activation. On the right is
a model for G/G SNP309 cancer cells, the MDM2-p53 chromatin complexes display DNA damage resistance.
1.3.5) MDM2 Chromatin Functions
As previously mentioned, MDM2 can bind to chromatin when in complex with p53 at
p53 REs (Minsky and Oren 2004; Arva et al. 2005; White et al. 2006). However, MDM2 is also
reported to interact with chromatin and other chromatin-bound proteins besides p53. The MDM2
N-terminal domain has sequence homology with the SWIB domain, a part of the SWI/SNF
chromatin remodeling complex (Riccardo Bennet-Lovsey 2002). This implies MDM2 binds
directly to DNA and may be responsible for chromatin remodeling. MDM2 can bind to Nbs-1, a
protein that is a part of the DNA repair MRN complex that binds to sites of DNA damage (Alt et
al. 2005). Binding of MDM2 to Nbs-1 can delay DNA damage repair facilitated by the MRN
complex (Alt et al. 2005). The RING finger domain of MDM2 is reported to ubiquitinate histone
18
H2B (Minsky and Oren 2004). Interestingly, the RING finger domain of MDM2 can also bind to
nucleotides directly (Poyurovsky et al. 2003; Priest et al. 2010). The histone methyltransferases
SUV39H1 and EHMT1 are reportedly recruited by MDM2 to facilitate methylation of H3K9 and
p53 to regulate p53-mediated transcription (Chen et al. 2010). MDM2 interacts with the histone
deacetylase HDAC-1 to mediate deacetylation of p53 (Ito et al. 2002). Interestingly, the MDM2HDAC-1 interaction on chromatin can also reduce transcription by the Androgen receptor (AR)
family of transcription factors (Gaughan et al. 2005). Additionally, MDM2 binds to KAP1
contributing to p53 inactivation (Wang et al. 2005). KAP1 is a protein involved in general
transcriptional regulation due to its ability to recruit numerous chromatin-remodeling proteins
(Iyengar and Farnham 2011; Iyengar et al. 2011). This provides some evidence that MDM2 may
have broader implications in global chromatin functions.
1.4 MDMX
1.4.1) MDMX Discovery and Regulation
MDMX, also known as MDM4, was identified in a mouse cDNA library screen as a
novel p53 binding partner (Shvarts et al. 1996). It is encoded by the mdmX/mdm4 gene in
humans and mice with a transcript comprised of 11 exons (Shvarts et al. 1996; Shvarts et al.
1997). Several transcription factor binding sites are characterized in the human mdmX promoter
region including c-Ets-1, Elk-1 and Aml-1. All are deemed critical for increased MDMX
expression in a panel of tumor cell lines (Gilkes et al. 2008). Oncogenic K-Ras and insulin-like
growth factor-1 (IGF-1) induce mdmX transcriptional activation in an MAPK/ERK-dependent
manner showing MDMX expression can be regulated by mitogenic signaling (Gilkes et al.
2008). In 2006, a p53-binding site was identified within the first intron of the mdmX gene (Wei
et al. 2006). Luciferase reporter constructs with this mdmX intron 1 p53-binding site are
19
responsive to wild-type p53 in a co-transfection assay (Li et al. 2010). Similar to the mdm2 gene
(both human and mouse), the mdmX gene has its p53-binding site localized near its P2 promoter
(Phillips et al. 2010).
1.4.2) Structural and Functional Comparison of MDMX and MDM2
The MDMX protein was originally identified as a p53-binding protein with some
functional properties of MDM2 (Shvarts et al. 1996). Full-length MDMX consists of 490 amino
acids and similar to MDM2 has p53-binding, acidic, zinc and RING finger domains (Figure 9)
(Shvarts et al. 1996; Shvarts et al. 1997; Blaydes 2010) . Human MDMX protein is characterized
to have high sequence homology to human MDM2 protein particularly in the N-terminal p53binding domain and RING finger domain (Shvarts et al. 1997). However, unlike MDM2,
MDMX does not have nuclear localization and export signals. This is associated with the mostly
cytoplasmic localization of MDMX protein in cells and requirement of MDM2 to translocate
MDMX into the nucleus for p53 inhibition (Migliorini et al. 2002). Heterodimerization of
MDM2 and MDMX proteins via their RING finger domains stabilizes MDM2 causing more
efficient p53 ubiquitination (Sharp et al. 1999; Tanimura et al. 1999). Interestingly,
homodimerization of MDM2 has decreased stability compared to heterodimers of MDM2 and
MDMX proteins (Sharp et al. 1999; Tanimura et al. 1999). The RING finger domain of MDMX,
despite high sequence homology to MDM2, has very little or no E3-ubiquitin ligase activity
(Badciong and Haas 2002; Linke et al. 2008). It is suggested that the increase in E3-ligase
activity by the MDMX/MDM2 heterodimer, generally when cells are under non-stress
conditions, may be due to stabilization of the UbcH5b E2 protein when MDMX is present
(Badciong and Haas 2002; Kawai et al. 2007; Poyurovsky et al. 2007; Linke et al. 2008; Lenos
20
and Jochemsen 2011). Additionally, MDM2 E3- ligase activity also functions to promote
ubiquitination and degradation of MDMX (Pan and Chen 2003).
Figure 9-Comparison of MDMX and MDM2 protein domains
From (Blaydes 2010). Shows the similarity of the domains between MDM2 and MDMX proteins. Both
proteins share p53 binding domains, acidic, zinc-finger and RING finger domains. However, MDMX does
not have nuclear localization or export signals.
1.4.3) The MDMX-p53 Interaction
Multiple regulatory molecules are necessary to control p53 because of its critical function
in cells. In addition to MDM2, the MDMX protein regulates p53 activity. Overexpression of
MDMX contributes to tumorigenesis via inhibition of p53 tumor suppressor activity (Danovi et
al. 2004). Mice that are mdmX/4 null are embryonic lethal while still retaining the mdm2 gene.
The lethality is rescued by additional deletion of the p53 gene showing some non-redundant
MDM2 and MDMX regulatory functions (Parant et al. 2001). Specific deletion of either gene in
tissue-specific regions in mice reveals that both MDM2 and MDMX proteins have different
functions dependent upon cell type (reviewed in (Wade et al. 2010)). Due to the lack of E3ubiquitin ligase activity, MDMX is more strongly associated with inhibition of p53
transcriptional activity via binding with the p53 transactivation domain (Shvarts et al. 1996).
This interaction is also reported to inhibit p53 and p300 binding thereby decreasing p53
21
acetylation necessary for transactivation (Sabbatini and McCormick 2002). Similar to MDM2,
MDMX protein can be found on chromatin at p53 REs (Tang et al. 2008).
The MDMX protein plays a critical role in the p53 response to cellular stress. MDM2 and
MDMX work together to regulate p53 activity under cellular stress conditions. Upon DNA
damage treatment, there is MDM2-mediated degradation of MDMX resulting in p53 induction
(Kawai et al. 2003). Several groups have reported that ATM and Chk2-dependent
phosphorylation of MDMX at several C-terminal serine (S) residues contribute to MDM2mediated degradation of MDMX (Chen et al. 2005; Pereg et al. 2005; Pereg et al. 2006).
Phosphorylation of MDMX at tyrosine 99 (Y99) by c-Abl after DNA damage causes dissociation
and p53 activation (Zuckerman et al. 2009). Chk1 induced phosphorylation of MDMX at S367
enhances association with 14-3-3γ resulting in increased MDMX cytoplasmic localization and
p53 activation (Jin et al. 2006). Interestingly, DNA damage induced phosphorylation of MDMX
at S367 was also linked to p53 activation via MDM2-mediated degradation (Okamoto et al.
2005).
1.4.4) Splice Variants and Isoforms of MDMX
The mdmX/4 gene can produce transcripts of varying sizes in addition to the full length
form. To date, a total of six transcript variants have been identified in tumor tissue and/or tumor
cell lines (Mancini et al. 2009). The first transcript variant identified, called mdmX-s, results
from an internal deletion in exon 6 creating a stop codon and produces a transcript which retains
exons only encoding the p53 binding domain (Rallapalli et al. 1999). This variant and isoform,
MDMX-S, potently binds to p53 inhibiting p53 transactivation better than MDMX-FL
(Rallapalli et al. 1999; Rallapalli et al. 2003). Other characterized variants mdmX-a, mdmX-g
22
and mdmX-211 reportedly interfere with MDM2 stabilization and degradation functions (de
Graaf et al. 2003; Giglio et al. 2005; Mancini et al. 2009). Genotoxic cellular stress conditions
also produce alternative splice variants of mdmX,-ALT-1(missing exons 5 and 10) and ALT-2
(missing exon 3 and 10), respectively (Chandler et al. 2006). It is unknown if all mdmX splice
variants are translated into protein isoforms. However, several smaller MDMX protein isoforms
were identified in a panel of tumor cell lines (Ramos et al. 2001). This indicates that the variants
may be represented in these identified MDMX protein isoforms.
1.5) Chemotherapeutics and MDM2 Overexpressing Cancers
1.5.1) Types of Cancer with MDM2 overexpression
When overexpressed, MDM2 has the potential to cause several malignancies from
different primary sites. Indeed, there are over 40 different types of malignancies that can have
MDM2 overexpression by increased protein and/or mRNA expression or genomic amplification
(see review (Rayburn et al. 2005)). These include, but are not limited to, carcinoma of the brain,
esophagus, breast, thyroid, lung, liver, ovaries, bladder, colon, cervix and prostate, melanoma,
soft tissue sarcoma, osteosarcoma, and several hematological malignancies including leukemia
and lymphomas (Rayburn et al. 2005). Interestingly, MDM2 overexpression can signal for either
a better or worse prognosis dependent upon the cancer type making MDM2 a controversial
prognostic marker (see reviews (Onel and Cordon-Cardo 2004; Rayburn et al. 2005)).
Most clinicians are unsure of what high MDM2 expression means because MDM2 has
both p53-dependent and independent capabilities and functions in diverse cellular processes.
This is clearly seen for cases of soft tissue sarcomas with MDM2 overexpression, where there
are conflicting reports about how MDM2 correlates with survival and prognosis (Wurl et al.
23
1997; Rieske et al. 1999; Taubert et al. 2000; Bartel et al. 2001; Taubert et al. 2003). However,
in hematological malignancies there is a more definitive link between MDM2 overexpression
and poor prognosis, worse survival and resistance to chemotherapy (Gustafsson et al. 1998;
Moller et al. 1999; Zhou et al. 2000; Gustafsson et al. 2001). For breast cancers, overexpression
of MDM2 is reported to correlate with a worse prognosis (Turbin et al. 2006). However, MDM2
overexpression is generally associated with estrogen receptor (ER) positive cancers which are
generally seen to have better prognosis than ER negative breast cancers (Reiner et al. 1990;
Berger et al. 1991; Hideshima et al. 1997; Kim et al. 2011). Studies have shown that ER positive
breast cancer cells work through MDM2 to increase proliferation (Brekman et al. 2011; Kim et
al. 2011). Other studies have shown that MDM2 overexpression is associated with metastases of
different tumor types through mechanisms including upregulation of vascular endothelial growth
factor (VEGF) and matrix metalloprotease-9 (MMP-9) (Zietz et al. 1998; Patterson et al. 2011;
Chen et al. 2013). Finally, there are links between MDM2 overexpression and decreased
response to chemotherapy and radiation. In patients and several cell lines with MDM2
overexpression, there are reports of increased resistance to DNA damage (Suzuki et al. 1998;
Cocker et al. 2001; Rodriguez-Lopez et al. 2001; Rotterud et al. 2001; Nayak et al. 2007). All the
literature points to MDM2 having multiple roles in cancer (Figure 10) (Rayburn et al. 2005).
24
Figure 10- MDM2 has multiple roles in cancer and cancer therapy.
Taken from (Rayburn et al. 2005). MDM2 can confer metastasis and resistance to chemotherapy and
radiation. It has multiple roles in cancer through p53-dependent and independent activities.
1.5.2) Chemotherapeutic DNA damage agents used to treat cancers
A plethora of chemotherapeutic anti-cancer agents that target rapidly dividing cells exist
for treatment of many tumor types. What these agents mostly have in common is the ability to
directly or indirectly cause DNA damage. There are several classes of DNA damage agents
which are divided into: alkylating agents, anti-metabolites, and topoisomerase poisons (see
review (Cheung-Ong et al. 2013)). Some common drugs that are used in the clinic today
include, but are not limited to, cisplatin (alkylating agent), camptothecin, doxorubicin and
etoposide (topoisomerase poisons). All have the ability to elicit a DNA damage response (DDR)
by activating ATM and ATR kinases which can signal to p53 for activation of cell cycle arrest or
cell death (see reviews (Nitiss 2002; Woods and Turchi 2013).
25
In particular, etoposide is classified as a poison for topoisomerase II, an enzyme
responsible for binding to DNA at breaks, having the ability to stabilize the DNA- topoisomerase
II complex (see reviews (Champoux 2001; Nitiss 2002; Montecucco and Biamonti 2007)). The
reported cytotoxic effects are due to this ability causing massive amounts of cellular DNA
damage (Montecucco and Biamonti 2007). Due to production of double-strand breaks, etoposide
treatment of cells activates the ATM kinase and eventually leads to formation of foci of the
Mre11/Rad51/Nbs-1 (MRN) complex involved in DNA repair (Robison et al. 2005). The
activation of the ATR-Chk1 pathway is necessary to inhibit DNA replication after etoposide
treatment and involves regulation by Nbs-1 (Rossi et al. 2006). The activation of these DNA
damage response pathways by etoposide involves cell cycle checkpoint regulation and apoptotic
signals, which can work through the p53 pathway (Canman et al. 1994; Kastan et al. 1995;
Canman et al. 1998; Nitiss 2002; Montecucco and Biamonti 2007).
1.5.3) Targeted MDM2 inhibitors
Many small-molecule inhibitors in development are targeting the p53-binding domain of
MDM2 to prevent an MDM2-p53 interaction (see review (Vu and Vassilev 2011)). One of the
first class of potent inhibitors of this interaction called Nutlins, in particular Nutlin-3a, was
discovered to reactivate wild-type p53 signaling in some MDM2 overexpressing cancers
(Vassilev et al. 2004; Tovar et al. 2006). A modified version of Nutlin-3, RG7112, reported more
potent than Nutlin-3 can activate p53 signaling (Tovar et al. 2013; Vu et al. 2013). It is the one of
the first MDM2 inhibitors in clinical trials and has already shown some efficacy in patients in a
Phase1b trial for acute myeloid leukemia (Martinelli et al. 2013). Another class of
spirooxindole-structure compounds called the MI compounds, in particular MI-63, was reported
to have similar cell growth inhibition results compared to Nutlin-3 (Vassilev et al. 2004; Ding et
26
al. 2006). Finally, there are inhibitors that target the RING finger domain of MDM2 to inhibit
p53 degradation that need to be developed further (Herman et al. 2011).
1.5.4) Potential of therapeutics that can induce p53-independent cell death
After DNA damage, including chemotherapy and/or radiation treatment, patients can
develop resistance and the recurring cancer will be more aggressive than it was before treatment.
In many of these cases, there is inactivation of the wild-type p53 pathway either by mutation
and/or overexpression of MDM2 or MDMX (Buttitta et al. 1997; Laframboise et al. 2000; Nayak
et al. 2007; Jin et al. 2010; Knappskog and Lonning 2012). MDM2 is suggested as a contributor
to chemo-and radioresistance (see review (Rayburn et al. 2005)). The targeted chemotherapeutics
developed for MDM2 work through activation of p53 signaling although MDM2 has many p53independent functions (see reviews (Ganguli and Wasylyk 2003; Rayburn et al. 2005; Vu and
Vassilev 2011)). There are reported cases of cancers having both MDM2 overexpression and
mutant p53 (Cordon-Cardo et al. 1994). Additionally, having wild-type p53 does not always
correlate to a better prognosis (Taylor et al. 2000). Therefore, in cases where wild-type p53
cannot be activated through DNA damage or inhibition of MDM2, other treatment options need
to be available irrespective of p53 status.
Recently, a nucleoside analogue called 8-amino-adenosine was found to induce p53independent cell death in metastatic breast cancer cells with mutant p53 (Polotskaia et al. 2012).
It was also reported as a potential therapeutic for multiple myeloma because of its cytotoxic
effects similar to the RNA-directed actions of 8-chloro-adenosine (Stellrecht et al. 2003; Krett et
al. 2004). 8-Amino-adenosine can inhibit general transcription of cells and interfere with RNA
metabolism (Frey and Gandhi 2010). Interestingly, the kind of cell death induced by 8-amino-
27
adenosine varies dependent upon the cell line (Polotskaia et al. 2012). The use of agents that
induce p53-independent cell death may function better than standard DNA damaging agents (or
MDM2 inhibitors) for cancers with MDM2 overexpression and inactive p53 protein.
28
Chapter 2: Materials and Methods
29
2.1 Cell Culture – ML-1 cells were a generous gift from Michael Kastan and the MANCA cells
were a generous gift from Andrew Koff. A875 cells were a generous gift from the Arnold Levine
laboratory. ML-1, MANCA and A875 cells were grown in RPMI 1640 medium (Mediatech)
supplemented with 10% fetal bovine serum (Gemini) and 50U/ml of penicillin and 50μg/ml of
streptomycin (Mediatech) in a 5% CO2 37ºC humidified incubator. Suspension cells (ML-1 and
MANCA) for experiments were seeded at 2.5 x 105cells/mL. Phoenix packaging cells were a
generous gift from Scott Lowe. The packaging cells were grown in DMEM (Cellgro) with 10%
fetal bovine serum and 50U/ml of penicillin and 50μg/ml of streptomycin in a 5% CO2 37ºC
humidified incubator. MANCA and A875 MLP and MLP/shMDM2 cells were grown under
constant selection pressure in complete RPMI media supplemented with 2µg/mL or 3µg/mL of
Puromycin.
2.2 Drug Treatments – Cell were treated with: 8µM etoposide (ETOP) (SIGMA) dissolved in
sterile DMSO (SIGMA) or sterile DMSO for 6 hours, 5nM Actinomycin D (ActD) (SIGMA) for
24 hours or 15µM 8-amino-adenosine (8AA) for 24 hours dissolved in sterile water.
2.3 Bacterial Culture and Molecular Cloning
2.3.1) Plasmids - The pSM2c plasmids with shRNA, MLP.1224, STGM PGK PURO, pMSCVrtTA3-PGK-Hygro and Helper expression plasmids were generous gifts from Scott Lowe.
2.3.2) Bacterial Growth - Echeseria coli were grown on LB (Luria-Bertani (1% Bacto-tryptone,
0.5% Bacto-yeast extract, 1% NaCL)) - Ampicillin (100µg/ml))-Agar plates overnight at 37⁰C.
Colonies were grown in LB-Broth with Ampicillin (50µg/ml) for 8 hours or overnight at 37⁰C.
2.3.3) Mini/Maxi preps - Qiagen Mini/Maxi prep kits were used according to manufacturer’s
protocol.
30
2.3.4) Plasmid DNA cloning - Cloning shRNA sequences into MLP.1224 and STGM PGK
PURO (MLP and STGM) vectors were done by Jill Bargonetti, Angelika Brekman, Alla
Polotskaia and Mandeep Kaur. The shRNA sequences for mdm2, mdmX and p53 were cloned
from pSM2c vectors into XhoI and EcoRI restriction sites in miR30 sequence of MLP and
STGM vectors
2.3.5) Digestions - MLP and STGM vectors were digested with EcoRI and XhoI (New England
Biolabs, Inc.). Digestions performed with 10X NE EcoRI buffer, BSA, 20U/µL of restriction
enzymes and nuclease free water as according to manufacturer’s protocol. Samples were
incubated for 3 hours at 37⁰C followed by heat inactivation at 65⁰C for 20 min.
2.4 Cellular protein extracts
2.4.1) Whole cell extract - Cells were pelleted at 1100 rpm for 7 min at 40C, washed three times
with ice-cold PBS and resuspended in RIPA buffer (0.1% SDS, 1% IGEPAL NP-40, 0.5%
Deoxycholate, 150mM NaCl, 1mM EDTA, 0.5mM EGTA, 50mM Tris-Cl pH 8.0, 1mM PMSF,
8.5µg/ml Aprotinin, and 2µg/ml Leupeptin). The cell suspension was incubated on ice for 30 to
60 minutes to lyse the cells, vortexing occasionally. Additional sonication of lysate for 3 times
for 30 seconds/ 30 seconds rest on ice at 98% amplitude was done when deemed necessary.
Samples centrifuged at 13,000 rpm for 20 min at 40C. The supernatants were stored at
-800C.
2.4.2) Cytosolic and nuclear extracts - Cells were pelleted at 1100 rpm for 7 min at 40C and
washed three times with ice-cold phosphate buffered saline (PBS). Cells were then resuspended
in 5 packed cell volumes of Buffer A (10 mM Hepes; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM
PMSF; 0.5mM DTT; 2µg/ml Leupeptin; and 8.5µg/ml Aprotinin), centrifuged at 1100 rpm for 7
min at 40C, resuspended in 2 packed cell volumes of Buffer A. The samples were passed through
31
a 20 ½ G needle several times and incubated for 10 min on ice. Then the samples were
centrifuged at 13,000 rpm for 10 min at 40C and the supernatant was removed to give the
cytoplasmic fraction, which was stored at -800C. The remaining pellets were resuspended in 1
packed cell volume of Buffer C (20mM Hepes; 25% Glycerol; 420mM NaCl; 1.5mM MgCl2;
0.2mM EDTA; 0.5mM PMSF; 0.5mM DTT; 2µg/ml Leupeptin; 8.5µg/ml Aprotinin) and passed
through a 20½ G needle several times. The samples were then rocked for 30 min at 40C and
centrifuged for 30 min at 13,000 rpm at 40C. The supernatant constituted the nuclear fraction and
was stored at -800C.
