ICANCER RESEARCH 53. 140.1-1408. March 15. 1993)
High-Level Expression of the Ribosomal Protein L19 in Human Breast T\imors That
Overexpress erbB-21
John L. Henry, David L. Coggin, and C. Richter King2
Oncogene Resetm-lì,Molecular Oncoln$\. Inc., Gailher.\hitrf>. Mary-land 2087X
ABSTRACT
MATERIALS
The erbK-2 (or III K-2 or neu i gene is amplified and overexpressed in
approximately one-third of cancers of the breast, stomach, and ovary.
Evidence is accumulating that erbK-2 overexpression is associated with
Screening of a Human Breast Cancer Cell Line cDNA Library by
Plus/Minus Hybridization. A MCF-7 Agt 10 cDNA library (a gift of Dr. Fran
Kern, Georgetown University) was screened by plating approximately 8(KX)
phage/plate with competent C600 cells. Triplicate plaque litis onto nitrocellu
lose were made and denatured by successive wettings in 0.5 M NaOH, 0.5 M
NaOH, 1.5 MNaCI, 0.5 MTris-HCI (pH 7.5), 0.5 MTris-HCI (pH 7.5). and 1.5
MNaCI. Each of the plaque lifts were hyhridi/.ed with a "P-labeled total cDNA
decreased survival of breast cancer patients. In an effort to understand
how erbß-2overexpression might impart a more malignant potential to
breast cancer cells, we have searched for evidence of changes in gene
expression associated with erbß-2 overexpression.
Using differential
probe from either the SK-BR-3, MDA-MB-468, or MCF-7 cells.
Cell Lines and Tissue Culture. Human breast cancer cell lines SK-BR-3,
T47D. MCF-7. BT474, BT20, MDA-MB-468. MDA-MB-2.11. and HBL-100
screening of a complementary DNA library we identified several comple
mentary DNAs that represent mRNAs the expression of which may vary
according to erbß-2level. One complementary DNA was studied in detail.
The mRNA encoding the ribosomal protein I.I') (1.9 kilobases) was more
abundant in breast cancer samples that express high levels of erbß-2
(P < 6 X 10~7). The level of IA9 mRNA expression varied over a 1- to
64-fold range among the tumor samples. No evidence of gene amplification
for I.I') was identified. The 1.19 overexpression in these breast tumor
samples was not associated with the increased expression of the mRNAs
for other ribosomal proteins (SI6 and L26).
INTRODUCTION
Three lines of evidence suggest that overexpression of the erbB-2
gene contributes to the malignancy of breast cancer cells. First, the
close similarity of the protein structure to the EOF' receptor indicates
a function in control of growth or differentiation (1-3). Second, arti
ficially induced erbB-2 overexpression can transform fibroblasts
(N1H/3T3) (4, 5). Third, and most important, many studies have
linked erbB-2 gene amplification or overexpression with poor patient
prognosis (6-10; reviewed in Refs. 11 and 12). Estimations for the
magnitude of this effect have been as high as a 5-fold increase in risk
of death in some patient groups (9). There is not yet a mechanisticunderstanding of the increased malignancy of breast cancers that
overexpress erbB-2. Clinical evidence has been reported that erbB-2
overexpression may effect either the response of cells to chemother
apy or the division rate (12).
In this study we attempted to determine if erbB-2 overexpression
alters cells qualitatively as evidenced by measurable changes in gene
expression. We used techniques designed to identify mRNAs the level
of which is consistently altered in association with erbB-2 overex
pression. Candidate cDNA clones were identified by differential
plaque hybridization. Differential expression of mRNA was then con
firmed by analysis of breast cell lines and primary tumors. One cDNA
clone identified in this way indicates that the mRNA for ribosomal
protein L19 has dramatically different expression in tumors that overexpress erbB-2. This expression pattern is not associated with a gen
eral increase in expression of mRNAs for other ribosomal proteins.
Received 10/16/92; accepted 1/11/9.1.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore he hereby marked advertisement in accordance with
18 U.S.C. Section 17.14 solely to indicate this fact.
1 Supported in part by Molecular Oncology. Inc. Also supported by NIH Grant
R44CA508I1.
: To whom requests for reprints should be addressed, at Oncogene Research, Molecular
Oncology, Inc., 19 Firslfield Rd.. Gaithersburg. MD 20878.