2.4.3) Chromatin Fractionations - Cells were pelleted at 1100 rpm for 7 min at 4⁰C and
washed three times with ice- cold phosphate buffered saline (PBS). Cells were suspended in
Buffer A (10mM HEPES pH 7.9, 10mM KCl, 1.5mM MgCl2, 0.34M Sucrose, 10% glycerol,
1mM DTT, 0.5mM PMSF, 2µg/ml Leupeptin, 8.5µg/ml Aprotinin) + 0.1% Triton X-100..
Incubated on ice 5 min. Spun down cells 3600 rpm for 5 min at 4⁰C. Spun down supernatant for
an additional 5min at 13,000 rpm at 4⁰C to clarify (S1 Fraction). Washed pellet 2 times with
Buffer A spinning down at 3600 rpm for 5min at 4⁰C. Resuspended nuclei pellet in Buffer B
(3mM EDTA, 0.2mM EGTA, 0.5mM PMSF, 2µg/ml Leupeptin, 8.5µg/ml Aprotinin). Samples
were incubated on ice 30 minutes with vigorous vortexing every 5 minutes and then spun down
4000 rpm for 5 min at 4⁰C. The supernatant is nuclear soluble proteins (S2 Fraction) and the
pellet is enriched in chromatin. Washed pellet 2 times with Buffer B. Resuspened pellet (P3
Fraction) in RIPA buffer and sonicated 3 times 30 sec/30 sec rest on ice. Froze samples at -80⁰C.
2.5 Western Blot analysis – Cell lysates were resuspended with lysis buffer and 6X Laemmli
Buffer with 12% β-Mercaptoethanol (final concentration 1X) and heated at 95⁰C for 7 minutes.
For resolution of MDM2 and MDMX proteins the lysate was resuspended in 4X NuPAGE LDS
32
buffer (Invitrogen) and DTT so that final concentrations for components were 1X for NuPAGE
buffer and 20mM DTT. The samples were heated at 70⁰C for 10 minutes and Iodoacetamide was
added to a final concentration of 100mM before loading onto gel. Without Iodoacetamide the
MDM2 did not run as a sharp band but rather as a large fuzzy band. The samples were then
separated by use of 8%, 10%, 12%, 14% or 4-12% (Invitrogen) SDS-PAGE followed by an
electro-transfer to nitrocellulose membrane or PVDF membrane for smaller proteins and blocked
with 5% milk solution in 0.1% Tween 20–PBS. The membranes were probed with primary
antibodies overnight at 40C. Membranes were washed 3 times with 0.1% Tween 20 - PBS
solution. Secondary HRP-conjugated antibodies applied in 1% milk solution of 0.1% Tween 20 –
PBS for 1 hour at room temperature followed by an additional three washes of 0.1% Tween 20–
PBS solution. The signal was detected by chemiluminescence. Actin-HRP (Santa Cruz) antibody
was used in 1% milk solution of 0.1% Tween 20 –PBS for 90-120 minutes at room temperature.
2.6 RNA isolation and quantitative RT-PCR – Cells were centrifuged at 1100 rpm for 7 min at
40C, washed three times with ice-cold PBS. The RNA was isolated using QIA shredder columns
and the RNeasy Mini Kit (Qiagen) following manufacturer’s protocol. RNA was stored at -800C.
1-5µg of RNA was used for cDNA synthesis using the High Capacity cDNA Archive Kit
reagents and protocol (Applied Biosystems), where the RT master mix (containing RT buffer,
dNTPs, random primers and MultiScribe reverse transcriptase) along with the RNA was
incubated at 25ºC for 10 min and then at 370C for 2 hrs. cDNA was stored at -200C.
Amplification
of
gene
p21(Hs00355782_m1),
(Hs00538709_m1),
transcripts
by
quantitative
pig3(Hs00153280_m1),
gadd45a
(Hs00169255_m1),
PCR
with
primer
probes
for
puma
(Hs00248075_m1),
fas
mdm2(3-4)
(Hs01069930_m1),
mdmx
(Hs00910358_s1), and gapdh (4333764) (Applied Biosystems Assays on Demand) combined
33
with the cDNA and Taqman Universal Master Mix was carried out following the program: one
cycle, 2 min, 500C; one cycle, 10 min, 950C; and 40 cycles, 15 seconds, 950C and 1 minute 600C
in a 7500 Sequence Detection System or ViiA7 sequence detection system (Applied
Biosystems).
2.7) Immunoprecipitations - 0.5-1 mg of protein was isolated out from protein extracts and
adjusted to equal volumes with either Co-IP or RIPA lysis buffer. We used Co-IP lysis buffer
when wanted to co-immunoprecipitate proteins. Antibody (2-5µg) was added to samples for
overnight rotating incubation at 4 ºC. Next day 50µl of 25% bead slurry of Protein A/G+ beads
(Santa Cruz) was added to samples and incubated for an additional 2 hours at 4 ºC. Spun down
2000 rpm for 3min at 4 ºC and then washed beads three times with 1mL of lysis buffer. Added
5X Lammeli buffer (with 10% β-Mercaptoethanol) or 4X NuPAGE buffer (diluted to 2X with
components listed in Western blot) to beads and ran SDS-PAGE and western blot analysis. Used
either Co-IP lysis buffer (50mM Tris-HCl pH 7.4, 50mM NaCl, 1% Triton X-100, 1mM
PMSF8.5µg/ml Aprotinin (SIGMA), and 2µg/ml Leupeptin, 1/100 dilution phosphatase inhibitor
cocktail 3 (SIGMA) (optional)) or RIPA buffer (0.1% SDS, 1% IGEPAL, 0.5% Deoxycholate,
150 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 50 mM Tris-Cl pH 8.0, 1 M PMSF, 8.5µg/ml
Aprotinin (SIGMA), and 2µg/ml Leupeptin, 1/100 dilution phosphatase inhibitor cocktail 3
(SIGMA) (optional)).
2.8 Chromatin Immunoprecipitation (ChIP) – Cells were cross-linked for 10 min at 37ºC in
1% formaldehyde followed by shaking 5 min at room temperature with 0.125 M Glycine
addition to quench the reaction. Cells then washed four times with cold 1X PBS; spun down at
1100 rpm, 7 min at 4ºC for suspension cells and 2000 rpm for 15 min at 4 ºC for adherent cells ;
resuspended in 1X RIPA Buffer (0.1% SDS, 1% IGEPAL, 0.5% Deoxycholate, 150mM NaCl,
34
1mM EDTA, 0.5mM EGTA, 50mM Tris-Cl pH 8.0, 1 M PMSF, 8.5µg/ml Aprotinin (SIGMA),
and 2µg/ml Leupeptin, 1/100 dilution phosphatase inhibitor cocktail 3 (SIGMA)), incubated for
30 minutes on ice; sonicated on ice to shear chromatin into approximately 3500-150 bp
fragments; and spun down at 13,000 rpm for 20 min at 40C. Immunoprecipitations carried out
overnight using 400µg of protein. For p53, Mdm2, RNA pol II and Cdk9 antibodies used 2 µg
of antibody per reaction and for H3K36me3 antibody used 5µg per reaction. The next day, prewashed in PBS and pre-blocked with 0.3 mg/ml herring sperm DNA (Invitrogen) for 30 min at
40C, Protein A/G Plus Agarose beads (Santa Cruz) were added for 2 hrs with rocking at 4 °C.
For the Covance H5 antibody, used 3µL (3-5 mg/mL- approximately 9-15µg) of antibody with
50µL of anti-mouse IgM Agarose beads (Sigma) diluted to 25% bead slurry (blocked with
1mg/mL BSA and 0.3mg/mL herring sperm DNA). Then the samples were spun down for 2 min
at 3,000 rpm at 4ºC and were washed with (1) 0.1% SDS, 1% Triton-X, 20mM Tris pH 8.1,
150mM NaCl, (2) same as Wash 1 but NaCl is 500mM, (3) 0.25M LiCl, 1%IGEPAL, 1% Na
Deoxycholate, 1mM EDTA, 10mM Tris pH 8, (4) TE pH 8, (5) same as Wash 4; every time
spinning the beads down between each wash. To obtain DNA from these samples for PCR,
added 100μL of 1X Elution buffer (0.1M NaHCO3 in 1% SDS) and 1mg/mL Proteinase K
(SIGMA), and incubated overnight at 65C. DNA fragments were purified using Qiagen PCR
Purification kit (Qiagen) according to manufacturer’s protocol and were amplified by
quantitative PCR.
Used primers designed to amplify the gene regions p21 5’ p53 binding site and TATA
box and puma p53 binding sites/ transcription start site. Sequences for sites are given below for
primers and Taqman probes (Applied Biosystems) as described in (Kaeser and Iggo 2002;
Kaeser and Iggo 2004).
35
p21: p53RE (5’) Forward – 5’GTGGCTCTGATTGGCTTTCTG-3’
Reverse- 5’ CTGAAAACAGGCAGCCCAAG-3’
Probe- 5’- TGGCATAGAAGAGGCTGGTGGCTATTTTG-3’
TATA box Forward- 5’CGCGAGGATGCGTGTTC-3’
Reverse – 5’CATTCACCTGCCGCAGAAA-3’
Probe - 5’CGGGTGTGTGC-3’
puma p53RE: Forward- 5’-GCGAGACTGTGGCCTTGTGT-3’
Reverse- 5’- CGTTCCAGGGTCCACAAAGT-3’
Probe – 5’- TGTGAGTACATCCTCTGGGCTCTGCCTG-3’
Used primers designed to amplify other regions of p21 and puma genes with SYBR Green Dye
(Applied Biosystems). Below is a chart of primers used described in (Gomes et al. 2006; Gomes
and Espinosa 2010).
p21 +7011 F
CCTGGCTGACTTCTGCTGTCT
p21 + 7011 R
CGGCGTTTGGAGTGGTAGA
p21 + 8566 F
CCTCCCACAATGCTGAATATACAG
p21 + 8566 R
AGTCACTAAGAATCATTTATTGAGCACC
puma +6014 F
AGGTGCTGCTCCGCCA
puma +6014 R
CCCTCTGCCTCTCCAAGGTC
puma +11,910 F ACATGATTTTTGTATGTTTCCTTTTCAATA
puma +11,910 R AAAGAGTATCCACTGTTCCAATCTGA
2.9 Antibodies
2.9.1) Western Blot - Mix of mouse monoclonal supernatant antibodies 421, 1801 and 240 for
p53; a mix of mouse monoclonal supernatant antibodies 4B2, 2A9 and 4B11 for MDM2; (H224) rabbit polyclonal RNA Pol II (Santa Cruz); (Ab-1) mouse monoclonal anti-p21
(Calbiochem); Mdm2C 4-10 rabbit polyclonal custom developed by immunizing rabbit with the
C4-10 peptide (Biosynthesis, Inc.); rabbit polyclonal MDMX (Bethyl); (C-20) rabbit polyclonal
Cdk9 (Santa Cruz); (H14) mouse monoclonal phosphorylated Serine 2 CTD RNA pol II
(Covance); mouse monoclonal β-Tubulin (Sigma), rabbit polyclonal Fibrillarin (abcam); goat
polyclonal H3 (Santa Cruz); rabbit polyclonal Histone H2B (abcam); rabbit polyclonal anti-actin
(Sigma); Secondary anti-mouse, anti-rabbit and anti-goat/sheep HRP antibodies (Sigma);
2.9.2) ChIP - (DO-1) mouse monoclonal anti-p53 (Calbiochem), (N-20) rabbit polyclonal Mdm2
(Santa Cruz); (H-224) rabbit polyclonal Pol II (Santa Cruz); (H5) mouse monoclonal
36
phosphorylated Serine 5 CTD RNA pol II (Covance); (C-20) rabbit polyclonal Cdk9 (Santa
Cruz); goat polyclonal H3 (Santa Cruz); ); rabbit polyclonal anti-RNA polymerase II CTD repeat
(phospho S2) ChIP grade (ab5095-abcam); rabbit polyclonal anti-Histone H3K36me3 ChIP
grade (ab9050-abcam); Goat IgG (Santa Cruz); Rabbit IgG (Santa Cruz); Mouse IgG (Santa
Cruz); Mouse IgM isotype control (Sigma)
2.10 Generation of stable and inducible shRNA cell lines
For stable shRNA knockdown cell lines, infected cells with MLP vector with shRNA using MLP
empty vector as control. For doxycycline-inducible shRNA knockdown cell lines, used STGM
vector with shRNA co-infected with rtTA3. Doxycycline binds to rtTA protein and together they
bind to the doxycycline-regulated promoter (TRE) to induce shRNA expression. Used STGM
empty vector co-infected with rtTA3 as control. Both MLP and STGM vectors are Puromycin
resistant and rtTA3 is Hygromycin resistant. GFP expressesion was used to assess shRNA
expression.
2.10.1) shRNA sequences
Clone ID
Position
shRNA sequence
mdm2 151656
1793…1811
CTGTCTATAAGAGAATTAT
mdmx 13023
246…264
GGTGAAATGTTCACTGTTA
p53 2120
2120…2139
GAGGATTTCATCTCTTGTA
2.10.2) Transient Transfection of Phoenix Packaging cells to make Retrovirus - Phoenix
packaging cells were plated at 5 x 106 cells per 10 cm plate and allowed to incubate (12-24
hours) overnight. Changed media on packaging cells with 9 ml of complete DMEM media
supplemented with 25µM chloroquine. Mixed together a DNA solution of 20µg retroviral DNA
37
(Either MLP or STGM vector with/without shRNA or rtTA3 vector) and 5µg of Helper plasmid
DNA with 2M CaCl2 in 0.01M HEPES pH 5.5 and sterile water into 2X BBS (50mM BES,
280mM NaCl, 1.5mM Na2HPO4 at pH 6.95) dropwise with bubbling. Waited 15 minutes for
precipitate to form and added 1 mL of this mixture into the packaging cells and incubated plates
overnight (no longer than 18 hours). Next day, changed media on packaging cells in the morning
and in the evening (7 mL per 10 cm plate) and let incubate overnight. The next day from
packaging cells, at five hour intervals, collected media containing virus and replaced with fresh
media and filtered through 0.45µm syringe filter to either use or freeze at -80⁰C.
2.10.3) Retroviral-mediated Gene transfer
MANCA cells – Used viral containing media and added 2µg/mL polybrene (Millipore) to make
infection cocktail. Counted MANCA cells using a hemocytometer and resuspended 1.0 x 106
cells into 2mL of infection cocktail and added to a six-well plate. The cells in the plate were spun
down at 1200 rpm for 120 minutes at 30⁰C using a plate rotor. After the spin, the cells were
collected in 15mL falcon tubes by spinning down at 1100 rpm for 7 minutes and resuspended in
4mL of complete RPMI media. After transferring to tissue culture flasks, the cells were allowed
to grow for 24-72 hours and the drug selection was started.
A875 cells - The cells were seeded at approximately 30% confluency the day before infection
into a 6 well plate. On the day of infection, combined viral containing media with 4µg/ml
polybrene for infection cocktail and added to wells (2mL/well). The plate was spun down at
1800 rpm for 45 min at room temperature and then incubated in a 37ºC incubator for 4 hours.
Replaced the infection cocktail in the wells with fresh infection cocktail and proceeded to spin
down the cells again at 1800 rpm for 45 minutes. This was followed by an additional 4 hour
incubation at 37ºC. The infection cocktail was removed from the cells and replaced with fresh
38
media. After growing overnight (12-24 hours), the cells were then split into a new plate and
allowed to grow for 24 hours. This was followed by the drug selection.
2.10.4) Drug selections of Retroviral-infected cells - After infection both MANCA and A875
cells were selected with either Puromycin or Hygromycin B. Before this was done a kill curve
was performed for each of the antibiotics to find the minimum dose that could be tolerated for
selection. For MANCA cells, a kill curve was performed with Puromycin comparing the
following concentrations 0, 1,2,4,6, and 8µg/mL over a seven day period. The same was done for
the MANCA cells with Hygromycin B comparing the following concentrations 0,
400,500,600,700, and 800µg/mL over a seven day period. For A875 cells, a kill curve was
performed with Puromycin comparing the following concentrations 0, 1,2,3,4 and 5µg/mL over a
seven day period. The same was done for Hygromycin B at the following concentrations 0, 300,
400, 500, 600, 700, 800, and 1000µg/mL over a seven day period. Cell counts using a
hemocytometer and/or MTT assay were used for cell viability along with visual microscopic
examination.
The following doses and time points were selected for each cell line:
MANCA cells - 2µg/mL of Puromycin for five days
500µg/ml of Hygromycin B for seven days
A875 cells - 3µg/ml of Puromycin for three days
600µg/ml of Hygromycin B for seven days
Double infected MANCA cells with constitutive and inducible mdm2 and mdmx shRNA and
rtTA3, selected cells in media with 2µg/ml of Puromycin and 500µg/ml Hygromycin B for seven
days.
39
2.11 MTT Assay - MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) stock
solution (5mg/ml in clear HANKs media) was added to treated cells in volume equal to 10% of
culture medium. Let cells incubate in 37⁰C incubator until color developed. Added MTT
solubilization solution (90% anhydrous isopropanol, 10% Triton X-100, and .826% 12.1N HCl)
to volume equal to original culture medium and pipetted to mix to dissolve formazan crystals.
Gently shook for 5 min at room temperature and then analyzed samples with plate
spectrophotometer. The absorbance was measured at 550nm and the 620nm absorbance was
subtracted for background to allow for quantification.
40
Chapter 3: G/G mdm2 SNP309 cancer cells
display compromised transcriptional
elongation of p53 target genes
41
3.1- Introduction
MDM2 overexpression is found in over 40 different tumor types (Rayburn et al. 2005).
A single nucleotide polymorphism (SNP) at position 309 of the mdm2 gene leads to increased
mdm2 transcription and is linked to increased cancer incidence, aggressiveness and accelerated
tumor development (Bond et al. 2004; Post et al. 2010). A nucleotide change from thymine to
guanine increases the binding affinity of the ubiquitous transcription factor, Sp1, for a site near
the P2 promoter of the mdm2 gene (Bond et al. 2004). Patients characterized as homozygous
G/G at SNP 309 manifest earlier age of onset of cancer and increased susceptibility to certain
cancer types in a gender and hormone specific manner (Bond et al. 2004; Bond et al. 2006). G/G
mdm2 SNP 309 cancer cell lines are reported to have an attenuated p53 stress response (Bond et
al. 2004). These cells are also described to have resistance to topoisomerase II- targeted
chemotherapeutic DNA damaging drugs, compromised p53 transcriptional activity after DNA
damage treatment and a disruption of p53-MDM2 oscillations in response to cellular stress
(Bond et al. 2004; Arva et al. 2005; Hu et al. 2007; Nayak et al. 2007). This implicates MDM2
overexpression in G/G SNP309 cancers as a driver for increased cancer incidence and
chemoresistance to standard DNA damage treatment through inhibition of wild-type p53
signaling.
An integral part of wild-type p53 signaling occurs through its function as a transcription
factor. MDM2-p53 chromatin complexes contribute to down-regulation of p53 transcriptional
activity (Arva et al. 2005; White et al. 2006). After DNA damage, cells with basal-level MDM2
expression can activate p53 recruitment to chromatin and transactivation of p53 target genes. The
MDM2 found in complex with p53 at p53 responsive elements (p53REs) is released upon
activation of DNA damage (White et al. 2006). After the initial DNA damage response has
42
passed, MDM2-p53 complexes reform on chromatin and are associated with repressed p53mediated transcription (White et al. 2006). Homozygous G/G mdm2 SNP309 cancer cells have
excess levels of MDM2 protein and MDM2-p53 chromatin complexes that are not sensitive to
DNA damage treatment, and this correlates with the inhibition of p53 transcriptional activity
(Arva et al. 2005). Three hours of etoposide treatment in various G/G SNP309 cancer cell lines
results in increased MDM2-p53 chromatin complexes compared to wild-type T/T cells (Arva et
al. 2005). ML-1 (T/T) cells are suitable for comparison to the G/G SNP309 MANCA and A875
cancer cell lines to examine the molecular signaling involved in compromised p53 transcriptional
activity (Arva et al. 2005). Six hours of DNA damage treatment in ML-1 cells, by various agents,
represents a critical point in p53 stabilization and peak of transcriptional activity (Abbas et al.
2002; Arva et al. 2005; White et al. 2006). All work done for this thesis was performed at the
critical six hour time point to examine compromised p53 transcriptional signaling seen in G/G
SNP309 MANCA and A875 cell lines. These cell lines and the ML-1 cell line are described in
the table below (Table 1). The purpose of this study was to investigate the mechanism of
compromised p53-dependent transcription in G/G SNP309 cancer cells and what role chromatinbound MDM2 may play in transcriptional regulation.
Table 1- Cell Lines Examined
Cell Line
p53 status
mdm2 SNP309 status
Cell Type
ML-1
MANCA
A875
wild-type
wild-type
wild-type
T/T (wild-type)
G/G (homozygous)
G/G (homozygous)
chronic myeloid leukemia
Burkitt lymphoma
Melanoma
43
3.2 Results
3.2.1) G/G SNP309 cancer cell lines display compromised p53 transcriptional activity and
MDM2-p53 complexes on chromatin.
Treatment of G/G SNP309 cancer cell lines with various DNA damaging agents yields
compromised transcription of p53 target genes relative to wild-type cells including p21, gadd45
and fas (Arva et al. 2005). Additionally, G/G SNP309 cancer cells maintain higher basal levels
of wild type p53 that is not degraded efficiently (Arva et al. 2005). We previously published
work showing that MANCA and A875 cells have compromised apoptotic signaling as compared
to ML-1 cells after 24 hours of DNA damage treatment by etoposide, camptothecin and
mitomycin C. FACS analysis shows that, only in ML-1 cells, treatment with DNA damage
agents significantly increases sub-G1 populations of cells representing apoptotic cell death (Arva
et al. 2005). Therefore, we were interested in comparing apoptotic p53 target genes such as
puma. Using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), we
looked at transcript levels of five common p53 target genes in ML-1 cells vs. MANCA and A875
cells after six hours of DNA damage treatment by etoposide (Figure 11). In addition to the p53
target genes p21, gadd45 and fas, transcription of the other genes puma and pig 3 was
compromised in MANCA and A875 cells in comparison to ML-1 cells. However, the response
for the gene pig 3 was higher in A875 cells as compared to MANCA cells (Figure 11). These
data support our previous findings that G/G SNP309 cancer cells display abnormally low p53
transcriptional activity after DNA damage for several types of p53 target genes.
44
Figure 11- G/G SNP309 MDM2 overexpressing cells display compromised wild-type p53
transcriptional activity after DNA damage.
ML-1, MANCA and A875 cells were treated with DMSO or 8 µM etoposide for 6 hours. Time point is reflected
as the highest point of p53 transcriptional activity in the ML-1 cells. Quantitative RT-PCR for p53 target genes
was normalized to gapdh as loading control. Values represent average of six independent experiments with
standard error bars for MANCA cells. The number of independent experiments for ML-1cells varies per gene
with n for p21 equal to 5, gadd45 equal to 3, fas equal to 3, puma equal to 4 and pig 3 equal to 5 given with
standard error bars. Values for A875 cells represent an average of three independent experiments with standard
error bars. The graph is shown on a logarithmic scale.
In G/G SNP309 cancer cells, the p53 protein binds DNA and is phosphorylated at Serine
15, a post translational modification associated with transcriptional activation at p53 response
elements (Dumaz and Meek 1999; Arva et al. 2005; Loughery et al. 2014). In contrast to G/G
SNP309 cancer cells, ML-1 cells have transcriptionally active p53 protein and less MDM2
protein localized at p53RE’s for p21 and mdm2 target genes after three hours of etoposide
treatment (Arva et al. 2005). We assessed the recruitment of p53 and MDM2 to chromatin after a
six hour-etoposide treatment, since six hours is the peak for p53 stabilization and transcriptional
45
activity in ML-1 cells. All cell lines were examined under these conditions as compared to the
three hour time point for p21 and puma genes. As expected, ML-1 cells showed increased p53
recruitment to p21 and puma p53 response elements after DNA damage by etoposide (Figure
12A). In MANCA cells, there was also increased p53 recruitment after DNA damage at p53
responsive elements for both genes. A875 cells had higher basal p53 recruitment at the p21 gene
than at puma, but both genes had trends of DNA damage induced p53 recruitment (Figure 12A).
MDM2 was also recruited to these sites in all three cell lines. We observed some MDM2
recruitment in ML-1 cells at p21 and puma genes associated with the large increase in p53
recruitment after etoposide treatment (Figure 12B). This correlates with the data published for
MDM2 recruitment back to chromatin after 6 hours with p53 to re-repress transcription of the
mdm2 gene (White et al. 2006). MANCA cells had a small significant increase in MDM2
recruitment after DNA damage at the p21 gene, with this trend also seen at the puma gene
(Figure 12B). This corresponds to the increase in p53 recruitment in MANCA cells after DNA
damage. A875 cells also displayed a small trend of increased MDM2 recruitment (Figure 12B).
In addition, we directly compared the ratios of MDM2 to p53 on chromatin for ML-1,
MANCA and A875 cell lines (Figure 12C). At the p21 gene, we observed that MANCA cells
had the highest ratio of MDM2 to p53 on the chromatin before etoposide treatment, which
decreased after treatment. We observed that MANCA cells had the lowest levels of p53
recruitment, while ML-1 cells had higher basal levels of p53 recruitment that increased
significantly after etoposide treatment (Figure 12A). Therefore, higher levels of p53 recruitment
contributed to the decrease of the MDM2 to p53 ratio. Interestingly, because A875 cells had high
basal levels of p53 recruitment to the p21 gene the ratio of MDM2 to p53 was low and did not
change much with etoposide treatment (Figure 12C). At the puma gene, we observed that before
46
etoposide treatment MANCA cells also had the average highest ratio of MDM2 to p53 on
chromatin (Figure 12C). However, in ML-1 cells we observed that the MDM2 to p53 ratio was
higher for puma than the p21 gene before etoposide treatment (Figure 12C). As before, the ratio
of MDM2 to p53 in A875 cells did not change with etoposide treatment although the ratios are
slightly higher for puma as compared to the p21 gene (Figure 12C). Overall, the data shows that
MANCA cells had the highest MDM2 to p53 ratio on chromatin as compared to the ML-1 and
A875 cell lines irrespective of etoposide treatment.
In order to address whether G/G SNP 309 cells have more MDM2 protein globally on the
chromatin compared to ML-1 cells, we performed a biochemical fractionation assay that
separates the cell into chromatin, nuclear soluble and cytosolic fractions and performed Western
Blot analysis for p53 and MDM2 protein levels (Figure 12D). We observed higher levels of
MDM2 and p53 on the chromatin in MANCA and A875 cells as compared to ML-1 cells. Our
data shows that these G/G SNP309 MDM2 overexpressing cancer cells have increased MDM2
and stabilized p53 protein on chromatin globally.
47
Figure 12- G/G SNP309 cells have increased MDM2 and p53 protein on chromatin and
increased p53 recruitment to p53REs after DNA damage.
ML-1, MANCA and A875 cells treated with DMSO or 8 µM etoposide for 6 hours. A and B) Chromatin
immunoprecipitations were performed for p53 and MDM2 proteins and analyzed by quantitative PCR using
d primers for the p21 gene 5’ p53 responsive element and puma gene p53 responsive elements. ML-1 and
MANCA results represent four to six independent experiments. A875 results represent two independent
experiments. All results given with standard error bars. All chromatin immunoprecipitation samples normalized
to IgG and input values. C) The MDM2 to p53 ratio was found by dividing the amount of MDM2 recruited at the
p53 RE divided by the amount of p53 recruited at these sites. The graphs represent two to four independent
experiments given with standard error bars. D) Cells were subjected to chromatin fractionation. 50 µg of
chromatin extract was subjected to SDS-PAGE and Western blot analysis. * represents a p value < 0.05, **
represents p value < 0.01, *** represents a p value < 0.001,**** represents p value < 0.0001. Statistical analysis
was done with student’s t test (unequal variance).
48
3.2.2) Stable knockdown of MDM2 in G/G SNP309 cancer cell lines moderately increases
p53 transcriptional activity in a gene-specific manner without affecting p53 degradation.
In order to examine the role of MDM2 overexpression in G/G SNP309 cells in
compromised p53 transactivation activity, we engineered MDM2 knockdown cells. Using
shRNA targeting exon 12 of mdm2, we created stable MDM2 knockdown MANCA and A875
cell lines by retroviral-mediated gene transfer (Figure 13A). Quantitative Image J analyses
showed an approximately 80-90% decrease in MDM2 protein levels (Figure 13B). The cells with
MDM2 knockdown remained viable and we were able to use them for all the following
experiments. Using MANCA and A875 cells with MDM2 knockdown, we examined p53
transcriptional activity by assessing changes of five common p53 target genes (Figure 13C).
Stable knockdown of MDM2 in MANCA cells increased transcription of puma and to a lesser
extent pig 3 (Figure 13C). In A875 cells, stable knockdown of MDM2 increased transcription of
fas and pig 3 to approximately equal levels (Figure 13C). Induction of DNA damage treatment
with six hours of etoposide yielded no additive effect on increased p53 target genes transcription
for these cells (data not shown). However, it is of note that the p53 target genes most strongly
affected by MDM2 knockdown alone in both cell lines (puma, fas and pig-3) are related to
cellular apoptotic functions. These data suggest that in different cell types MDM2 moderately
regulates transcription of p53 target genes gene-specific manner.
G/G SNP309 MANCA and A875 cancer cell lines have stabilized p53 protein despite the
high MDM2 protein levels (Arva et al. 2005). Therefore, we asked what effect MDM2
knockdown in these cell lines would have on p53 protein levels. The knockdown of MDM2 in
MANCA cells caused a small but significant increase in p53 protein levels. In A875 cells, there
was variability seen in increased p53 protein levels (Figure 13A and B). In order to directly
49
address whether this was through the well-characterized ubiquitin-proteasome pathway, we
treated MANCA cells with the proteasome inhibitor MG132 for six hours (Figure 13D).
Proteasome inhibition by MG132 treatment caused a statistically significant increase in total
ubiquitinated protein (Figure 13E). Interestingly, p53 protein levels were not significantly
changed with addition of MG132. Additionally, MANCA cells with MDM2 knockdown and
MG132 treatment did not show any change in p53 protein levels as compared to MDM2
knockdown alone (Figure 13D and E). There was also a trend for increased MDM2 protein levels
with MG132 treatment suggestive of some MDM2 auto-ubiquitination function (Figure 13E).
This indicates that MDM2 is not functioning as an E3-ubiquitin ligase for p53 in G/G SNP309
cancer cells, but may serve as an E3-ligase for other proteins besides p53 including itself. This
data suggests that cancers with G/G SNP309 do not have MDM2 that functions as a normal E3ligase for p53 protein targeting it for degradation.
50
Figure 13- Stable knockdown of MDM2 in MANCA and A875 cells moderately increases
p53 transcriptional activity in a gene-specific manner without affecting p53 degradation.
MANCA and A875 cells were infected with retrovirus containing empty vector or vector with mdm2 shRNA and
subjected to puromycin selection. Cells were grown under constant selection pressure with puromycin. A) Whole
cell extracts of were made and 50 µg of protein was subjected to SDS-PAGE and western blot analysis. Cells were
probed with antibodies against MDM2, p53 and Actin proteins and a representative blot is shown above. B) Image J
analysis of western blots shown for MDM2 and p53 protein levels normalized to Actin. Results represent an
average of three independent experiments with standard error bars. C) cDNA was prepared from the cells and
quantitative RT-PCR was performed on the five p53 target genes p21, puma, fas, gadd 45 and pig 3and normalized
to gapdh. All results represent an average of three independent experiments with standard error bars. D) MANCA
cells were treated with 10µM MG132 for six hours. Whole cell extracts were made and 50 µg of protein was
subjected to SDS-PAGE and western blot analysis with a representative blot shown. E) Imaje J analysis performed
for western blots of samples treated in D. Graphs represent an average of three independent experiments with
standard error bars. * represents a p value < 0.05, ** represents p value < 0.01, *** represents a p value <
0.001,**** represents p value < 0.0001. Statistical analysis was done using student’s t test.
51
3.2.3) Regulation of p53 target genes in G/G SNP309 cancer cells occurs at post-initiation
steps.
To discern the mechanisms leading to compromised p53 transcriptional activity in the
G/G SNP309 cancer cell lines, we tested the hypothesis that p53 transcriptional activity was
compromised at transcription initiation. We analyzed the recruitment of total and initiated
(phospho-Serine-5 CTD) forms of RNA pol II at p21 and puma transcription start sites (Figure
14). In ML-1 cells, which have functional p53 transcriptional activity, addition of etoposide
increased total and initiated forms of RNA pol II at transcription start sites for both genes (Figure
14A and B). Interestingly, in MANCA cells etoposide treatment increased total and initiated
forms of RNA pol II comparable to that of ML-1 cells at transcription start sites (Figure 14A and
B). Additionally, A875 cells had approximately equal basal and activated total RNA pol II
recruitment to that seen in ML-1 cells after etoposide treatment (Figure 14A). This was also seen
for the initiated forms of RNA pol II after etoposide (Figure 14B). The results observed in A875
cells suggest that the studied p53 target genes are poised for transcription irrespective of DNA
damage treatment. Altogether, these results suggest that G/G SNP 309 cells exhibit functional
transcriptional initiation at p53 target genes. Therefore, the inhibition of these genes may occur
at post-initiation steps.
52
Figure 14-DNA damage induced RNA pol II recruitment at p53 target genes in G/G
SNP309 cancer cells indicates functional transcription initiation.
ML-1, MANCA and A875 cells were treated with DMSO or etoposide for 6 hours. A and B) Total RNA
pol II and phosphorylated Serine 5 C-terminal domain (S5P) RNA polymerase II chromatin
immunoprecipitations were carried out and analyzed using qPCR primers to p21 and puma transcription
start sites for both genes. Results for total RNA pol II represent four to six independent experiments. For
S5P RNA pol II chromatin immunoprecipitations represent three independent experiments given with
standard error bars for ML-1 and MANCA cell and four independent experiments for A875 cells. All
chromatin immunoprecipitation samples normalized to IgG and input values. Total and S5P RNA pol II
after ETOP for all three cell lines were compared for statistical analysis. * represents a p value < 0.05, **
represents p value < 0.01, *** represents a p value < 0.001,**** represents p value < 0.0001. ns signifies
not significant. Statistical analysis was done using student’s t- test (unequal variance).
3.2.4) Reduced H3K36 trimethylation near transcription start sites suggests G/G SNP309
cancer cells have compromised transcriptional elongation at p53 target genes.
Since the p53 target genes tested showed functional transcription initiation, we
hypothesized that p53 target genes in G/G SNP 309 cancer cells were inhibited during
transcription elongation. To address this, we first asked whether p21 and puma genes manifested
any defects in CDK9 recruitment. CDK9 functions as the active subunit of P-TEFb, the enzyme
53
responsible for phosphorylating Serine 2 CTD of RNA pol II and DSIF for productive elongation
(see review (Peterlin 2006)). We noticed that in ML-1, MANCA and A875 cells there were no
defects in CDK9 recruitment at transcription start sites for both genes (Figure 15A). Second, we
examined the elongating form of RNA pol II, phospho-Serine 2 CTD RNA pol II. Since the
phosphorylation of Serine 2 on the RNA pol II CTD increases toward the 3’ end of genes
(Komarnitsky et al. 2000), we looked at regions of p21 (+7011) and puma (+6014) genes
downstream of the transcription start sites near exon 3. As expected, in ML-1 cells there was a
very significant increase in phospho-Serine 2 RNA pol II after etoposide treatment (Figure 15B).
In MANCA and A875 cells, phospho-Serine 2 RNA pol II was also recruited with trends of
increased elongating pol II after etoposide treatment. It was statistically significant for the p21
gene in MANCA cells (Figure 13B). This indicated there was functional transcript being made
for p21 and puma genes. However, we still needed to account for the differences in transcript
levels between T/T and G/G SNP309 cells. In order to address this, we compared histone H3
Lysine 36 trimethylation (H3K36me3) for both genes. Histone H3K36 trimethylation is a histone
post-translational modification mark associated with active transcriptional elongation (Morris et
al. 2005). We expected that following DNA damage by etoposide in ML-1 cells we would detect
an increase in H3K36 trimethylation. We observed that at transcription start sites for p21 and
puma genes there was an increase in H3K36 trimethylation in ML-1 cells after DNA damage
treatment (Figure 15C). In MANCA and A875 cells, there was less H3K36 trimethylation at
transcription start sites for p21 and puma genes after DNA damage when compared to ML-1
cells (Figure 15C). We observed a large difference in the means when comparing H3K36me3
between ML-1 and MANCA (338 with 95% CI [39-638]) and between ML-1 and A875 (342
54
with 95% CI [43-642]) after DNA damage. Together these data indicate that MANCA and A875
cells have less active transcriptional elongation at p53 target genes.
Figure 15- Reduced H3K36 trimethylation near transcription start sites in G/G SNP309
cells suggests compromised transcriptional elongation for p53 target genes
ML-1, MANCA and A875 cells treated with DMSO or 8 µM etoposide for 6 hours. A) CDK9 chromatin
immunoprecipitations were carried out and analyzed by qPCR at p21 and puma transcription start sites. Results
represent four independent experiments with standard error bars. B) Phospho-Serine 2 RNA pol II chromatin
immunoprecipitations were carried out and analyzed using qPCR primers to p21 +7011 and puma +6014 regions
of the genes. C) H3K36me3 chromatin immunoprecipitations were carried out and analyzed by qPCR primers for
p21 and puma gene transcription start sites. Results represent at least four independent experiments given with
standard error bars. All chromatin immunoprecipitation samples are normalized to input and IgG values. *
represents a p value < 0.05, ** represents p value < 0.01, *** represents a p value < 0.001,**** represents p
value < 0.0001. Statistical analysis was done using student’s t test.
55
3.2.5) Stable MDM2 knockdown in MANCA cells alters p53 recruitment and H3K36
trimethylation in a gene- and site-specific manner.
MDM2 knockdown in MANCA and A875 cells moderately increased transcription of
p53 target genes and MANCA cells have slightly increased p53 protein levels (Figure 13).
Therefore, we asked if knockdown of MDM2 increased p53 levels on chromatin and altered p53
recruitment to p53REs. We also tested if DNA damage with MDM2 knockdown had an additive
effect to change p53 recruitment and levels on chromatin. Chromatin was isolated using
biochemical fractionation and Western Blot analysis was carried out for MANCA cells with
MDM2 knockdown and compared to vector control. Interestingly, p53 protein levels appeared
to be approximately equal on chromatin irrespective of etoposide treatment or MDM2
knockdown (Figure 16A). When analyzed for p53 recruitment on chromatin, MANCA cells with
MDM2 knockdown had a small but significant (p=0.03) increase (approximately double) in p53
recruitment to the p21 p53 RE. There was also a trend (p=0.06) of this increase in p53
recruitment with etoposide treatment (Figure 16B). For the puma gene, there was a trend
(p=0.085) of increased p53 recruitment in MANCA cells after MDM2 knockdown although not
as pronounced an effect as that seen for the p21 gene. Also, MDM2 knockdown did not impact
DNA-damage induced p53 recruitment to the puma gene (Figure 16B). Interestingly, MDM2
recruitment to p53 response elements was not changed with MDM2 knockdown although overall
levels of MDM2 appear to be decreased on the chromatin (Figure 16A and C). For both p21 and
puma genes, MDM2 knockdown did not change MDM2 recruitment to chromatin. This is likely
due to the concomitant increased p53 recruitment seen in MANCA cells with MDM2
knockdown. This phenomenon can be seen in ML-1 cells, which have increased MDM2
56
recruitment to chromatin when p53 recruitment is increased by DNA damage treatment (Figure
13).
Figure 16- Stable MDM2 knockdown in MANCA cells increases p53 recruitment to the p21
p53 response element.
MANCA vector and mdm2 shRNA cells were treated with DMSO or 8µM etoposide for 6 hours. A) Cells were
subjected to chromatin fractionation. 50 µg of chromatin extract was subjected to SDS-PAGE and Western Blot
analysis and probed with MDM2, p53 and Fibrillarin antibodies. B and C) Chromatin immunoprecipitations
were performed for p53 and MDM2 proteins and analyzed by quantitative PCR using primers for the p21 gene
5’ p53 responsive element and puma gene p53 responsive elements. Results represent four independent
experiments. All chromatin immunoprecipitation samples normalized to IgG and input values. * represents a p
value < 0.05, ** represents p value < 0.01, *** represents a p value < 0.001,**** represents p value < 0.0001.
Statistical analysis was done with student’s t test (unequal variance).
57
To investigate the moderate changes in transcription in MANCA cells, we also tested if
MDM2 had any effect on H3K36me3 at p53 target genes. We examined whether MDM2
knockdown in MANCA cells changed H3K36me3 at p21 and puma genes. MDM2 knockdown
had no significant impact on H3K36me3 in MANCA cells at p21 and puma transcription start
sites. This was not changed when cells were treated with etoposide (Figure 17A). We also
examined p21 and puma polyadenylation sites for changes in H3K36me3. As observed at
transcription start sites, there were no significant changes in p21 or puma polyadenylation sites
with MDM2 knockdown alone. Interestingly, MDM2 knockdown in MANCA cells displayed a
significant, DNA-damage induced increase in H3K36me3 at the puma polyadenylation site as
compared to vector control (Figure 17B). Our data show that MDM2 knockdown alone was not
able to recover H3K36 trimethylation near transcription start sites of p53 target genes. This
suggests that the moderate increase in transcription of select p53 target genes resulting from
MDM2 knockdown in MANCA and A875 cells does not appear to be through a pathway that
results in increased H3K36 trimethylation.
58
Figure 17- MDM2 knockdown in MANCA cells increases H3K36 trimethylation after DNA
damage at the puma polyadenylation site.
MANCA vector and mdm2 shRNA cells were treated with DMSO or 8µM etoposide for six hours. H3K36me3 chromatin
immunoprecipitations were carried out and analyzed by qPCR primers for p21 and puma gene transcription start sites (A)
and polyadenylation sites (B). Results represent five independent experiments given with standard error bars. All
chromatin immunoprecipitation samples are normalized to input and IgG values. * represents a p value < 0.05, **
represents p value < 0.01, *** represents a p value < 0.001,**** represents p value < 0.0001. Statistical analysis was
done using student’s t test (unequal variance).
3.2.6) Histone H2B post-translational modifications and cytosolic levels are altered by
MDM2 knockdown in G/G SNP309 MANCA and A875 cells.
MDM2 can ubiquitinate histone H2B and inhibit transcription via H2B ubiquitination of
the surrounding chromatin near p53 REs (Minsky and Oren 2004). We observed that MDM2
knockdown alone is not sufficient to change histone H3K36 trimethylation in MANCA cells at
p21 and puma genes (Figure 17). Therefore, we tested if MDM2 knockdown in MANCA and
A875 cells altered H2B post-translational modifications. Using biochemical fractionation and
western blot analysis, we looked for changes in total histone H2B in the chromatin-enriched
59
fractions of MANCA and A875 cells (Figure 18A). We observed a band above the normally
described ~17 kDa band for histone H2B, which likely represents a post-translationally modified
form of H2B. Given the approximate size of this band, ~25 kDa, it may represent ubiquitinated
H2B (Figure 18A). In the chromatin fraction of both MANCA and A875 cell lines, the H2B band
at ~ 25kDa decreased with MDM2 knockdown. With etoposide treatment, the ~25kDa was also
decreased irrespective of MDM2 knockdown in MANCA cells in the chromatin-enriched
fraction (Figure 18A). These data are indicative of MDM2 regulation in H2B post-translational
modifications. Cytosolic fractions of MANCA and A875 cells were run alongside chromatin
fractions. Interestingly, in both cell lines MDM2 knockdown alone caused significant decreases
in cytosolic H2B levels (Figure 18B). In MANCA cells, there was an approximately 60%
decrease and in A875 cells a 40% decrease in cytosolic H2B levels. Treatment with etoposide in
both cell lines did not change H2B cytosolic levels. Overall, these data imply MDM2 is involved
in some aspect of H2B regulation.