1The abbreviations used are: EGF. epidemial growth factor; cDNA. complementary
DNA; SSC. standard saline citrate (15 mw sodium citrate. 150 min NaCI. pH 7.2).
AND METHODS
were obtained from the American Type Culture Collection. Cells were grown
in Dulbecco's modified Eagle's medium (Gibco) with 5% fetal bovine serum
(Gibco), and the medium was changed every 2 days.
Tissue Specimens. Archival fro/en breast cancer tissue samples with pre
viously determined diagnostic and prognostic parameters were obtained from
the Molecular Oncology, Inc., Tumor Repository.
RNA Isolation from Tissue Samples and Cultured Cells. Total RNA was
isolated from tissue samples and cultured cells by a modified Chigwin method
(13). Fro/en tumor samples were lyophili/.ed for 12 h and then ground to a fine
powder with a mortar and pestle. The ground tumor powders or culture cell
pellets were soluhili/.ed in 4 Mguanidine isothiocyanate, 0.5% sodium Sarkosyl, 5 mm sodium citrate (pH 7). and 0.1 M ß-mercaptoethanol by homogenization in a Polytron. CsCI was added to 0.25% (w/v), mixed, and layered on
a 5.7 M CsCI cushion containing 5 ITIMEDTA and \c/r sodium Sarkosyl and
centrifuged at 1(X),000 X g for >16 h. The RNA band was recovered by
ethanol precipitation. The RNA pellet was resuspended in K) IHMTris-HCI (pH
7.5), 5 mm EDTA. and 19!- sodium Sarkosyl. extracted with CHCl,:isobutyl
alcohol (4:1), and then precipitated with ethanol. Polyadenylated RNA was
isolated by incubation with oligodeoxythymidine cellulose.
Northern Blot Analysis. Total RNA (5 ug) isolated from tumor samples or
cultured cells was denatured in 2.2 M formaldehyde at 65°Cfor 5 min and
electrophoresed in a 1% agarose gel containing 0.66 M formaldehyde. Com
parison of the total RNA loaded per well and the integrity of the RNA were
visuali/ed by ethidium bromide staining of the 28S and 1XS rRNA in the gel.
The gel was soaked in 50 HIMNaOH, 10 HIMNaCI followed by l Mammonium
acetate and then transferred to a ZetaProhe nylon filter (Bio-Rad) in I M
ammonium acetate and cross-linked lo the filler by exposure to 0.3 J/cm2 of
312-nm UV radiation in a BiosLink (Bios Corp.).
Dot-Blot Analysis. The total RNA samples were denatured in 50 ITIM
NaOH. 1.5 MNaCI and then neutrali/ed with I Mammonium acetate. Approx
imately 2 ug of each sample were serially diluted 2-fold in I M ammonium
acetate with transfer RNA added to maintain constant total RNA concentration
and then vaccum filtered onto ZetaProbe nylon filters in a dot-blot manifold.
The RNA was cross-linked to the filter as described above. The dot-blot
quanlilation of the various experimental mRNA levels was normali/ed by
hyhridi/ing the same blots with a /3-actin cDNA probe. The hybridi/alion
intensities of the various experimental probes were then compared to that of the
ß-aclinprobe al their different dilution levels, and their expression ratios were
determined (14).
Polymerase Chain Reaction and Cloning of the Isolated Library Se
quences. The cDNA portions of recombinanl phage were isolated by polymerase chain reaction ( 15) using primers adjacent to the 3' and 5' cloning sites.
The insert (—690 base pairs) was then used as a hybridisation probe for the
initial screening of breast cell lines by Northern blot analysis. The Llu cDNA
insert was isolated by EcuRi digestion of a Agi 10 phage DNA preparalion.
band purified, and then cloned into pUC 18 or M13 RF at the Eci>R\ cloning site
for sequencing.
Probes and Hybridizations. cDNA probes used to screen the cDNA li
brary plaques were made by reverse transcription of polyadenylaled RNA
isolated from the SK-BR-3, MDA-MB-468. or MCF-7 cell lines in the pres-
1403
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
L19 IN HUMAN
enee of ['2P]dCTP (Amersham).