In order to address if ubiquitinated H2B could be regulated by MDM2, we asked if H2B
K120-Ub, the mammalian form known to be influenced during transcription, could be altered by
MDM2 knockdown. We used MANCA cells with MDM2 knockdown and looked for changes in
H2B K120-Ub in chromatin-enriched fractions. Interestingly, we did not observe any changes in
the H2B K120-Ub protein levels (Figure 18C). The levels of H2B-Ub were also not changed in
MANCA cells with etoposide treatment. Cytosolic fractions of these samples were also run
alongside for comparison and we observed no H2B K120-Ub in the cytosolic fractions (Figure
18C). Only when the MDM2 knockdown cells were treated with etoposide did we observe an
increase in the levels of H2B K120-Ub in the cytosolic fraction. The significance of this is not
known at this time.
60
Figure 18 – Histone H2B is altered by MDM2 knockdown in MANCA and A875 cells.
MANCA and A875 vector and mdm2 shRNA cells were treated with DMSO or 8 µM etoposide for six hours. Cells
were subjected to chromatin fractionation. A) 25µg of chromatin protein and 50µg of cytosolic protein were
subjected to SDS-PAGE and Western Blot analysis and probed for H2Band Actin and Fibrillarin proteins as loading
controls for chromatin and cytosol. A representative image is shown. B) Image J analysis of cytosolic H2B protein
levels. Results represent two independent experiments. C) Chromatin and cytosolic proteins were subjected to SDSPAGE and western blot analysis and probed with H2B K120-Ub and Fibrillarin. A representative image is shown. *
represents a p value < 0.05, ** represents p value < 0.01, *** represents a p value < 0.001,**** represents p value <
0.0001. Statistical analysis was done using student’s t test (unequal variance).
61
3.2.7) MANCA cells with MDM2 knockdown have changes in RNA pol II posttranslational modifications
Here, we present data that in MANCA and A875 cells there is functional transcription
initiation, but compromised transcriptional elongation because chromatin modifications suggest
less active elongation near p53 target gene transcription start sites (Figures 14 and 15). This
suggests that the RNA pol II is arrested or stalled at points in transcription elongation and likely
accounts for the differences in p53 target gene transcript levels between T/T and G/G SNP309
cells. Published reports describe stalled/arrested RNA pol II complexes can be released through
ubiquitination and proteasomal degradation to allow continued transcription for the next
functional RNA pol II elongation complexes (Svejstrup 2003). We asked if MDM2 was involved
to restore some functional transcription through this pathway.
First, we addressed if there were any differences in RNA pol II ubiquitination in
MANCA cells in the presence or absence of MDM2 knockdown. The cells were treated with the
proteasome inhibitor MG132 for six hours to inhibit protein degradation. Total RNA pol II was
immunoprecipitated from extracts and subsequently checked for differences in ubiquitinated
protein (Figure 19A). We observed that MG132 treated MANCA cells with MDM2 knockdown
had higher levels of ubiquitinated RNA pol II as compared to vector control. Quantitative Image
J analysis showed a difference in the means of 8.89 with 95% CI [5.29-12.49] between MDM2
knockdown and vector control MG132 treated cells after two independent experiments (Figure
19B). Secondly, we observed only slightly lower levels in phospho-Serine 2 CTD RNA pol II
with MDM2 knockdown (Figure 19A). Total RNA pol II was immunoprecipitated at
approximately equal levels from the whole cell extracts (Figure 19A). Our data suggests that
MANCA cells with MDM2 knockdown have higher ubiquitinated RNA pol II. This indicates
62
that MDM2 may be inhibiting the rescue of stalled/arrested RNA pol II complexes during
transcription.
Figure 19- MANCA cells with MDM2 knockdown appear to have increased RNA pol II
ubiquitin modifications.
MANCA vector or mdm2 shRNA cells were treated with MG132 for six hours. A) Whole cell extracts were performed and total
RNA pol II was immunoprecipitated from 1mg of protein compared to input samples and run for SDS-PAGE and Western Blot
analysis. Samples were probed for RNA pol II, phospho-Serine 2 pol II and total ubiquitin protein. Representative images are
shown. B) Image J analysis of the ubiquitin from the immunoprecipitated RNA pol II. Graph represents two independent
experiments normalized to RNA pol II from the immunoprecipitation.
63
3.3 Discussion
Among the cancer cells with MDM2 overexpression, those with G/G SNP309 are known
to be resistant to DNA damage in part to the cells attenuated p53 stress response (Bond et al.
2004). The compromised p53 transcriptional activity in G/G SNP309 cancer cells contributes to
the attenuated stress response (Arva et al. 2005). The experiments described in this chapter
explored how p53-mediated transcription in G/G SNP309 cancer cells is compromised and the
involvement of MDM2 in p53 transcriptional regulation in these chemoresistant cancers. We
recapitulated that G/G SNP309 MANCA and A875 cells had compromised p53-mediated
transcription after DNA damage and added the apoptotic target puma and pig-3 to the list of p53
target genes with compromised transcription (Figure 11). The compromised apoptotic signaling
seen in MANCA and A875 cells after 24 hours of DNA damage by FACS analysis (Arva et al.
2005) correlates to the compromised transcriptional activity of apoptotic p53 targets after six
hours of DNA damage treatment. In addition to the presence of MDM2-p53 chromatin
complexes at p53REs, we analyzed the MDM2 to p53 ratio on chromatin and observed that
MANCA cells had the highest ratio before etoposide treatment (Figure 12C). We also showed
that overall MDM2 protein levels on the chromatin in MANCA and A875 cells were higher than
in ML-1 cells (Figure 12D).
MDM2 reportedly inhibits p53-mediated transcription via dual mechanisms with the first
through MDM2 binding to the p53 transactivation domain (Momand et al. 1992; Thut et al.
1997). Targeted chemotherapeutics that inhibit MDM2 binding to p53 transactivation domain
have been developed and are in clinical trials as methods to reactivate wild-type p53
transcriptional activity (Vu and Vassilev 2011). One of the more common small-molecule
inhibitors, Nutlin-3, is reported to have some efficacy at treating MDM2 overexpressing cells
64
with mdm2 genomic amplification when they have wild-type p53 function (Tovar et al. 2006). In
A875 cells, Nutlin-3 treatment activates p53-dependent transcription significantly better than
etoposide treatment for mdm2 and pig-3, less so for p21/waf1, but not for gadd45 or puma genes
(Arva et al. 2008). We provide evidence that, similar to MDM2 inhibition by Nutlin-3 treatment,
MDM2 knockdown has a selective effect on p53-dependent transcription (Figure 13C).
Knockdown of MDM2 in G/G SNP309 cells moderately increased select p53 target genes in a
cell-type specific manner with no additive effect after DNA damage treatment (Figure 13C and
data not shown). In p53-null H1299 lung carcinoma cells with inducible wild-type p53, excess
full-length MDM2 has a selective inhibition on p53 target genes pig-3 and 14-3-3σ (Ohkubo et
al. 2006). The second reported mechanism for MDM2 inhibition of p53 transcription is through
binding TFIIE and thus inhibiting pre-initiation complex formation (Thut et al. 1997). However,
our data suggest that G/G SNP309 MDM2 overexpressing cells have functional transcription
initiation (Figure 14). Both MANCA and A875 cells, in comparison to ML-1 cells, had similar
total and initiated forms of RNA pol II recruited to p53 target gene start sites. In fact, for A875
cells, there was significantly higher initiated RNA pol II recruited than in ML-1 cells for p21 and
puma genes. A875 cells treated with Nutlin-3 also had similar RNA pol II recruitment to cells
treated with DNA damage (data not shown). The work implicating MDM2 repressing p53dependent transcription by binding TFIIE and p53 was carried out in an in vitro system without
chromatin (Thut et al. 1997). In this system, it would be difficult to account for the chromatin
environment of p53 target genes which obviously has a profound effect on its transcription.
When examining all this information it indicates a complex relationship between MDM2 and
p53-dependent transcriptional regulation.
65
In cancer cells with MDM2 overexpression, there is a concomitant increase in mdm2
splice variants and protein isoforms and in G/G SNP309 cancer cell lines several mdm2 splice
variants are found (Bartel et al. 2002; Arva et al. 2008; Okoro et al. 2012). In fact, MANCA cells
are characterized with higher levels of the mdm2-c splice variant compared to full-length mdm2
transcript (Okoro et al. 2013). When excess exogenous mdm2-c is transfected into H1299 lung
carcinoma cells, there is no significant effect on co-transfected wild-type p53 transcriptional
activity (Okoro et al. 2013). The knockdown of MDM2 protein in G/G SNP309 cancer cells, due
to the shRNA targeting exon 12 of mdm2, likely alters all forms of MDM2 protein isoforms
present. The moderate effects on p53 transcriptional activity are consistent with higher MDM2
protein isoforms than full-length MDM2 protein in our G/G SNP309 cancer cells.
Promoter pausing and elongation are increasingly seen as the main regulatory events
during transcription (see review (Smith and Shilatifard 2013)). Our data show that MANCA and
A875 cells have CDK9 and phospho-Serine 2 CTD RNA pol II recruited during transcription of
p53 target genes (Figure 15A and B). However, the data also suggest that p53 target genes in
G/G SNP309 cancer cells, due to lower H3K36 trimethylation, have less active transcriptional
elongation (Figure 15C). Nearly 75% of all genes in embryonic stem cells are poised for
transcription initiation and, interestingly, only a fraction of the studied genes are able to
efficiently elongate (Guenther et al. 2007). Environmental responsive genes are poised for
transcriptional activation with paused RNA pol II near transcription start sites (Hendrix et al.
2008; Sawarkar et al. 2012). Combined the data suggest that, similar to stem cells, G/G SNP309
cancer cells have p53 target gene regulation at post-initiation steps. The exact mechanism to
account for compromised transcriptional elongation is unknown and warrants further study.
66
Due to compromised elongation we were interested in how MDM2 may account for the
moderate changes in transcription with MDM2 knockdown alone. We asked if there was an
associated increase in H3K36 trimethylation in MANCA cells with MDM2 knockdown at p53
target genes. We observed that MDM2 knockdown did not significantly change H3K36
trimethylation at p21 and puma transcription start sites (Figure 17B). These data indicate that in
G/G SNP309 cancer cells MDM2 knockdown alone is likely not sufficient to reactivate p53dependent transcriptional elongation. Interestingly, we noticed that MDM2 knockdown increased
ubiquitinated RNA pol II after MG132 treatment (Figure 19). Since RNA pol II ubiquitination is
reported to clear stalled/arrested elongation complexes (Somesh et al. 2005; Somesh et al. 2007),
it is likely there is some MDM2 involvement in compromised elongation through inhibited
ubiquitination of RNA pol II. MDM2 knockdown in MANCA cells also altered DNA damaged
induced H3K36me3 at the puma polyA site. This may not necessarily be related to transcription,
but have more to do with MDM2 involvement in DNA damage response pathways. H3K36
trimethylation, in addition to active transcriptional elongation, is also associated with DNA
damage repair by mismatch and homologous recombination repair leading to genomic stability
(Li et al. 2013; Pfister et al. 2014). MDM2 interacts with NBS-1 of the MRN complex to delay
DNA repair (Alt et al. 2005), therefore MDM2 knockdown in MANCA cells may facilitate
quicker DNA repair after etoposide treatment. Additionally, extrachromosomal histone H2B
serves as a sensor for cellular DNA damage (Kobiyama et al. 2013). We observed that after
MDM2 knockdown, MANCA and A875 cells had a significant decrease in cytosolic H2B
protein levels (Figure 18B). This is indicative of MDM2 involvement G/G SNP 309 cancers cells
in the DNA damage response pathway likely changing DNA damage sensing and/or signaling.
67
We also tested the E3 ligase functions for MDM2 in G/G SNP309 cancer cells.
Interestingly, MG132 treatment in MANCA cells did not increase p53 protein levels or have an
additive effect with MDM2 knockdown (Figure 13D and E). These data demonstrate that p53 in
G/G SNP309 cells is not affected by proteasome-dependent degradation. This implicates MDM2
is not functioning as an E3-Ubiquitin ligase for p53 in these cells. In H1299 cells, exogenously
transfected mdm2-C has no effect on co-transfected wild-type p53 protein levels (Okoro et al.
2013). In addition to ligase function, MDM2 can also regulate p53 mRNA (Candeias et al. 2008;
Naski et al. 2009). The RING finger domain of MDM2 is reported to enhance p53 mRNA
translation with the phosphorylation of Serine 395 on MDM2 by ATM seemingly necessary for
this function (Candeias et al. 2008; Gajjar et al. 2012). Interestingly, the ligase function of
MDM2 toward the ribosomal protein RPL26 can also attenuate p53 mRNA translation (OfirRosenfeld et al. 2008). The small but significant increase in p53 protein levels in MANCA cells
with MDM2 knockdown (Figure 13B) may be due to slight increases in p53 mRNA levels. The
most commonly found mdm2 splice variants are missing exons that code for the p53 binding
domain, but retain exon 12 that encodes the RING finger domain (Okoro et al. 2012). The RING
finger domain contains P loop motifs associated with nucleotide binding proteins and activity
implying DNA and RNA functions (Poyurovsky et al. 2003; Priest et al. 2010). In G/G SNP309
cancer cells, MDM2 isoform proteins likely outnumber MDM2-FL protein and therefore may
not contribute much to the normal p53 regulatory functions.
68
Chapter 4- MDMX Regulation in G/G
SNP309 MDM2 Overexpressing Cancer Cells
69
4.1-Introduction
MDM2 and MDMX are inextricably linked in p53 regulation and regulate each other.
MDM2 protein is a well-known E3-ubiquitin ligase and promotes the degradation of MDMX
through this pathway (Pan and Chen 2003). We were interested to determine if the reason we did
not see robust activation of p53 after knockdown of MDM2 was due to an increase in MDMX.
The MDMX protein is involved in mdm2 gene regulation promoting p53-mediated
transactivation of mdm2 under cellular stress conditions (Biderman et al. 2012). Cellular stress
conditions, such as DNA damage, decrease MDMX protein levels through pathways associated
with MDM2-mediated degradation of MDMX protein (Kawai et al. 2003). Phosphorylation of
several residues on MDMX by DNA damage induced kinases, Chk1 and Chk2, can induce
MDM2-mediated degradation of MDMX and subsequently p53 activation (Chen et al. 2005).
We wanted to address how MDMX is regulated under conditions with MDM2
overexpression. This was a critical question because the cells did not die when we decreased
MDM2 protein levels and because MDMX is a target of MDM2. The G/G SNP309 MDM2
overexpressing cell lines used in this study were a vehicle to address this question. Both cell
lines used in this study are characterized to be among the cancer types (Burkitts’ lymphoma and
melanoma) by several groups to have MDMX overexpression (Gembarska et al. 2012; Leventaki
et al. 2012). We characterized the basal MDMX expression levels in the MANCA and A875
cells and proceeded to address if MDMX contributed toward compromised p53 activity in these
G/G SNP309 cancer cell lines by assessing the influence of MDM2 knockdown on MDMX
levels.
70
4.2- Results
4.2.1) MANCA cells with MDM2 knockdown have increased MDMX protein stability
Both MANCA and A875 cell lines overexpress MDM2 protein. We asked what the basal
levels of MDMX protein were in both cell lines. MANCA cells had higher basal levels of
MDMX protein compared to A875 cells (data not shown). Next, we asked if there would be
changes in MDMX levels with decreased MDM2. When addressed in the context of MDM2
knockdown, there were no changes to MDMX protein levels in A875 cells (data not shown).
Interestingly, in MANCA cells the knockdown of MDM2 caused an approximate 11 fold
increase in MDMX protein levels (p=0.03) (Figure 20A and B). We wanted to see if the dramatic
increase in MDMX protein levels correlated to an increase of mdmX transcript levels in MANCA
cells. With MDM2 knockdown, we observed no statistically significant increase in mdmX
transcript levels (Figure 20C). This implies that MDM2 in MANCA cells is involved in
regulating MDMX protein levels, but not mRNA.
Due to the importance of MDMX and MDM2 in the p53 stress response, we also treated
MANCA cells in the presence and absence of MDM2 knockdown with DNA damage using
etoposide. MDMX transcript and protein is reported to decrease with DNA damage agents
(Kawai et al. 2003; Markey and Berberich 2008). DNA damage significantly decreased MDMX
protein levels by approximately 80% (p < 0.0001). With MDM2 knockdown, the high levels of
MDMX protein decreased slightly after DNA damage, although it was not statistically
significant (Figure 20A and B). Interestingly, in MANCA cells treated with etoposide we did not
observe a decrease in mdmX transcript levels (Figure 20C). The data indicates DNA damage
regulation of MDMX in MANCA cells is through protein degradation.
71
Figure 20- MANCA cells have increased MDMX protein stability with MDM2 knockdown
A) MANCA vector and mdm2 shRNA cells were treated with 8µM etoposide for six hours. Whole cell extracts were performed and
subjected to SDS-PAGE and Western Blot analysis. The samples were probed for MDM2, MDM2, p53 and Actin. A representative
image is shown. B) Quantitative analysis by Image J was performed for analyzing MDMX protein levels normalized to Actin. Graph
represents four independent experiments given with standard error bars. C) Transcript levels of mdmX were analyzed by quantitative
RT-PCR and normalized to gapdh. Student’s t-test done for statistical analysis. * represents a p value < 0.05, ** represents p
value < 0.01, *** represents a p value < 0.001,**** represents p value < 0.0001
4.2.2) MDM2 knockdown regulates MDMX protein levels in different subcellular
compartments.
Since MDMX protein levels were dramatically increased in MANCA cells by MDM2
knockdown, we wanted to locate the increased MDMX levels. We addressed this question by
performing a subcellular fractionation on the MANCA cells with constitutive mdm2 shRNA
compared to vector control in the presence and absence of etoposide-induced DNA damage.
Using Western Blot analysis, chromatin and cytosolic protein fractions were compared for
differences in MDMX protein levels. With MDM2 knockdown, we observed a statistically
72
significant increase in MDMX protein levels in the cytosolic fraction (p < 0.0001). Additionally,
there was a trend (p=0.07) of decreased MDMX protein levels after etoposide treatment (Figure
21A and C). In the chromatin fraction, there was a trend (p=0.12) of increased MDMX after
MDM2 knockdown. However, with etoposide treatment there was a large variability of MDMX
protein on chromatin (Figure 21A and B). This data indicates MDM2 knockdown is associated
with increased MDMX protein in different subcellular compartments in MANCA cells.
Figure 21- MDM2 knockdown in MANCA cells alters MDMX protein levels in different
subcellular compartments.
MANCA vector and mdm2 shRNA cells were treated with 8µM etoposide for six hours. A) Cells were subjected to biochemical
subcellular fractionation. Chromatin and cytosolic fractions were run for SDS-PAGE and Western Blot analysis and probed for MDMX,
Fibrillarin and Actin. A representative image is shown. B) Image J analysis was done for the chromatin fractions of the samples
normalized to Fibrillarin. Results represent four independent experiments with standard error bars. C) Image J analysis was done for the
cytosolic fractions of the samples normalized to Actin. Results represent four independent experiments with standard error bars.
Student’s t-test done for statistical analysis. * represents a p value < 0.05, ** represents p value < 0.01, *** represents a p value
< 0.001,**** represents p value < 0.0001
73
4.2.3) MDM2 and MDMX protein regulation is linked in MANCA cells
The above result led us to further investigate in MANCA cells if MDMX might have a
role in p53 regulation. We were interested in the roles of MDMX and MDM2 proteins in relation
to each other and p53 regulation. We infected MANCA cells with constitutive and inducible
mdm2 and mdmX shRNA and compared this to vector controls. First, we addressed if we could
knockdown basal MDMX protein levels using constitutive mdmX shRNA and observed a
decrease in MDMX protein (Figure 22, lanes 1 and 3). As before, constitutive mdm2 shRNA
knockdown increased MDMX protein levels (Figure 22, lanes 1 and 2). We were also interested
in decreasing MDM2 and MDMX protein levels simultaneously. The approach was to use the
constitutive mdmX shRNA cell line and infect those cells with inducible mdm2 shRNA. In that
way, there should be a manner to control the levels of MDM2 protein in an already low baseline
background of MDMX. We tested the inducible mdm2 shRNA cell line compared to vector
control in the presence and absence of the low mdmX background. Several unexpected issues
were encountered in the MANCA cells during this process. The inducible mdm2 shRNA alone
decreased MDM2 protein levels although it appeared there was decrease before induction
(Figure 22, lanes 7-10). At doses above 2µg/mL, the drug doxycycline used to induce mdm2
shRNA proved to be quite cytotoxic to MANCA cells. Interestingly, in the background of low
basal MDMX levels, MDM2 protein levels were comparable to vector controls before and after
mdm2 shRNA induction (Figure 22, lanes 7, 8 to 11, 12). Therefore, the mdm2 shRNA did not
have an effect on MDM2 protein levels in cells with constitutive mdmX shRNA. Similar to
MDMX protein levels with MDM2 knockdown, the stability of MDM2 protein in MANCA cells
increased slightly with MDMX knockdown. Our data indicate that MDM2 and MDMX are
involved in the others protein regulation.
74
We also asked how the p53 stress response may differ in the MANCA cell lines made
using etoposide to induce DNA damage. As expected, MDMX protein levels decreased with
DNA damage (Figure 20 lanes 1,4 and 7,13). The p53 protein levels were not affected by
constitutive mdmX shRNA alone (Figure 22, lanes 1 and 3). The basal levels of p53 protein
appeared to increase in the MANCA cells with low basal MDMX levels and inducible mdm2
shRNA (Figure 22 lanes 7,8 to 11,12). The levels of p53 protein were also increased with DNA
damage treatment in all cell lines treated (Figure 22). The knockdown of either MDM2 or
MDMX did not change DNA damage induced p53 protein levels. However, because
simultaneous knockdown on MDM2 and MDMX proteins could not be achieved in MANCA
cells it is hard to infer any conclusions about p53 regulation or the stress response in these cells.
Figure 22- MDM2 and MDMX protein regulation are linked in MANCA cells
MANCA cells were infected with vector or constitutive mdm2 or mdmX shRNA. The MANCA cells were also infected with
inducible vector or mdm2 shRNA. Consitutive mdmX shRNA MANCA cells were also infected with inducible mdm2 shRNA.
Cells with inducible shRNA and vector control were treated with 2 µg/mL of doxycycline for 10 days. The above cell lines
were treated with 8 µM etoposide for six hours. Whole cell extracts were performed on the cells and subjected to SDS-PAGE
and
Blot analysis. Samples were probed for MDM2, MDMX, p53 and Actin proteins. Image J analysis was done and
4.3Western
Dscussion
shown below the blot and the samples were normalized to Actin.
75
4.3) Discussion
MDMX protein is a major negative regulator of p53, homologous to the MDM2 protein
(Shvarts et al. 1996). We wanted to explore if MDMX may play a role in p53 regulation in
cancer cells with MDM2 overexpression. First, we observed basal MDMX protein expression
was higher in MANCA cells than A875 cells (data not shown). In A875 cells, MDM2
knockdown did not affect the levels of MDMX protein (data not shown). However, in MANCA
cells MDMX protein levels were dramatically increased with MDM2 knockdown (Figure 20).
Interestingly, mdmX transcript levels did not correlate with the increase in MDMX protein levels
as mdmX transcript levels were not affected by MDM2 knockdown (Figure 20). MDM2
reportedly functions as an E3-Ubiquitin ligase toward MDMX protein (Pan and Chen 2003). It is
likely that MDM2 in MANCA cells is responsible for degrading MDMX protein.
After subcellular fractionation of MANCA cells, we observed MDMX protein in the
cytosolic fraction and consistent increases after MDM2 knockdown (Figure 21). MDMX protein
is characterized as a cytosolic protein with MDM2 necessary to traffic MDMX to the nucleus
(Migliorini et al. 2002). The data presented here is consistent with MDMX being a cytosolic
protein. However, MDMX protein is more associated with inhibition of p53 transcriptional
activity because the RING finger domain of MDMX is not capable E3 ligase activity (Shvarts et
al. 1996; Ghosh et al. 2003). MDMX protein can be found on chromatin at p53 response
elements (Tang et al. 2008). We observed variability in the protein levels in the chromatinenriched fraction especially with etoposide treatment (Figure 21). This is suggestive of MDMX
protein being in flux between being chromatin-bound and in the nuclear soluble fraction. This
also implies that other proteins besides MDM2 are likely involved in bringing MDMX protein
into the nucleus.
76
Due to the structural protein homology of MDM2 and MDMX proteins, we hypothesized
that in MANCA cells the increase in MDMX levels by MDM2 knockdown was substituting for
the lack of MDM2 protein to regulate p53 activity. Using shRNA, we attempted to create
MANCA cells with knockdown of both MDM2 and MDMX proteins (Figure 22). We observed
that knockdown of MDMX protein levels in MANCA cells caused a slight increase in MDM2
protein levels. As in Figure 20, we saw the levels of MDMX increase with knockdown of
MDM2. However, successful knockdown of both MDM2 and MDMX proteins simultaneously
was not achieved in MANCA cells. MDM2 and MDMX protein can bind via the RING finger
domains (Tanimura et al. 1999), therefore implying that MDMX and MDM2 may be involved in
each other’s protein regulation. Our data also suggests that it may be lethal to get rid of both
MDM protein family members at the same time. Both MDM2 and MDMX depleted may allow
for activation of p53 and cell death.
MDM2 and MDMX work together after DNA damage to regulate p53 activation (see
reviews (Chen 2012; Shadfan et al. 2012)). DNA–damage induced phosphorylation of MDMX
leads to MDM2-mediated degradation resulting in p53 activation (Kawai et al. 2003; Chen et al.
2005; Okamoto et al. 2005). Our results in MANCA cells were consistent to published results.
We observed, under etoposide-induced DNA damage conditions, a significant decrease in
MDMX protein levels (Figure 20). Also, suggestive of MDM2-mediated MDMX protein
degradation is the lack of change seen in mdmX transcript levels after DNA damage treatment
(Figure 20). We observed that knockdown of MDMX protein in MANCA cells did not change
p53 protein levels (Figure 20). We also observed no significant changes in DNA-damage
induced p53 protein levels with MDM2 or MDMX knockdown (Figures 20 and 22). This is
consistent with MDMX not affecting p53 protein levels and with the compromised p53
77
transcriptional activity still seen in MANCA cells after DNA damage. However, when we
checked if knockdown of MDMX with DNA damage could induce p53 transcriptional activity
we observed no significant changes in transcript levels of p21, puma or pig 3 (data not shown).
Although the p53 characterized in G/G SNP309 MANCA and A875 cells is genetically wildtype, its function in these cells is not. Knockdown of either of the major negative regulators of
p53 in MANCA cells was not able to restore a functional p53 stress response. Overall, the data
presented here suggests a complex relationship between MDM2 and MDMX protein in cancer
cells with MDM2 overexpression and wild-type p53.
78
Chapter 5- G/G SNP309 cancer cells are
sensitive to p53-independent cell death
79
5.1 Introduction
The most common chemotherapeutic agents utilize DNA damage pathways that can
activate wild-type p53 to promote cell death (see reviews (Levine 1997; Woods and Turchi
2013)). However, resistance to DNA damage in some cancer types can develop if there are p53
mutations or overexpression of MDM2 and/or MDMX to functionally inactivate the wild-type
p53 protein (Buttitta et al. 1997; Laframboise et al. 2000; Nayak et al. 2007; Jin et al. 2010;
Knappskog and Lonning 2012). Specific pharmacological agents can switch p53 from a mutant
to a wild-type conformation for restoring wild-type p53 function (Foster et al. 1999). Smallmolecule inhibitors of the MDM2-p53 interaction at the N-termini of both proteins are also in
development to reactivate wild-type p53 function in cancers that overexpress MDM2 (see review
(Vu and Vassilev 2011)). Additionally, there are inhibitors that target the RING fingers of both
MDM2 and MDMX proteins to inhibit p53 degradation (Herman et al. 2011). This suggests that
reactivation of wild-type p53 in cancer cells is a targetable pathway to induce cell death in
aggressive and/or chemoresistant cancers. However, in cases where wild-type p53 function
cannot be restored, alternative treatments need to be sought to induce cell death in these cancer
types. Here we explored treatment options for chemoresistant G/G SNP309 cancer cells.
80
5.2 Results
5.2.1) G/G SNP309 cancer cells are sensitive to p53-independent cell death induction
G/G SNP309 cancer cells are known to be resistant to various types of common
chemotherapeutic DNA damage agents in part due to compromised p53 transcriptional activity
(Arva et al. 2005). The knockdown of MDM2 by siRNA in G/G SNP309 MANCA and A875
cancer cells was reported to sensitize the cells to etoposide as shown by lower half maximal
inhibitory (IC50) concentrations after treatment (Nayak et al. 2007). Using the MDM2
knockdown MANCA cell line, we tested the sensitivity of the cells to 24 hours of etoposide
treatment at varying concentrations. First, we observed that MDM2 knockdown in MANCA cells
caused a slight trend of decreased cell proliferation over a 96 hour period (Figure 23A). Next, we
treated the cells with varying doses of etoposide and observed that only at 1µM concentration
was there a moderately smaller amount of cell growth with MDM2 knockdown as compared to
vector control (Figure 23B). Using an MTT assay to assess cell viability, we observed no
difference in sensitivity to different doses of etoposide with MDM2 knockdown (Figure 23C).
Contrary to mdm2 siRNA in G/G SNP309 MANCA and A875 cancer cells (Nayak et al. 2007),
our data show that MDM2 knockdown by constitutive shRNA did not sensitize G/G SNP309
MANCA cells to etoposide treatment. This may be due to the increase in MDMX protein levels
after MDM2 knockdown in MANCA cells (Figure 20). MDMX may contribute to the DNA
damage resistance in a redundant manner to MDM2 protein.
81
Figure 23 - Knockdown of MDM2 in MANCA cells does not change sensitivity to DNA
damage by etoposide.
A) MANCA vector and mdm2 shRNA cells were grown over a 96 hour period and counted using a
hemocytometer at 24, 48, 72 and 96 hour time points seeded at 1.0 x10 5 cells/mL. The p values at each time point
are as follows: 24 p = 0.093, 48 p = 0.17, 72 p = 0.196, 96 p = 0.067. Results represent an average of four
independent experiments given with standard error bars. B) Cells were seeded at 2.5x10 5cells/mL at treated with
varying concentrations of etoposide. After 24 hours cells were counted using a hemacytometer. Results represent
two independent experiments with standard error bars. C) Cells used in B were also subjected to an MTT assay
and assessed for changes in cell viability. Results represent two independent experiments with standard error
bars.
Since MDM2 knockdown by shRNA did not sensitize cells to etoposide, we tested if
other treatment options known to induce other cell death pathways would be more effective than
standard DNA damaging agents. Inhibitors of general transcription and RNA synthesis have
been suggested as efficacious treatment options for cancers (see review (Stellrecht and Chen
2011)). For example, actinomycin D at low doses is reported to activate the p53 pathway
82
(Choong et al. 2009). Using 5nM actinomycin D, we treated G/G SNP309 MANCA and A875
cells for 24 hours and also addressed if MDM2 knockdown would further sensitize the cells to
treatment. Microscopic examination revealed that actinomycin D treatment caused MANCA
cells to stop aggregating, while in A875 cells there was no visible change compared to controls
(Figure 24A). Using an MTT assay, we tested for cell viability. In MANCA cells, low dose
actinomycin D caused an approximate 50% decrease in cell viability, while in A875 cells it
caused no change in cell viability (Figure 24B). MDM2 knockdown had no effect on cell
sensitivity to actinomycin D treatment. In MANCA and A875 cells, we observed that
actinomycin D treatment increased p53 protein levels (Figure 24C, lanes 1, 2 and 7, 8).
Interestingly, with MDM2 knockdown actinomcyin D treated MANCA cells had p53 protein
levels decrease while in A875 cells p53 levels did not change (Figure 24C, lanes 2, 5 and 8, 11).
To address if there was any apoptotic cell death in both cell lines, we asked if there was PARP
cleavage after actinomycin D treatment. In both MANCA and A875 cell lines, there was no
PARP cleavage in the presence or absence of MDM2 knockdown after treatment (Figure 24C,
lanes 1,2 and 4,5; lanes 7,8 and 10,11). This indicates that methods used to reactivate the p53
pathway in G/G SNP309 cancers cells may not be the best option for treatment of these
chemoresistant cancers.
Another inhibitor of general transcription and RNA synthesis is the nucleoside analog 8amino-adenosine (Frey and Gandhi 2010; Stellrecht and Chen 2011). It is cytotoxic to cancer
cells in a p53-independent manner (Polotskaia et al. 2012). We used 15µM 8-amino-adenosine,
previously reported to be effective for killing metastatic breast cancer cells (Polotskaia et al.
2012). MANCA and A875 cells were treated with 8-amino-adenosine in the presence or absence
of MDM2 knockdown for 24 hours. Microscopic examination revealed that both MANCA and
83
A875 responded to treatment. However, A875 cells appeared more responsive to 8-aminoadenosine than MANCA cells (Figure 24A). When testing for cell viability using MTT assay, we
found that both cell lines had a significant reduction (~70%) in viability (Figure 24B). MDM2
knockdown in MANCA or A875 cell lines did not further sensitize the cells to treatment (Figure
24B). We also observed that 8-amino-adenosine treatment did not increase p53 protein levels in
either MANCA or A875 cells and therefore did not activate the p53 pathway (Figure 24C, lanes
1,3 and 7,9). In order to address if the decrease in cell viability was associated with apoptotic cell
death we looked for PARP cleavage in both cell lines. In MANCA cells, there was no PARP
cleavage with 8-amino-adenosine with or without MDM2 knockdown (Figure 24C lanes
1,3,4,6). When A875 cells were treated with 8-amino-adenosine there was a band below the main
PARP band indicating cleavage (Figure 24C lanes 7, 9). Interestingly, treated A875 cells with
MDM2 knockdown had the band that indicated PARP cleavage decreased (Figure 24C lanes 9,
12). Our data imply that targeting G/G SNP309 cancer cells with an inducer of p53-independent
cell death, like 8-amino-adenosine, may be a more effective treatment option that trying to
reactivate the wild-type p53 pathway.
84
Figure 24- G/G SNP309 cancer cells are sensitive to 8-amino-adenosine.
MANCA and A875 with constitutively expressed mdm2 shRNA or vector control were treated with 5nM Actinomycin
D (ActD) and 15 µM 8-amino-adenosine (8AA) for 24 hours. A) After treatment, pictures of cells under 10X objective
were taken. B) MTT assay was performed on the cells after treatment. Results represent three independent experiments
with standard error bars. C) Whole cell extracts performed and subjected to SDS-PAGE and Western Blot analysis.
Shown are representative images. Statistical analysis performed using student’s t-test. * represents a p value < 0.05,
*** represents p value < 0.001, **** represents p value < 0.0001
85
5.3 Discussion
Chemotherapuetic DNA damaging agents are in common use in the clinic to treat a
multitude of cancers. Many of these drugs respond via activation of the DNA damage pathway
signaling to p53 (see reviews (Nitiss 2002; Woods and Turchi 2013)). Reactivation of p53
signaling through DNA damage can signal transcriptional cell death targets in cancer cells (see
reviews (Vousden 2002; Woods and Turchi 2013)). When cancer cells develop a resistance to
these drugs, there is no response via the normal signaling pathways. Knockdown of MDM2 by
siRNA in G/G SNP309 MANCA and A875 cancer cells can decrease IC50 concentrations after
etoposide treatment and was therefore reported to sensitize cells to treatment (Nayak et al. 2007).
We were interested in whether MDM2 knockdown by shRNA showed a similar sensitivity to
overcome resistance to etoposide. Our results showed that in MANCA cells the knockdown of
MDM2 by shRNA did not sensitize the cells to etoposide treatment (Figure 23). However,
constitutive MDM2 knockdown increases MDMX protein levels (Figure 20). This may account
for the contrary results because MDMX protein may have redundant roles for MDM2 protein
and contribute to DNA damage resistance. This suggests that other methods of treating
chemoresistant G/G SNP309 cancer cells besides DNA damage agents need to be considered.
Inhibitors of general transcription and RNA synthesis are being used as a new therapeutic
targets for cancer because they display differential sensitivity between non-transformed and
transformed cells (see review (Stellrecht and Chen 2011)). The drug actinomycin D can bind
DNA and interfere with elongating RNA of actively transcribing genes (Sobell 1985). At low
doses actinomycin D can reactivate the p53 pathway (Choong et al. 2009). This reportedly
occurs through MDM2 binding to ribosomal proteins released from the nucleolus after ribosomal
stress thus preventing p53 degradation (Choong et al. 2009; van Leeuwen et al. 2011). We
86
observed that actinomycin D treatment in MANCA and A875 cells increased p53 protein levels
(Figure 24C); however, cell viability was not affected in A875 cells while decreasing viability
approximately 50% in MANCA cells (Figure 24B). When we treated MANCA and A875 cells
with the nucleoside analog 8-amino-adenosine, we observed an approximate 70% decrease in
cell viability and no change with MDM2 knockdown (Figure 22B). 8-Amino-adenosine inhibits
multiple mechanisms of transcription and RNA synthesis associated with a decrease in cellular
ATP levels (Frey and Gandhi 2010). The nucleoside analog 8-amino-adenosine is cytotoxic to
cancer cells in a p53-independent manner (Polotskaia et al. 2012). In metastatic breast cancer
cells, 8-amino-adenosine treatment activates differing types of cytotoxic reactions with markers
for both autophagy and apoptosis dependent upon the cell line (Polotskaia et al. 2012). We
observed a marker for apoptosis by PARP cleavage in A875 cells after treatment with 8-aminoadenosine, but in MANCA cells no evidence was presented for apoptotic cell death (Figure 24C).
This suggests 8-amino-adenosine targeted different cell death pathways in the different cell
types. Therefore, targeting chemoresistant G/G SNP309 cancer cells with p53-independent
transcriptional/RNA synthesis inhibitors is suggested as a better option for therapy compared to
other chemotherapeutics that reactivate the wild-type p53 pathway.
87
Chapter 6- Future Directions
88
6.1) Future Directions
In closing, the evidence collected by the experiments described in this thesis
indicates several interesting phenomenon. We describe in chapter 3 that G/G SNP309 cancer
cells have functional transcriptional initiation as evidenced by efficient recruitment of total and
initiated forms of RNA pol II at transcription start sites for p53 target genes (Figure 14). After
comparing H3K36 trimethylation (H3K36me3), there was evidence of compromised
transcriptional elongation. In comparison to MANCA and A875 cells, we showed that ML-1
cells had higher H3K36me3 after etoposide treatment at p21 and puma transcription start sites
(Figure 15). The reduced H3K36me3 in MANCA and A875 cells, as compared to ML-1 cells,
suggested less active elongation. This should be followed up by looking at additional histone
modification marks associated with transcriptional elongation such as H3K79 dimethylation
(H3K79me2). Less active elongation likely suggests a decreased rate of transcription elongation
for p53 target genes. This could be tested by employing a newer technique developed to measure
rates of transcriptional elongation in cells, 4sUDRB-seq, which involves tagging newly
transcribed RNA with 4-thiouridine followed by high throughput sequencing (Fuchs et al. 2014).
However, the mechanism in G/G SNP309 cancer cells that may be associated with less
transcriptional elongation at these p53 target genes needs to be explored.
The enzyme responsible for H3K36me3 is SETD2, a histone methyltransferase
preferentially recruited to chromatin by phosphorylated S5/S2 CTD RNA pol II (Li et al. 2005;
Sun et al. 2005). The p53 protein interacts with SETD2 to selectively regulate transcription of
p53 target genes (Xie et al. 2008). The overexpression of SETD2 cooperates with p53 to
upregulate transcription of select p53 target genes including p21 and puma, while downregulating mdm2. However, the knockdown of SETD2 by siRNA has the opposite effect (Xie et
89
al. 2008). SETD2, and the associated H3K6me3 mark, recruits the FACT chromatin complex
(Carvalho et al. 2013). FACT (Facilitates Chromatin Transcription) is a chromatin-specific
elongation complex that facilitates nucleosome disassembly and reassembly during transcription
(Orphanides et al. 1998; Orphanides et al. 1999; Belotserkovskaya and Reinberg 2004). The
FACT complex is proposed to displace H2A-H2B dimers from nucleosomes destabilizing its
structure and reassembling nucleosomes after elongating RNA pol II has passed over the gene
during transcription (Belotserkovskaya and Reinberg 2004; Formosa 2008; Xin et al. 2009).
Therefore, SETD2 is a likely target in attempting to explain the discrepancy in H3K36me3 and
lower transcript levels in G/G SNP309 cancer cells for p53 target genes as compared to wildtype cells.
In G/G SNP309 cancer cells, we hypothesize less SETD2 recruitment at p53 target gene
transcription sites as compared to wild-type cells. SETD2 recruitment can be tested by
performing chromatin immunoprecipitation analysis. As compared to ML-1 cells, MANCA and
A875 cells may have defects in SETD2 recruitment that would account for differences in
H3K36me3 at p21 and puma genes. Less SETD2 recruitment likely contributes to the
compromised transcriptional elongation at p53 target genes due to decreased FACT recruitment
leading to less displacement of H2A-H2B dimers from nucleosomes and less nucleosome
disassembly. This can be tested by performing chromatin immunoprecipitation analysis of a
FACT subunit, Spt16, one of the components found to be affected by SETD2 at several genes
during transcription (Carvalho et al. 2013). Nucleosome organization can also be observed for
both p21 and puma genes by observing changes in H2B with chromatin immunoprecipitation
analysis along the length of the p53 target genes. Previously, it was observed that H2B levels are
affected in cells in a SETD2-dependent manner during transcription (Carvalho et al. 2013). In
90
order to determine if SETD2 is indeed the dependent factor for transcription elongation,
overexpression of SETD2 in G/G SNP309 MANCA and A875 cancer cells should be able to
overcome transcription of p53 target genes. This can be achieved by transfecting or infecting
exogenous SETD2 into G/G SNP309 cancer cells followed by etoposide treatment to observe if
this causes an increase in transcription of p53 target genes. We can then determine if in G/G
SNP309 cancer cells this is due to differences in H3K36me3 and SETD2 recruitment using
chromatin immunoprecipitation analysis. Additionally, we can also determine if treating G/G
SNP309 cancer cells with different therapeutic agents known to active p53 transcriptional
activity including Nutlin-3 and actinomycin D also have similar differences in H3K36me3 and
SETD 2 recruitment in comparison to wild-type cells.
A smaller, but interesting, finding in chapter 3 was observed involving ubiquitinated
RNA pol II. After total RNA pol II immunoprecipitation, we observed that constitutive
knockdown of MDM2 in MANCA cells treated with proteasome inhibitor had increased
ubiquitinated RNA pol II (Figure 19). Proteasome inhibitor treatment was added to increase the
overall total pool of ubiqutinated protein in the cells. Why ubiquitinated RNA pol II increased
with MDM2 knockdown is not known, however, we can speculate the reason this may occur.
Ubiquitination of RNA pol II is a mechanism used by cells to target arrested transcriptional RNA
pol II complexes during transcription elongation to clear the complexes for the next elongating
RNA pol II complex (see reviews (Svejstrup 2003; Wilson et al. 2013)). Distinct E3-ubiquitin
ligases are responsible for ubiquitination of RNA pol II in a two-step mechanism (Harreman et
al. 2009). NEDD4 cooperates with the ElonginA/B/C-Cullin 5 complex for RNA pol II polyubiquitination (Harreman et al. 2009). Recently, NEDD4-1 was found to interact with MDM2
targeting it for ubiquitination and degradation (Xu et al. 2015). Interestingly, since MANCA
91
cells have an overabundance of mdm2 mRNA and protein (including splice variants and protein
isoforms) there could be binding of MDM2 to NEDD-4 and targeted degradation. In Figure 13,
we did indeed observe that MDM2 was a target of the ubiquitin-proteasome pathway because
proteasome inhibitor treatment increased MDM2 protein levels (Figure 13). It is likely that in
MANCA cells, the knockdown of MDM2 could shift the equilibrium of NEDD4 E3 ligase
activity toward the binding and ubiquitination of RNA pol II. This could be tested by first
performing co-immunoprecipitation analysis for NEDD4 and RNA pol II and NEDD4 and
MDM2 in MANCA cells. Hypothetically, the knockdown of MDM2 would increase the amount
of NEDD4 protein immunoprecipitated with RNA pol II and hence increased ubiquitinated RNA
pol II.
In chapter 4, we observed that G/G SNP309 MANCA cells had a substantial increase in
MDMX protein levels after MDM2 knockdown with no significant increases in mdmX transcript
levels (Figure 20). MDM2 functions as an E3-ligase for MDMX targeting it for degradation (Pan
and Chen 2003). The data indicates MDM2-mediated degradation of MDMX protein. It would
be interesting to follow-up by treating the MANCA cells with and without MDM2 knockdown
with a proteasome inhibitor to observe if it causes an increase in MDMX protein levels. This will
determine if MDMX protein is indeed a target of the ubiquitin-proteasome pathway. Since
MDMX increased only in MANCA cells, we should also ask if this can occur in other
hematological malignancies. We can screen a panel of MDM2 overexpressing hematological
cancer cell lines and infect them with mdm2 shRNA to determine if MDM2 knockdown will
increase MDMX protein levels. It will help determine if this is cell-type specific and also
indicate if MDMX has redundant roles for MDM2 in hematological malignancies.
92
Finally, in chapters 3 and 5 we observed that in G/G SNP309 cancer cells the normal
p53-dependent associated functions of MDM2 were not functioning properly. The knockdown of
MDM2 did not increase p53 protein stability and only moderately increased transactivation of
p53 target genes (Figure 13). Additionally, MDM2 knockdown combined with etoposide
treatment did not sensitize the cells further to treatment or cause an additive effect on p53
transcriptional activity (data not shown). Low dose actinomycin D, used as an alternative to
DNA damage for p53 activation, was not able to cause a robust cell death response in both
MANCA and A875 cell lines (Figure 24). G/G SNP309 cancers have an attenuated p53 stress
response (Bond et al. 2004), and the evidence presented here shows that these cancers cannot
have the p53 pathway reactivated. To pursue this further we need to compare T/T and G/G
SNP309 cells for differences in response to treatment after activation of both p53-dependent and
p53-independent therapeutics including etoposide, Nutlin, actinomycin D and 8-aminoadenosine. We can assess for cell viability, transcription levels of p53 target genes, p53 protein
levels and different markers of cell death. T/T SNP309 cells will likely be responsive to both
p53-dependent and p53-independent chemotherapeutic treatments. Evidence presented here
suggests that G/G SNP309 cancer cells will be more responsive to p53-independent therapeutic
treatments. Below is a model describing the predictions for response to treatment in both T/T
and G/G SNP309 cells (Figure 25).
93
Figure 25- Model describing predicted response to p53-dependent and p53-independent
chemotherapeutics in T/T vs. G/G SNP309 cancer cells.
MDM2 has both p53-dependent and independent functions in cancer. MDM2 in G/G
SNP309 cancer cells likely contributes to chemoresistance in a p53-independent manner. This
may be due to delays in DNA repair associated with MDM2, the regulation of general
transcription by inhibiting RNA pol II ubiquitination or the many functions of the MDM2
isoform proteins that are still unknown. These are just several avenues that can be explored to
correlate MDM2 to chemoresistance in a p53-independent manner.
94
Chapter 7: Bibliography
95
Abbas T, Olivier M, Lopez J, Houser S, Xiao G, Kumar GS, Tomasz M, Bargonetti J. 2002.
Differential activation of p53 by the various adducts of mitomycin C. Journal of
Biological Chemistry 277: 40513-40519.
Alt JR, Bouska A, Fernandez MR, Cerny RL, Xiao H, Eischen CM. 2005. Mdm2 binds to Nbs1
at sites of DNA damage and regulates double strand break repair. J Biol Chem 280:
18771-18781.
An W, Kim J, Roeder R. 2004. Ordered cooperative functions of PRMT1, p300, and CARM1 in
transcriptional activation by p53. Cell 117: 735-748.
An WG, Kanekal M, Simon MC, Maltepe E, Blagosklonny MV, Neckers LM. 1998.
Stabilization of wild-type p53 by hypoxia-inducible factor 1alpha. Nature 392: 405-408.
Angelov D, Bondarenko VA, Almagro S, Menoni H, Mongelard F, Hans F, Mietton F, Studitsky
VM, Hamiche A, Dimitrov S et al. 2006. Nucleolin is a histone chaperone with FACTlike activity and assists remodeling of nucleosomes. EMBO J 25: 1669-1679.
Appella E, Anderson C. 2001. Post-translational modifications and activation of p53 by
genotoxic stresses. Eur J Biochem 268: 2764-2772.
Araki S, Eitel JA, Batuello CN, Bijangi-Vishehsaraei K, Xie XJ, Danielpour D, Pollok KE,
Boothman DA, Mayo LD. 2010. TGF-beta1-induced expression of human Mdm2
correlates with late-stage metastatic breast cancer. The Journal of clinical investigation
120: 290-302.
Arva N, Gopen T, Talbott K, Campbell L, Chicas A, White D, Bond G, Levine A, Bargonetti J.
2005. A chromatin-associated and transcriptionally inactive p53-Mdm2 complex occurs
in mdm2 SNP309 homozygous cells. J Biol Chem 280: 26776-26787.
96
Arva N, Talbott K, Okoro D, Brekman A, Qiu W, Bargonetti J. 2008. Disruption of the p53Mdm2 complex by Nutlin-3 reveals different cancer cell phenotypes. Ethn Dis 18: S2-18.
Badciong JC, Haas AL. 2002. MdmX is a RING finger ubiquitin ligase capable of synergistically
enhancing Mdm2 ubiquitination. J Biol Chem 277: 49668-49675.
Barak Y, Gottlieb E, Juven-Gershon T, Oren M. 1994. Regulation of mdm2 expression by p53:
alternative promoters produce transcripts with nonidentical translation potential. Genes
Dev 8: 1739-1749.
Bargonetti J, Friedman P, Kern S, Vogelstein B, Prives C. 1991. Wild-type but not mutant p53
immunopurified proteins bind to sequences adjacent to the SV40 origin of replication.
Cell 65: 1083-1091.
Bargonetti J, Reynisdottir I, Friedman PN, Prives C. 1992. Site-Specific Binding of Wild-TypeP53 to Cellular DNA Is Inhibited by Sv40-T Antigen and Mutant P53. Genes &
Development 6: 1886-1898.
Barlev NA, Liu L, Chehab NH, Mansfield K, Harris KG, Halazonetis TD, Berger SL. 2001.
Acetylation of p53 activates transcription through recruitment of coactivators/histone
acetyltransferases. Mol Cell 8: 1243-1254.
Bartel F, Meye A, Wurl P, Kappler M, Bache M, Lautenschlager C, Grunbaum U, Schmidt H,
Taubert H. 2001. Amplification of the MDM2 gene, but not expression of splice variants
of MDM2 MRNA, is associated with prognosis in soft tissue sarcoma. International
journal of cancer Journal international du cancer 95: 168-175.
Bartel F, Taubert H, Harris L. 2002. Alternative and aberrant splicing of MDM2 mRNA in
human cancer. Cancer Cell 2: 9-15.
97
Beckerman R, Prives C. 2010. Transcriptional regulation by p53. Cold Spring Harb Perspect
Biol 2: a000935.
Bell S, Klein C, Müller L, Hansen S, Buchner J. 2002. p53 contains large unstructured regions in
its native state. J Mol Biol 322: 917-927.
Belotserkovskaya R, Reinberg D. 2004. Facts about FACT and transcript elongation through
chromatin. Current opinion in genetics & development 14: 139-146.
Berger S. 2007. The complex language of chromatin regulation during transcription. Nature 447:
407-412.
Berger U, McClelland RA, Wilson P, Greene GL, Haussler MR, Pike JW, Colston K, Easton D,
Coombes RC. 1991. Immunocytochemical determination of estrogen receptor,
progesterone receptor, and 1,25-dihydroxyvitamin D3 receptor in breast cancer and
relationship to prognosis. Cancer Res 51: 239-244.
Biderman L, Poyurovsky MV, Assia Y, Manley JL, Prives C. 2012. MdmX is required for p53
interaction with and full induction of the Mdm2 promoter after cellular stress. Mol Cell
Biol 32: 1214-1225.
Blaydes JP. 2010. Cooperation Between MDM2 and MDMX in the Regulation of p53. in p53
(ed. AAaT Hupp), p. 15.
Boddy M, Freemont P, Borden K. 1994. The p53-associated protein MDM2 contains a newly
characterized zinc-binding domain called the RING finger. Trends Biochem Sci 19: 198199.
Bond G, Hirshfield K, Kirchhoff T, Alexe G, Bond E, Robins H, Bartel F, Taubert H, Wuerl P,
Hait W et al. 2006. MDM2 SNP309 accelerates tumor formation in a gender-specific and
hormone-dependent manner. Cancer Res 66: 5104-5110.
98
Bond G, Hu W, Bond E, Robins H, Lutzker S, Arva N, Bargonetti J, Bartel F, Taubert H, Wuerl
P et al. 2004. A single nucleotide polymorphism in the MDM2 promoter attenuates the
p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 119:
591-602.
Braastad CD, Han Z, Hendrickson EA. 2003. Constitutive DNase I hypersensitivity of p53regulated promoters. J Biol Chem 278: 8261-8268.
Brekman A, Singh KE, Polotskaia A, Kundu N, Bargonetti J. 2011. A p53-independent role of
Mdm2 in estrogen-mediated activation of breast cancer cell proliferation. Breast cancer
research : BCR 13: R3.
Bueso-Ramos C, Yang Y, deLeon E, McCown P, Stass S, Albitar M. 1993. The human MDM-2
oncogene is overexpressed in leukemias. Blood 82: 2617-2623.
Buratowski S. 2009. Progression through the RNA polymerase II CTD cycle. Mol Cell 36: 541546.
Buttitta F, Marchetti A, Gadducci A, Pellegrini S, Morganti M, Carnicelli V, Cosio S, Gagetti O,
Genazzani AR, Bevilacqua G. 1997. p53 alterations are predictive of chemoresistance
and aggressiveness in ovarian carcinomas: a molecular and immunohistochemical study.
British journal of cancer 75: 230-235.
Cahilly-Snyder L, Yang-Feng T, Francke U, George D. 1987. Molecular analysis and
chromosomal mapping of amplified genes isolated from a transformed mouse 3T3 cell
line. Somat Cell Mol Genet 13: 235-244.
Candeias M, Malbert-Colas L, Powell D, Daskalogianni C, Maslon M, Naski N, Bourougaa K,
Calvo F, Fåhraeus R. 2008. p53 mRNA controls p53 activity by managing Mdm2
functions. Nat Cell Biol.
99
Canman CE, Lim DS, Cimprich KA, Taya Y, Tamai K, Sakaguchi K, Appella E, Kastan MB,
Siliciano JD. 1998. Activation of the ATM kinase by ionizing radiation and
phosphorylation of p53. Science 281: 1677-1679.
Canman CE, Wolff AC, Chen CY, Fornace AJ, Jr., Kastan MB. 1994. The p53-dependent G1
cell cycle checkpoint pathway and ataxia-telangiectasia. Cancer Res 54: 5054-5058.
Carvalho S, Raposo AC, Martins FB, Grosso AR, Sridhara SC, Rino J, Carmo-Fonseca M, de
Almeida SF. 2013. Histone methyltransferase SETD2 coordinates FACT recruitment
with nucleosome dynamics during transcription. Nucleic Acids Res 41: 2881-2893.
Champoux JJ. 2001. DNA topoisomerases: structure, function, and mechanism. Annual review of
biochemistry 70: 369-413.
Chandler DS, Singh RK, Caldwell LC, Bitler JL, Lozano G. 2006. Genotoxic stress induces
coordinately regulated alternative splicing of the p53 modulators MDM2 and MDM4.
Cancer research 66: 9502-9508.
Chen D, Zhang Z, Li M, Wang W, Li Y, Rayburn ER, Hill DL, Wang H, Zhang R. 2007.
Ribosomal protein S7 as a novel modulator of p53-MDM2 interaction: binding to
MDM2, stabilization of p53 protein, and activation of p53 function. Oncogene 26: 50295037.
Chen H, Li B, Workman JL. 1994. A histone-binding protein, nucleoplasmin, stimulates
transcription factor binding to nucleosomes and factor-induced nucleosome disassembly.
EMBO J 13: 380-390.
Chen J. 2012. The Roles of MDM2 and MDMX Phosphorylation in Stress Signaling to p53.
Genes Cancer 3: 274-282.
100
Chen J, Marechal V, Levine A. 1993. Mapping of the p53 and mdm-2 interaction domains. Mol
Cell Biol 13: 4107-4114.
Chen L, Gilkes DM, Pan Y, Lane WS, Chen J. 2005. ATM and Chk2-dependent phosphorylation
of MDMX contribute to p53 activation after DNA damage. EMBO J 24: 3411-3422.
Chen L, Li Z, Zwolinska AK, Smith MA, Cross B, Koomen J, Yuan ZM, Jenuwein T, Marine
JC, Wright KL et al. 2010. MDM2 recruitment of lysine methyltransferases regulates p53
transcriptional output. EMBO J 29: 2538-2552.
Chen X, Qiu J, Yang D, Lu J, Yan C, Zha X, Yin Y. 2013. MDM2 promotes invasion and
metastasis in invasive ductal breast carcinoma by inducing matrix metalloproteinase-9.
PloS one 8: e78794.
Cheung-Ong K, Giaever G, Nislow C. 2013. DNA-damaging agents in cancer chemotherapy:
serendipity and chemical biology. Chem Biol 20: 648-659.
Choong ML, Yang H, Lee MA, Lane DP. 2009. Specific activation of the p53 pathway by low
dose actinomycin D: a new route to p53 based cyclotherapy. Cell Cycle 8: 2810-2818.
Cocker HA, Hobbs SM, Tiffin N, Pritchard-Jones K, Pinkerton CR, Kelland LR. 2001. High
levels of the MDM2 oncogene in paediatric rhabdomyosarcoma cell lines may confer
multidrug resistance. British journal of cancer 85: 1746-1752.
Cordon-Cardo C, Latres E, Drobnjak M, Oliva M, Pollack D, Woodruff J, Marechal V, Chen J,
Brennan M, Levine A. 1994. Molecular abnormalities of mdm2 and p53 genes in adult
soft tissue sarcomas. Cancer Res 54: 794-799.
Danovi D, Meulmeester E, Pasini D, Migliorini D, Capra M, Frenk R, de Graaf P, Francoz S,
Gasparini P, Gobbi A et al. 2004. Amplification of Mdmx (or Mdm4) directly contributes
101
to tumor formation by inhibiting p53 tumor suppressor activity. Mol Cell Biol 24: 58355843.
de Graaf P, Little NA, Ramos YF, Meulmeester E, Letteboer SJ, Jochemsen AG. 2003. Hdmx
protein stability is regulated by the ubiquitin ligase activity of Mdm2. J Biol Chem 278:
38315-38324.
Dias C, Liu Y, Yau A, Westrick L, Evans S. 2006. Regulation of hdm2 by stress-induced
hdm2alt1 in tumor and nontumorigenic cell lines correlating with p53 stability. Cancer
Res 66: 9467-9473.
Ding K, Lu Y, Nikolovska-Coleska Z, Wang G, Qiu S, Shangary S, Gao W, Qin D, Stuckey J,
Krajewski K et al. 2006. Structure-based design of spiro-oxindoles as potent, specific
small-molecule inhibitors of the MDM2-p53 interaction. Journal of medicinal chemistry
49: 3432-3435.
Dulac C, Michels AA, Fraldi A, Bonnet F, Nguyen VT, Napolitano G, Lania L, Bensaude O.
2005. Transcription-dependent association of multiple positive transcription elongation
factor units to a HEXIM multimer. J Biol Chem 280: 30619-30629.
Dumaz N, Meek D. 1999. Serine15 phosphorylation stimulates p53 transactivation but does not
directly influence interaction with HDM2. EMBO J 18: 7002-7010.
Edmunds JW, Mahadevan LC, Clayton AL. 2008. Dynamic histone H3 methylation during gene
induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J 27: 406-420.
Eitoku M, Sato L, Senda T, Horikoshi M. 2008. Histone chaperones: 30 years from isolation to
elucidation of the mechanisms of nucleosome assembly and disassembly. Cell Mol Life
Sci 65: 414-444.
102
el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B. 1992. Definition of a consensus
binding site for p53. Nature genetics 1: 45-49.
Espinosa J, Emerson B. 2001. Transcriptional regulation by p53 through intrinsic
DNA/chromatin binding and site-directed cofactor recruitment. Mol Cell 8: 57-69.
Espinosa JM, Verdun RE, Emerson BM. 2003. p53 functions through stress- and promoterspecific recruitment of transcription initiation components before and after DNA damage.
Mol Cell 12: 1015-1027.
Fakharzadeh S, Trusko S, George D. 1991. Tumorigenic potential associated with enhanced
expression of a gene that is amplified in a mouse tumor cell line. EMBO J 10: 1565-1569.
Farmer G, Colgan J, Nakatani Y, Manley J, Prives C. 1996. Functional interaction between p53,
the TATA-binding protein (TBP), andTBP-associated factors in vivo. Mol Cell Biol 16:
4295-4304.
Fields S, Jang S. 1990. Presence of a potent transcription activating sequence in the p53 protein.
Science 249: 1046-1049.
Formosa T. 2008. FACT and the reorganized nucleosome. Mol Biosyst 4: 1085-1093.
Foster BA, Coffey HA, Morin MJ, Rastinejad F. 1999. Pharmacological rescue of mutant p53
conformation and function. Science 286: 2507-2510.
Frey JA, Gandhi V. 2010. 8-Amino-adenosine inhibits multiple mechanisms of transcription.
Molecular cancer therapeutics 9: 236-245.
Friedman PN, Chen X, Bargonetti J, Prives C. 1993. The p53 protein is an unusually shaped
tetramer that binds directly to DNA. Proc Natl Acad Sci U S A 90: 3319-3323.
103
Fuchs G, Voichek Y, Benjamin S, Gilad S, Amit I, Oren M. 2014. 4sUDRB-seq: measuring
genomewide transcriptional elongation rates and initiation frequencies within cells.
Genome biology 15: R69.
Gajjar M, Candeias MM, Malbert-Colas L, Mazars A, Fujita J, Olivares-Illana V, Fahraeus R.
2012. The p53 mRNA-Mdm2 interaction controls Mdm2 nuclear trafficking and is
required for p53 activation following DNA damage. Cancer cell 21: 25-35.
Ganguli G, Wasylyk B. 2003. p53-independent functions of MDM2. Mol Cancer Res 1: 10271035.
Gaughan L, Logan IR, Neal DE, Robson CN. 2005. Regulation of androgen receptor and histone
deacetylase 1 by Mdm2-mediated ubiquitylation. Nucleic Acids Res 33: 13-26.
Gembarska A, Luciani F, Fedele C, Russell EA, Dewaele M, Villar S, Zwolinska A, Haupt S, de
Lange J, Yip D et al. 2012. MDM4 is a key therapeutic target in cutaneous melanoma.
Nat Med 18: 1239-1247.
Geng F, Wenzel S, Tansey WP. 2012. Ubiquitin and proteasomes in transcription. Annual review
of biochemistry 81: 177-201.
Ghosh M, Huang K, Berberich SJ. 2003. Overexpression of Mdm2 and MdmX fusion proteins
alters p53 mediated transactivation, ubiquitination, and degradation. Biochemistry 42:
2291-2299.
Giglio S, Mancini F, Gentiletti F, Sparaco G, Felicioni L, Barassi F, Martella C, Prodosmo A,
Iacovelli S, Buttitta F et al. 2005. Identification of an aberrantly spliced form of HDMX
in human tumors: a new mechanism for HDM2 stabilization. Cancer Res 65: 9687-9694.
Gilkes DM, Pan Y, Coppola D, Yeatman T, Reuther GW, Chen J. 2008. Regulation of MDMX
expression by mitogenic signaling. Mol Cell Biol 28: 1999-2010.
104
Gomes NP, Bjerke G, Llorente B, Szostek SA, Emerson BM, Espinosa JM. 2006. Gene-specific
requirement for P-TEFb activity and RNA polymerase II phosphorylation within the p53
transcriptional program. Genes Dev 20: 601-612.
Gomes NP, Espinosa JM. 2010. Gene-specific repression of the p53 target gene PUMA via
intragenic CTCF-Cohesin binding. Genes Dev 24: 1022-1034.
Graeber TG, Osmanian C, Jacks T, Housman DE, Koch CJ, Lowe SW, Giaccia AJ. 1996.
Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours.
Nature 379: 88-91.
Graunke DM, Fornace AJ, Jr., Pieper RO. 1999. Presetting of chromatin structure and
transcription factor binding poise the human GADD45 gene for rapid transcriptional upregulation. Nucleic Acids Res 27: 3881-3890.
Gu W, Roeder RG. 1997. Activation of p53 sequence-specific DNA binding by acetylation of
the p53 C-terminal domain. Cell 90: 595-606.
Guenther MG, Levine SS, Boyer LA, Jaenisch R, Young RA. 2007. A chromatin landmark and
transcription initiation at most promoters in human cells. Cell 130: 77-88.
Gustafsson B, Axelsson B, Gustafsson B, Christensson B, Winiarski J. 2001. MDM2 and p53 in
childhood acute lymphoblastic leukemia: higher expression in childhood leukemias with
poor prognosis compared to long-term survivors. Pediatr Hematol Oncol 18: 497-508.
Gustafsson B, Stal O, Gustafsson B. 1998. Overexpression of MDM2 in acute childhood
lymphoblastic leukemia. Pediatr Hematol Oncol 15: 519-526.
Hake SB, Garcia BA, Duncan EM, Kauer M, Dellaire G, Shabanowitz J, Bazett-Jones DP, Allis
CD, Hunt DF. 2006. Expression patterns and post-translational modifications associated
with mammalian histone H3 variants. J Biol Chem 281: 559-568.
105
Harreman M, Taschner M, Sigurdsson S, Anindya R, Reid J, Somesh B, Kong SE, Banks CA,
Conaway RC, Conaway JW et al. 2009. Distinct ubiquitin ligases act sequentially for
RNA polymerase II polyubiquitylation. Proc Natl Acad Sci U S A 106: 20705-20710.
Harris C. 1993. p53: at the crossroads of molecular carcinogenesis and risk assessment. Science
262: 1980-1981.
Harris C, Hollstein M. 1993. Clinical implications of the p53 tumor-suppressor gene. N Engl J
Med 329: 1318-1327.
Haupt Y, Maya R, Kazaz A, Oren M. 1997. Mdm2 promotes the rapid degradation of p53.
Nature 387: 296-299.
Hendrix DA, Hong JW, Zeitlinger J, Rokhsar DS, Levine MS. 2008. Promoter elements
associated with RNA Pol II stalling in the Drosophila embryo. Proc Natl Acad Sci U S A
105: 7762-7767.
Henry KW, Wyce A, Lo WS, Duggan LJ, Emre NC, Kao CF, Pillus L, Shilatifard A, Osley MA,
Berger SL. 2003. Transcriptional activation via sequential histone H2B ubiquitylation
and deubiquitylation, mediated by SAGA-associated Ubp8. Genes Dev 17: 2648-2663.
Herman AG, Hayano M, Poyurovsky MV, Shimada K, Skouta R, Prives C, Stockwell BR. 2011.
Discovery of Mdm2-MdmX E3 ligase inhibitors using a cell-based ubiquitination assay.
Cancer discovery 1: 312-325.
Hideshima T, Shinohara T, Baba M, Shirakusa T. 1997. The expression of MDM2 and p53
protein breast carcinoma. Oncology reports 4: 297-300.
Hirao A, Kong YY, Matsuoka S, Wakeham A, Ruland J, Yoshida H, Liu D, Elledge SJ, Mak
TW. 2000. DNA damage-induced activation of p53 by the checkpoint kinase Chk2.
Science 287: 1824-1827.
106
Holzel M, Burger K, Muhl B, Orban M, Kellner M, Eick D. 2010. The tumor suppressor p53
connects ribosome biogenesis to cell cycle control: a double-edged sword. Oncotarget 1:
43-47.
Honda R, Tanaka H, Yasuda H. 1997. Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor
suppressor p53. FEBS Lett 420: 25-27.
Hu W, Feng Z, Ma L, Wagner J, Rice JJ, Stolovitzky G, Levine AJ. 2007. A single nucleotide
polymorphism in the MDM2 gene disrupts the oscillation of p53 and MDM2 levels in
cells. Cancer Res 67: 2757-2765.
Hupp TR, Lane DP. 1994a. Allosteric activation of latent p53 tetramers. Current biology : CB 4:
865-875.
-. 1994b. Regulation of the cryptic sequence-specific DNA-binding function of p53 by protein
kinases. Cold Spring Harb Symp Quant Biol 59: 195-206.
Inga A, Storici F, Darden TA, Resnick MA. 2002. Differential transactivation by the p53
transcription factor is highly dependent on p53 level and promoter target sequence. Mol
Cell Biol 22: 8612-8625.
Ito A, Kawaguchi Y, Lai CH, Kovacs JJ, Higashimoto Y, Appella E, Yao TP. 2002. MDM2HDAC1-mediated deacetylation of p53 is required for its degradation. EMBO J 21: 62366245.
Iwakuma T, Lozano G. 2003. MDM2, an introduction. Mol Cancer Res 1: 993-1000.
Iyengar S, Farnham PJ. 2011. KAP1 protein: an enigmatic master regulator of the genome. J Biol
Chem 286: 26267-26276.
Iyengar S, Ivanov AV, Jin VX, Rauscher FJ, 3rd, Farnham PJ. 2011. Functional analysis of
KAP1 genomic recruitment. Mol Cell Biol 31: 1833-1847.
107
Jenuwein T, Allis CD. 2001. Translating the histone code. Science 293: 1074-1080.
Jin G, Cook S, Cui B, Chen WC, Keir ST, Killela P, Di C, Payne CA, Gregory SG, McLendon R
et al. 2010. HDMX regulates p53 activity and confers chemoresistance to 3-bis(2chloroethyl)-1-nitrosourea. Neuro-oncology 12: 956-966.
Jin S, Levine A. 2001. The p53 functional circuit. J Cell Sci 114: 4139-4140.
Jin Y, Dai MS, Lu SZ, Xu Y, Luo Z, Zhao Y, Lu H. 2006. 14-3-3gamma binds to MDMX that is
phosphorylated by UV-activated Chk1, resulting in p53 activation. EMBO J 25: 12071218.
Jones SN, Roe AE, Donehower LA, Bradley A. 1995. Rescue of embryonic lethality in Mdm2deficient mice by absence of p53. Nature 378: 206-208.
Juan L, Shia W, Chen M, Yang W, Seto E, Lin Y, Wu C. 2000. Histone deacetylases specifically
down-regulate p53-dependent gene activation. J Biol Chem 275: 20436-20443.
Juven T, Barak Y, Zauberman A, George D, Oren M. 1993. Wild type p53 can mediate
sequence-specific transactivation of an internal promoter within the mdm2 gene.
Oncogene 8: 3411-3416.
Kaeser M, Iggo R. 2004. Promoter-specific p53-dependent histone acetylation following DNA
damage. Oncogene 23: 4007-4013.
Kaeser MD, Iggo RD. 2002. Chromatin immunoprecipitation analysis fails to support the latency
model for regulation of p53 DNA binding activity in vivo. Proc Natl Acad Sci U S A 99:
95-100.
Kastan M, Onyekwere O, Sidransky D, Vogelstein B, Craig R. 1991. Participation of p53 protein
in the cellular response to DNA damage. Cancer Res 51: 6304-6311.
108
Kastan MB, Canman CE, Leonard CJ. 1995. P53, cell cycle control and apoptosis: implications
for cancer. Cancer Metastasis Rev 14: 3-15.
Kawai H, Lopez-Pajares V, Kim MM, Wiederschain D, Yuan ZM. 2007. RING domainmediated interaction is a requirement for MDM2's E3 ligase activity. Cancer Res 67:
6026-6030.
Kawai H, Wiederschain D, Kitao H, Stuart J, Tsai KK, Yuan ZM. 2003. DNA damage-induced
MDMX degradation is mediated by MDM2. J Biol Chem 278: 45946-45953.
Kim K, Burghardt R, Barhoumi R, Lee SO, Liu X, Safe S. 2011. MDM2 regulates estrogen
receptor alpha and estrogen responsiveness in breast cancer cells. J Mol Endocrinol 46:
67-79.
Knappskog S, Lonning PE. 2012. P53 and its molecular basis to chemoresistance in breast
cancer. Expert opinion on therapeutic targets 16 Suppl 1: S23-30.
Knights CD, Catania J, Di Giovanni S, Muratoglu S, Perez R, Swartzbeck A, Quong AA, Zhang
X, Beerman T, Pestell RG et al. 2006. Distinct p53 acetylation cassettes differentially
influence gene-expression patterns and cell fate. The Journal of cell biology 173: 533544.
Ko LJ, Prives C. 1996. p53: puzzle and paradigm. Genes Dev 10: 1054-1072.
Kobiyama K, Kawashima A, Jounai N, Takeshita F, Ishii KJ, Ito T, Suzuki K. 2013. Role of
Extrachromosomal Histone H2B on Recognition of DNA Viruses and Cell Damage.
Frontiers in genetics 4: 91.
Komarnitsky P, Cho E, Buratowski S. 2000. Different phosphorylated forms of RNA polymerase
II and associated mRNA processing factors during transcription. Genes Dev 14: 24522460.
109
Krett NL, Davies KM, Ayres M, Ma C, Nabhan C, Gandhi V, Rosen ST. 2004. 8-aminoadenosine is a potential therapeutic agent for multiple myeloma. Molecular cancer
therapeutics 3: 1411-1420.
Kruse J, Gu W. 2009. Modes of p53 regulation. Cell 137: 609-622.
Laframboise S, Chapman W, McLaughlin J, Andrulis IL. 2000. p53 mutations in epithelial
ovarian cancers: possible role in predicting chemoresistance. Cancer journal 6: 302-308.
Landers J, Haines D, Strauss Jr, George D. 1994. Enhanced translation: a novel mechanism of
mdm2 oncogene overexpression identified in human tumor cells. Oncogene 9: 27452750.
Laskey RA, Mills AD, Philpott A, Leno GH, Dilworth SM, Dingwall C. 1993. The role of
nucleoplasmin in chromatin assembly and disassembly. Philosophical transactions of the
Royal Society of London Series B, Biological sciences 339: 263-269; discussion 268-269.
Lau J, Lew QJ, Diribarne G, Michels AA, Dey A, Bensaude O, Lane DP, Chao SH. 2009.
Ubiquitination of HEXIM1 by HDM2. Cell Cycle 8: 2247-2254.
Lemon B, Tjian R. 2000. Orchestrated response: a symphony of transcription factors for gene
control. Genes Dev 14: 2551-2569.
Lenos K, Jochemsen AG. 2011. Functions of MDMX in the modulation of the p53-response.
Journal of biomedicine & biotechnology 2011: 876173.
Lents NH, Wheeler LW, Baldassare JJ, Dynlacht BD. 2008. Identification and characterization
of a novel Mdm2 splice variant acutely induced by the chemotherapeutic agents
adriamycin and actinomycin D. Cell Cycle 7: 1580-1586.
110
Lev Bar-Or R, Maya R, Segel L, Alon U, Levine A, Oren M. 2000. Generation of oscillations by
the p53-Mdm2 feedback loop: a theoretical and experimental study. Proc Natl Acad Sci
U S A 97: 11250-11255.
Leventaki V, Rodic V, Tripp SR, Bayerl MG, Perkins SL, Barnette P, Schiffman JD, Miles RR.
2012. TP53 pathway analysis in paediatric Burkitt lymphoma reveals increased MDM4
expression as the only TP53 pathway abnormality detected in a subset of cases. British
journal of haematology 158: 763-771.
Levine A. 1997. p53, the cellular gatekeeper for growth and division. Cell 88: 323-331.
Lew QJ, Chia YL, Chu KL, Lam YT, Gurumurthy M, Xu S, Lam KP, Cheong N, Chao SH.
2012. Identification of HEXIM1 as a positive regulator of p53. J Biol Chem 287: 3644336454.
Lew QJ, Chu KL, Chia YL, Cheong N, Chao SH. 2013. HEXIM1, a New Player in the p53
Pathway. Cancers 5: 838-856.
Li B, Cheng Q, Li Z, Chen J. 2010. p53 inactivation by MDM2 and MDMX negative feedback
loops in testicular germ cell tumors. Cell Cycle 9: 1411-1420.
Li F, Mao G, Tong D, Huang J, Gu L, Yang W, Li GM. 2013. The histone mark H3K36me3
regulates human DNA mismatch repair through its interaction with MutSalpha. Cell 153:
590-600.
Li M, Luo J, Brooks CL, Gu W. 2002. Acetylation of p53 inhibits its ubiquitination by Mdm2. J
Biol Chem 277: 50607-50611.
Li M, Phatnani HP, Guan Z, Sage H, Greenleaf AL, Zhou P. 2005. Solution structure of the Set2Rpb1 interacting domain of human Set2 and its interaction with the hyperphosphorylated
C-terminal domain of Rpb1. Proc Natl Acad Sci U S A 102: 17636-17641.
111
Lill N, Grossman S, Ginsberg D, DeCaprio J, Livingston D. 1997. Binding and modulation of
p53 by p300/CBP coactivators. Nature 387: 823-827.
Linke K, Mace PD, Smith CA, Vaux DL, Silke J, Day CL. 2008. Structure of the
MDM2/MDMX RING domain heterodimer reveals dimerization is required for their
ubiquitylation in trans. Cell death and differentiation 15: 841-848.
Linke SP, Clarkin KC, Di Leonardo A, Tsou A, Wahl GM. 1996. A reversible, p53-dependent
G0/G1 cell cycle arrest induced by ribonucleotide depletion in the absence of detectable
DNA damage. Genes Dev 10: 934-947.
Linzer D, Levine A. 1979. Characterization of a 54K dalton cellular SV40 tumor antigen present
in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 17: 43-52.
Liu L, Scolnick DM, Trievel RC, Zhang HB, Marmorstein R, Halazonetis TD, Berger SL. 1999.
p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA
damage. Mol Cell Biol 19: 1202-1209.
Lohrum MA, Ashcroft M, Kubbutat MH, Vousden KH. 2000. Identification of a cryptic
nucleolar-localization signal in MDM2. Nat Cell Biol 2: 179-181.
Loughery J, Cox M, Smith LM, Meek DW. 2014. Critical role for p53-serine 15 phosphorylation
in stimulating transactivation at p53-responsive promoters. Nucleic Acids Res 42: 76667680.
Lozano G, Montes de Oca Luna R. 1998. MDM2 function. Biochimica et biophysica acta 1377:
M55-59.
Lu H, Levine AJ. 1995. Human TAFII31 protein is a transcriptional coactivator of the p53
protein. Proc Natl Acad Sci U S A 92: 5154-5158.
112
Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. 1997. Crystal structure of the
nucleosome core particle at 2.8 A resolution. Nature 389: 251-260.
Lukas J, Gao DQ, Keshmeshian M, Wen WH, Tsao-Wei D, Rosenberg S, Press MF. 2001.
Alternative and aberrant messenger RNA splicing of the mdm2 oncogene in invasive
breast cancer. Cancer Res 61: 3212-3219.
Mancini F, Di Conza G, Moretti F. 2009. MDM4 (MDMX) and its Transcript Variants. Current
genomics 10: 42-50.
Manfredi JJ. 2010. The Mdm2-p53 relationship evolves: Mdm2 swings both ways as an
oncogene and a tumor suppressor. Genes Dev 24: 1580-1589.
Marechal V, Elenbaas B, Taneyhill L, Piette J, Mechali M, Nicolas J, Levine A, Moreau J. 1997.
Conservation of structural domains and biochemical activities of the MDM2 protein from
Xenopus laevis. Oncogene 14: 1427-1433.
Markey M, Berberich SJ. 2008. Full-length hdmX transcripts decrease following genotoxic
stress. Oncogene 27: 6657-6666.
Martinelli G, Assouline S, Kasner M, Vey N, Kelly KR, Drummond MW, Dennis M, Seiter K,
Blotner S, Jukofsky L et al. 2013. Phase 1b Study Of The MDM2 Antagonist RG7112 In
Combination With 2 Doses/Schedules Of Cytarabine. Blood 122: 498-498.
McLure KG, Lee PW. 1998. How p53 binds DNA as a tetramer. EMBO J 17: 3342-3350.
Meek DW, Anderson CW. 2009. Posttranslational modification of p53: cooperative integrators
of function. Cold Spring Harb Perspect Biol 1: a000950.
Migliorini D, Danovi D, Colombo E, Carbone R, Pelicci PG, Marine JC. 2002. Hdmx
recruitment into the nucleus by Hdm2 is essential for its ability to regulate p53 stability
and transactivation. J Biol Chem 277: 7318-7323.
113
Minsky N, Oren M. 2004. The RING domain of Mdm2 mediates histone ubiquitylation and
transcriptional repression. Mol Cell 16: 631-639.
Moller MB, Nielsen O, Pedersen NT. 1999. Oncoprotein MDM2 overexpression is associated
with poor prognosis in distinct non-Hodgkin's lymphoma entities. Modern pathology : an
official journal of the United States and Canadian Academy of Pathology, Inc 12: 10101016.
Momand J, Zambetti G, Olson D, George D, Levine A. 1992. The mdm-2 oncogene product
forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69:
1237-1245.
Montecucco A, Biamonti G. 2007. Cellular response to etoposide treatment. Cancer letters 252:
9-18.
Montes de Oca Luna R, Wagner D, Lozano G. 1995. Rescue of early embryonic lethality in
mdm2-deficient mice by deletion of p53. Nature 378: 203-206.
Morris SA, Shibata Y, Noma K, Tsukamoto Y, Warren E, Temple B, Grewal SI, Strahl BD.
2005. Histone H3 K36 methylation is associated with transcription elongation in
Schizosaccharomyces pombe. Eukaryotic cell 4: 1446-1454.
Nakagawa K, Taya Y, Tamai K, Yamaizumi M. 1999. Requirement of ATM in phosphorylation
of the human p53 protein at serine 15 following DNA double-strand breaks. Mol Cell
Biol 19: 2828-2834.
Naski N, Gajjar M, Bourougaa K, Malbert-Colas L, Fåhraeus R, Candeias M. 2009. The p53
mRNA-Mdm2 interaction. Cell Cycle 8: 31-34.
114
Nayak M, Yang J, Hait W. 2007. Effect of a single nucleotide polymorphism in the murine
double minute 2 promoter (SNP309) on the sensitivity to topoisomerase II-targeting
drugs. Cancer Res 67: 5831-5839.
Nitiss JL. 2002. DNA topoisomerases in cancer chemotherapy: using enzymes to generate
selective DNA damage. Current opinion in investigational drugs 3: 1512-1516.
Ofir-Rosenfeld Y, Boggs K, Michael D, Kastan M, Oren M. 2008. Mdm2 regulates p53 mRNA
translation through inhibitory interactions with ribosomal protein L26. Mol Cell 32: 180189.
Ohkubo S, Tanaka T, Taya Y, Kitazato K, Prives C. 2006. Excess HDM2 impacts cell cycle and
apoptosis and has a selective effect on p53-dependent transcription. J Biol Chem 281:
16943-16950.
Okamoto K, Kashima K, Pereg Y, Ishida M, Yamazaki S, Nota A, Teunisse A, Migliorini D,
Kitabayashi I, Marine JC et al. 2005. DNA damage-induced phosphorylation of MdmX at
serine 367 activates p53 by targeting MdmX for Mdm2-dependent degradation. Mol Cell
Biol 25: 9608-9620.
Okoro DR, Arva N, Gao C, Polotskaia A, Puente C, Rosso M, Bargonetti J. 2013. Endogenous
human MDM2-C is highly expressed in human cancers and functions as a p53independent growth activator. PloS one 8: e77643.
Okoro DR, Rosso M, Bargonetti J. 2012. Splicing Up Mdm2 for Cancer Proteome Diversity.
Genes & Cancer.
Oliner J, Kinzler K, Meltzer P, George D, Vogelstein B. 1992. Amplification of a gene encoding
a p53-associated protein in human sarcomas. Nature 358: 80-83.
Onel K, Cordon-Cardo C. 2004. MDM2 and prognosis. Mol Cancer Res 2: 1-8.
115
Orphanides G, LeRoy G, Chang CH, Luse DS, Reinberg D. 1998. FACT, a factor that facilitates
transcript elongation through nucleosomes. Cell 92: 105-116.
Orphanides G, Wu WH, Lane WS, Hampsey M, Reinberg D. 1999. The chromatin-specific
transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins.
Nature 400: 284-288.
Pan Y, Chen J. 2003. MDM2 promotes ubiquitination and degradation of MDMX. Mol Cell Biol
23: 5113-5121.
Parant J, Chavez-Reyes A, Little NA, Yan W, Reinke V, Jochemsen AG, Lozano G. 2001.
Rescue of embryonic lethality in Mdm4-null mice by loss of Trp53 suggests a
nonoverlapping pathway with MDM2 to regulate p53. Nature genetics 29: 92-95.
Park YJ, Luger K. 2008. Histone chaperones in nucleosome eviction and histone exchange.
Current opinion in structural biology 18: 282-289.
Patterson DM, Gao D, Trahan DN, Johnson BA, Ludwig A, Barbieri E, Chen Z, Diaz-Miron J,
Vassilev L, Shohet JM et al. 2011. Effect of MDM2 and vascular endothelial growth
factor inhibition on tumor angiogenesis and metastasis in neuroblastoma. Angiogenesis
14: 255-266.
Pauklin S, Kristjuhan A, Maimets T, Jaks V. 2005. ARF and ATM/ATR cooperate in p53mediated apoptosis upon oncogenic stress. Biochemical and biophysical research
communications 334: 386-394.
Pereg Y, Lam S, Teunisse A, Biton S, Meulmeester E, Mittelman L, Buscemi G, Okamoto K,
Taya Y, Shiloh Y et al. 2006. Differential roles of ATM- and Chk2-mediated
phosphorylations of Hdmx in response to DNA damage. Mol Cell Biol 26: 6819-6831.
116
Pereg Y, Shkedy D, de Graaf P, Meulmeester E, Edelson-Averbukh M, Salek M, Biton S,
Teunisse AF, Lehmann WD, Jochemsen AG et al. 2005. Phosphorylation of Hdmx
mediates its Hdm2- and ATM-dependent degradation in response to DNA damage. Proc
Natl Acad Sci U S A 102: 5056-5061.
Peterlin BMaP, David H. 2006. Controlling the Elongation Phase of Transcription with P-Tefb.
Molecular Cell.
Pfister SX, Ahrabi S, Zalmas LP, Sarkar S, Aymard F, Bachrati CZ, Helleday T, Legube G, La
Thangue NB, Porter AC et al. 2014. SETD2-dependent histone H3K36 trimethylation is
required for homologous recombination repair and genome stability. Cell reports 7:
2006-2018.
Phillips A, Teunisse A, Lam S, Lodder K, Darley M, Emaduddin M, Wolf A, Richter J, de Lange
J, Verlaan-de Vries M et al. 2010. HDMX-L is expressed from a functional p53responsive promoter in the first intron of the HDMX gene and participates in an
autoregulatory feedback loop to control p53 activity. J Biol Chem 285: 29111-29127.
Polotskaia A, Hoffman S, Krett NL, Shanmugam M, Rosen ST, Bargonetti J. 2012. 8-Aminoadenosine activates p53-independent cell death of metastatic breast cancers. Molecular
cancer therapeutics 11: 2495-2504.
Post SM, Quintás-Cardama A, Pant V, Iwakuma T, Hamir A, Jackson JG, Maccio DR, Bond GL,
Johnson DG, Levine AJ et al. 2010. A high-frequency regulatory polymorphism in the
p53 pathway accelerates tumor development. Cancer Cell 18: 220-230.
Poyurovsky MV, Jacq X, Ma C, Karni-Schmidt O, Parker PJ, Chalfie M, Manley JL, Prives C.
2003. Nucleotide binding by the Mdm2 RING domain facilitates Arf-independent Mdm2
nucleolar localization. Mol Cell 12: 875-887.
117
Poyurovsky MV, Priest C, Kentsis A, Borden KL, Pan ZQ, Pavletich N, Prives C. 2007. The
Mdm2 RING domain C-terminus is required for supramolecular assembly and ubiquitin
ligase activity. EMBO J 26: 90-101.
Priest C, Prives C, Poyurovsky MV. 2010. Deconstructing nucleotide binding activity of the
Mdm2 RING domain. Nucleic Acids Res 38: 7587-7598.
Rallapalli R, Strachan G, Cho B, Mercer WE, Hall DJ. 1999. A novel MDMX transcript
expressed in a variety of transformed cell lines encodes a truncated protein with potent
p53 repressive activity. J Biol Chem 274: 8299-8308.
Rallapalli R, Strachan G, Tuan RS, Hall DJ. 2003. Identification of a domain within MDMX-S
that is responsible for its high affinity interaction with p53 and high-level expression in
mammalian cells. Journal of cellular biochemistry 89: 563-575.
Ramos YF, Stad R, Attema J, Peltenburg LT, van der Eb AJ, Jochemsen AG. 2001. Aberrant
expression of HDMX proteins in tumor cells correlates with wild-type p53. Cancer Res
61: 1839-1842.
Rayburn E, Zhang R, He J, Wang H. 2005. MDM2 and human malignancies: expression, clinical
pathology, prognostic markers, and implications for chemotherapy. Current cancer drug
targets 5: 27-41.
Reiner A, Neumeister B, Spona J, Reiner G, Schemper M, Jakesz R. 1990. Immunocytochemical
localization of estrogen and progesterone receptor and prognosis in human primary breast
cancer. Cancer Res 50: 7057-7061.
Riccardo Bennet-Lovsey SEH, Hiroki Shirai, Kenji Mizuguchi. 2002. The SWIB and the Mdm2
domains are homologous and share a common fold. Bioinformatics Discovery Note Vol
18: 626-630.
118
Rieske P, Bartkowiak JK, Szadowska AM, Olborski B, Harezga-Bal B, Debiec-Rychter M.
1999. A comparative study of P53/MDM2 genes alterations and P53/MDM2 proteins
immunoreactivity in soft-tissue sarcomas. Journal of experimental & clinical cancer
research : CR 18: 403-416.
Robison JG, Lu L, Dixon K, Bissler JJ. 2005. DNA lesion-specific co-localization of the
Mre11/Rad50/Nbs1 (MRN) complex and replication protein A (RPA) to repair foci. J
Biol Chem 280: 12927-12934.
Rodriguez-Lopez AM, Xenaki D, Eden TO, Hickman JA, Chresta CM. 2001. MDM2 mediated
nuclear exclusion of p53 attenuates etoposide-induced apoptosis in neuroblastoma cells.
Molecular pharmacology 59: 135-143.
Rossi R, Lidonnici MR, Soza S, Biamonti G, Montecucco A. 2006. The dispersal of replication
proteins after Etoposide treatment requires the cooperation of Nbs1 with the ataxia
telangiectasia Rad3-related/Chk1 pathway. Cancer Res 66: 1675-1683.
Roth J, Dobbelstein M, Freedman D, Shenk T, Levine A. 1998. Nucleo-cytoplasmic shuttling of
the hdm2 oncoprotein regulates the levels of the p53 protein via a pathway used by the
human immunodeficiency virus rev protein. EMBO J 17: 554-564.
Rotterud R, Berner A, Holm R, Skovlund E, Fossa SD. 2001. p53, p21 and mdm2 expression vs
the response to radiotherapy in transitional cell carcinoma of the bladder. BJU Int 88:
202-208.
Sabbatini P, McCormick F. 2002. MDMX inhibits the p300/CBP-mediated acetylation of p53.
DNA and cell biology 21: 519-525.
119
Sánchez-Aguilera A, García J, Sánchez-Beato M, Piris M. 2006. Hodgkin's lymphoma cells
express alternatively spliced forms of HDM2 with multiple effects on cell cycle control.
Oncogene 25: 2565-2574.
Santos-Rosa H, Caldas C. 2005. Chromatin modifier enzymes, the histone code and cancer.
European journal of cancer 41: 2381-2402.
Saunders A, Werner J, Andrulis ED, Nakayama T, Hirose S, Reinberg D, Lis JT. 2003. Tracking
FACT and the RNA polymerase II elongation complex through chromatin in vivo.
Science 301: 1094-1096.
Sawarkar R, Sievers C, Paro R. 2012. Hsp90 globally targets paused RNA polymerase to
regulate gene expression in response to environmental stimuli. Cell 149: 807-818.
Schwabish MA, Struhl K. 2004. Evidence for eviction and rapid deposition of histones upon
transcriptional elongation by RNA polymerase II. Mol Cell Biol 24: 10111-10117.
-. 2007. The Swi/Snf complex is important for histone eviction during transcriptional activation
and RNA polymerase II elongation in vivo. Mol Cell Biol 27: 6987-6995.
Shadfan M, Lopez-Pajares V, Yuan ZM. 2012. MDM2 and MDMX: Alone and together in
regulation of p53. Translational cancer research 1: 88-89.
Sharp DA, Kratowicz SA, Sank MJ, George DL. 1999. Stabilization of the MDM2 oncoprotein
by interaction with the structurally related MDMX protein. J Biol Chem 274: 3818938196.
Shinobu N, Maeda T, Aso T, Ito T, Kondo T, Koike K, Hatakeyama M. 1999. Physical
interaction and functional antagonism between the RNA polymerase II elongation factor
ELL and p53. J Biol Chem 274: 17003-17010.
120
Shvarts A, Bazuine M, Dekker P, Ramos YF, Steegenga WT, Merckx G, van Ham RC, van der
Houven van Oordt W, van der Eb AJ, Jochemsen AG. 1997. Isolation and identification
of the human homolog of a new p53-binding protein, Mdmx. Genomics 43: 34-42.
Shvarts A, Steegenga WT, Riteco N, van Laar T, Dekker P, Bazuine M, van Ham RC, van der
Houven van Oordt W, Hateboer G, van der Eb AJ et al. 1996. MDMX: a novel p53binding protein with some functional properties of MDM2. EMBO J 15: 5349-5357.
Sigalas I, Calvert AH, Anderson JJ, Neal DE, Lunec J. 1996. Alternatively spliced mdm2
transcripts with loss of p53 binding domain sequences: transforming ability and frequent
detection in human cancer. Nat Med 2: 912-917.
Siliciano JD, Canman CE, Taya Y, Sakaguchi K, Appella E, Kastan MB. 1997. DNA damage
induces phosphorylation of the amino terminus of p53. Genes Dev 11: 3471-3481.
Sims Rr, Belotserkovskaya R, Reinberg D. 2004. Elongation by RNA polymerase II: the short
and long of it. Genes Dev 18: 2437-2468.
Slack A, Lozano G, Shohet JM. 2005. MDM2 as MYCN transcriptional target: implications for
neuroblastoma pathogenesis. Cancer letters 228: 21-27.
Smith E, Shilatifard A. 2013. Transcriptional elongation checkpoint control in development and
disease. Genes Dev 27: 1079-1088.
Sobell HM. 1985. Actinomycin and DNA transcription. Proc Natl Acad Sci U S A 82: 53285331.
Somesh BP, Reid J, Liu WF, Sogaard TM, Erdjument-Bromage H, Tempst P, Svejstrup JQ.
2005. Multiple mechanisms confining RNA polymerase II ubiquitylation to polymerases
undergoing transcriptional arrest. Cell 121: 913-923.
121
Somesh BP, Sigurdsson S, Saeki H, Erdjument-Bromage H, Tempst P, Svejstrup JQ. 2007.
Communication between distant sites in RNA polymerase II through ubiquitylation
factors and the polymerase CTD. Cell 129: 57-68.
Stellrecht CM, Chen LS. 2011. Transcription inhibition as a therapeutic target for cancer.
Cancers 3: 4170-4190.
Stellrecht CM, Rodriguez CO, Jr., Ayres M, Gandhi V. 2003. RNA-directed actions of 8-chloroadenosine in multiple myeloma cells. Cancer Res 63: 7968-7974.
Strahl BD, Allis CD. 2000. The language of covalent histone modifications. Nature 403: 41-45.
Sun XJ, Wei J, Wu XY, Hu M, Wang L, Wang HH, Zhang QH, Chen SJ, Huang QH, Chen Z.
2005. Identification and characterization of a novel human histone H3 lysine 36-specific
methyltransferase. J Biol Chem 280: 35261-35271.
Suzuki A, Toi M, Yamamoto Y, Saji S, Muta M, Tominaga T. 1998. Role of MDM2
overexpression in doxorubicin resistance of breast carcinoma. Japanese journal of cancer
research : Gann 89: 221-227.
Svejstrup JQ. 2003. Rescue of arrested RNA polymerase II complexes. J Cell Sci 116: 447-451.
Tang Y, Zhao W, Chen Y, Zhao Y, Gu W. 2008. Acetylation is indispensable for p53 activation.
Cell 133: 612-626.
Tanimura S, Ohtsuka S, Mitsui K, Shirouzu K, Yoshimura A, Ohtsubo M. 1999. MDM2
interacts with MDMX through their RING finger domains. FEBS Lett 447: 5-9.
Taubert H, Koehler T, Meye A, Bartel F, Lautenschlager C, Borchert S, Bache M, Schmidt H,
Wurl P. 2000. mdm2 mRNA level is a prognostic factor in soft tissue sarcoma. Molecular
medicine 6: 50-59.
122
Taubert H, Schuster K, Brinck U, Bartel F, Kappler M, Lautenschlager C, Bache M, Trump C,
Schmidt H, Holzhausen HJ et al. 2003. Loss of heterozygosity at 12q14-15 often occurs
in stage I soft tissue sarcomas and is associated with MDM2 amplification in tumors at
various stages. Modern pathology : an official journal of the United States and Canadian
Academy of Pathology, Inc 16: 1109-1116.
Taylor AC, Shu L, Danks MK, Poquette CA, Shetty S, Thayer MJ, Houghton PJ, Harris LC.
2000. P53 mutation and MDM2 amplification frequency in pediatric rhabdomyosarcoma
tumors and cell lines. Medical and pediatric oncology 35: 96-103.
Thiriet C, Hayes JJ. 2006. Histone dynamics during transcription: exchange of H2A/H2B dimers
and H3/H4 tetramers during pol II elongation. Results and problems in cell differentiation
41: 77-90.
Thut C, Goodrich J, Tjian R. 1997. Repression of p53-mediated transcription by MDM2: a dual
mechanism. Genes Dev 11: 1974-1986.
Thut CJ, Chen JL, Klemm R, Tjian R. 1995. p53 transcriptional activation mediated by
coactivators TAFII40 and TAFII60. Science 267: 100-104.
Tovar C, Graves B, Packman K, Filipovic Z, Higgins B, Xia M, Tardell C, Garrido R, Lee E,
Kolinsky K et al. 2013. MDM2 small-molecule antagonist RG7112 activates p53
signaling and regresses human tumors in preclinical cancer models. Cancer Res 73:
2587-2597.
Tovar C, Rosinski J, Filipovic Z, Higgins B, Kolinsky K, Hilton H, Zhao X, Vu BT, Qing W,
Packman K et al. 2006. Small-molecule MDM2 antagonists reveal aberrant p53 signaling
in cancer: implications for therapy. Proc Natl Acad Sci U S A 103: 1888-1893.
123
Turbin DA, Cheang MC, Bajdik CD, Gelmon KA, Yorida E, De Luca A, Nielsen TO, Huntsman
DG, Gilks CB. 2006. MDM2 protein expression is a negative prognostic marker in breast
carcinoma. Modern pathology : an official journal of the United States and Canadian
Academy of Pathology, Inc 19: 69-74.
Unger T, Juven-Gershon T, Moallem E, Berger M, Vogt Sionov R, Lozano G, Oren M, Haupt Y.
1999. Critical role for Ser20 of human p53 in the negative regulation of p53 by Mdm2.
EMBO J 18: 1805-1814.
van Leeuwen IM, Higgins M, Campbell J, Brown CJ, McCarthy AR, Pirrie L, Westwood NJ,
Lain S. 2011. Mechanism-specific signatures for small-molecule p53 activators. Cell
Cycle 10: 1590-1598.
Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, Kong N, Kammlott U,
Lukacs C, Klein C et al. 2004. In vivo activation of the p53 pathway by small-molecule
antagonists of MDM2. Science 303: 844-848.
Venot C, Maratrat M, Dureuil C, Conseiller E, Bracco L, Debussche L. 1998. The requirement
for the p53 proline-rich functional domain for mediation of apoptosis is correlated with
specific PIG3 gene transactivation and with transcriptional repression. EMBO J 17: 46684679.
Vogelstein B, Lane D, Levine A. 2000. Surfing the p53 network. Nature 408: 307-310.
Vousden KH. 2002. Activation of the p53 tumor suppressor protein. Biochimica et biophysica
acta 1602: 47-59.
Vousden KH, Lane DP. 2007. p53 in health and disease. Nat Rev Mol Cell Biol 8: 275-283.
124
Vu B, Wovkulich P, Pizzolato G, Lovey A, Ding Q, Jiang N, Liu JJ, Zhao C, Glenn K, Wen Y et
al. 2013. Discovery of RG7112: A Small-Molecule MDM2 Inhibitor in Clinical
Development. ACS medicinal chemistry letters 4: 466-469.
Vu BT, Vassilev L. 2011. Small-molecule inhibitors of the p53-MDM2 interaction. Current
topics in microbiology and immunology 348: 151-172.
Wade M, Wang YV, Wahl GM. 2010. The p53 orchestra: Mdm2 and Mdmx set the tone. Trends
in cell biology 20: 299-309.
Walker KK, Levine AJ. 1996. Identification of a novel p53 functional domain that is necessary
for efficient growth suppression. Proc Natl Acad Sci U S A 93: 15335-15340.
Wang C, Ivanov A, Chen L, Fredericks WJ, Seto E, Rauscher FJ, 3rd, Chen J. 2005. MDM2
interaction with nuclear corepressor KAP1 contributes to p53 inactivation. EMBO J 24:
3279-3290.
Wang P, Reed M, Wang Y, Mayr G, Stenger JE, Anderson ME, Schwedes JF, Tegtmeyer P.
1994. p53 domains: structure, oligomerization, and transformation. Mol Cell Biol 14:
5182-5191.
Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T, Shahab A, Yong HC, Fu Y, Weng Z et al.
2006. A global map of p53 transcription-factor binding sites in the human genome. Cell
124: 207-219.
Weinberg RL, Freund SM, Veprintsev DB, Bycroft M, Fersht AR. 2004. Regulation of DNA
binding of p53 by its C-terminal domain. J Mol Biol 342: 801-811.
Weng M, Lai J, Hsu C, Yu K, Chen C, Lin T, Lai W, Lee H, Ko J. 2005. Alternative splicing of
MDM2 mRNA in lung carcinomas and lung cell lines. Environ Mol Mutagen 46: 1-11.
125
White D, Talbott K, Arva N, Bargonetti J. 2006. Mouse double minute 2 associates with
chromatin in the presence of p53 and is released to facilitate activation of transcription.
Cancer Res 66: 3463-3470.
Wilson MD, Harreman M, Svejstrup JQ. 2013. Ubiquitylation and degradation of elongating
RNA polymerase II: the last resort. Biochimica et biophysica acta 1829: 151-157.
Woods D, Turchi JJ. 2013. Chemotherapy induced DNA damage response: convergence of drugs
and pathways. Cancer biology & therapy 14: 379-389.
Workman JL. 2006. Nucleosome displacement in transcription. Genes Dev 20: 2009-2017.
Wu X, Bayle J, Olson D, Levine A. 1993. The p53-mdm-2 autoregulatory feedback loop. Genes
Dev 7: 1126-1132.
Wurl P, Meye A, Berger D, Bache M, Lautenschlager C, Schmidt H, Kalthoff H, Rath FW,
Taubert H. 1997. Prognostic relevance of C-terminal Mdm2 detection is enhanced by p53
positivity in soft tissue sarcomas. Diagn Mol Pathol 6: 249-254.
Xiao G, White D, Bargonetti J. 1998. p53 binds to a constitutively nucleosome free region of the
mdm2 gene. Oncogene 16: 1171-1181.
Xie P, Tian C, An L, Nie J, Lu K, Xing G, Zhang L, He F. 2008. Histone methyltransferase
protein SETD2 interacts with p53 and selectively regulates its downstream genes. Cell
Signal 20: 1671-1678.
Xin H, Takahata S, Blanksma M, McCullough L, Stillman DJ, Formosa T. 2009. yFACT induces
global accessibility of nucleosomal DNA without H2A-H2B displacement. Mol Cell 35:
365-376.
126
Xing J, Sheppard HM, Corneillie SI, Liu X. 2001. p53 Stimulates TFIID-TFIIA-promoter
complex assembly, and p53-T antigen complex inhibits TATA binding protein-TATA
interaction. Mol Cell Biol 21: 3652-3661.
Xu C, Fan CD, Wang X. 2015. Regulation of Mdm2 protein stability and the p53 response by
NEDD4-1 E3 ligase. Oncogene 34: 281-289.
Xu XL, Fang Y, Lee TC, Forrest D, Gregory-Evans C, Almeida D, Liu A, Jhanwar SC,
Abramson DH, Cobrinik D. 2009. Retinoblastoma has properties of a cone precursor
tumor and depends upon cone-specific MDM2 signaling. Cell 137: 1018-1031.
Yakovleva T, Pramanik A, Kawasaki T, Tan-No K, Gileva I, Lindegren H, Langel U, Ekstrom
TJ, Rigler R, Terenius L et al. 2001. p53 Latency. C-terminal domain prevents binding of
p53 core to target but not to nonspecific DNA sequences. J Biol Chem 276: 15650-15658.
Zauberman A, Flusberg D, Haupt Y, Barak Y, Oren M. 1995. A functional p53-responsive
intronic promoter is contained within the human mdm2 gene. Nucleic Acids Res 23:
2584-2592.
Zhang K, Dent SY. 2005. Histone modifying enzymes and cancer: going beyond histones.
Journal of cellular biochemistry 96: 1137-1148.
Zhang Y, Wang J, Yuan Y, Zhang W, Guan W, Wu Z, Jin C, Chen H, Zhang L, Yang X et al.
2010. Negative regulation of HDM2 to attenuate p53 degradation by ribosomal protein
L26. Nucleic Acids Res 38: 6544-6554.
Zhou M, Gu L, Abshire TC, Homans A, Billett AL, Yeager AM, Findley HW. 2000. Incidence
and prognostic significance of MDM2 oncoprotein overexpression in relapsed childhood
acute lymphoblastic leukemia. Leukemia 14: 61-67.
127
Zietz C, Rossle M, Haas C, Sendelhofert A, Hirschmann A, Sturzl M, Lohrs U. 1998. MDM-2
oncoprotein overexpression, p53 gene mutation, and VEGF up-regulation in
angiosarcomas. The American journal of pathology 153: 1425-1433.
Zuckerman V, Lenos K, Popowicz GM, Silberman I, Grossman T, Marine JC, Holak TA,
Jochemsen AG, Haupt Y. 2009. c-Abl phosphorylates Hdmx and regulates its interaction
with p53. J Biol Chem 284: 4031-4039.
128