BREAST TUMORS THAT OVEREXPRESS erbB-2
The SI6 and L26 probes (a gift of Dr. Ira
co iCD CO
Wool. University of Chicago) as well as the erhB-2 and /3-actin probes were
labeled by random prime polymerization (Pharmacia) of their complete cDNA
sequence in the presence of [ '-P]dCTP. The isolated library cDNA inserts were
labeled by random priming with [ <2P)dCTP as probes for the cell line Northern
CO OD OD
blot and tumor sample dot blots.
Probe hybridization was conducted at 42°Cin 50% formamide, 5x SSC,
5x Denhardt's solution. 10% dextran sulfate, and 0.5% sodium dodecyl sulfate
CQ I
PROBE:
with 250 ug/ml salmon sperm DNA. Blots were washed at 54°Cwith two
15-min washes of 2X SSC, then 0.2X SSC 0.1% sodium dodecyl sulfate, and
L19
1.9kb
erbB-2
•¿5.0
kb
finally 0.2X SSC. Successive probe hybridizations were accomplished by
stripping the blot at 65°Cin 50% formamide. lOx SSC, and 10 m.\i sodium
pyrophosphate
(pH 7.2), verified by 24-h autoradiographic
m < <
¿00
co S S
exposure.
DNA Sequencing and Analysis. The isolated cDNA inserts subcloned into
pUCI8 and MI3 vectors (BRL-Gibco) were sequenced in the 5' and 3' direc
tions by the dideoxynucleotide chain termination method ( 16) using Sequenase
2.0 (U.S. Biochemicals).
Statistical Analysis. Correlations between the L19 relative expression lev
els and various prognostic factors were evaluated by performing the x2 con
tingency table analysis where appropriate. Fisher's exact test was performed
when the assumptions of the \2 analysis were violated.
ß-Actin
RESULTS
Identification of cDNAs Cooverexpressed with erbB-2. A twostep approach was devised to identity cDNA clones corresponding to
mRNAs the expression levels of which vary significantly in breast
cancers with erbB-2 overexpression. First, a MCF-7 AgtlO cDNA
library was screened by comparing the hybridization intensity for a
given phage when replicate filters were exposed to different probes.
These radioactive probes were prepared as total cDNA from the polyadenylated RNA of a cell line with high levels of erbB-2 mRNA
(SK-BR-3) and one with low levels of erbB-2 mRNA (MCF-7). These
total cDNA probes thus represent mixed radioactive DNAs corre
sponding to all mRNAs within the cell line. The relative amount of
each radioactive sequence will approximately reflect the contribution
of the corresponding mRNA in the cell. Thus relatively abundant
mRNAs will determine a relatively intense hybridization signal to
their corresponding cDNA alone. In the initial screening of 80.000
phage plaques, 388 discrete plaques exhibited distinct hybridization
intensity differences when the SK-BR-3 and the MCF-7 probes were
compared. A second screening of these 388 candidates was conducted
by picking each into an array. This allowed for a more quantitative
comparison of the hybridization signal intensity for each candidate
phage. Eleven clones were confirmed to show distinctly differential
hybridization when the SK-BR-3 to MCF-7 probes were compared.
The cDNA inserts from these recombinant phage were isolated by
polymerase chain reaction.
In the second step of our isolation approach, these cDNAs were
used to determine in several cell lines whether the expression of the
corresponding mRNA varied consistently with erhB-2 levels. Total
RNA samples from eight human breast cancer cell lines that overex-
2.0 kb
Fig. I. Northern blot of human breast cancer cell lines. Northern blot analysis using 5
Mgtotal RNA from human breast cancer cell lines. Top. blot hybridized with the isolated
LI9 cDNA (1.9-kiloba.se) probe. Middle, blot hybridized with the erbB-2 cDNA (5.0kilobase) probe. Bottom, blot hybridized with the ß-aclincDNA (2.0-kilobase) probe. The
same blot filter was used for each hybridization. The figure is a composite generated from
a single autoradiographic exposure for each probe.
press either erbB-2 or EOF receptor, or express low levels of both of
these genes (14, 17) were used in Northern blot hybridization exper
iments using each candidate cDNA insert. Control blots of the same
RNA samples were hybridized with a ß-actinor erbB-2 probe to allow
comparison of the amount of each RNA sample on the blot and to
confirm the erbB-2 expression status of each cell line (Fig. I). One
candidate cDNA clone (later identified as ribosomal protein L19
DNA; see below) detected a strong RNA band at 1.9 kilobases in all
three cell lines (SK-BR-3, BT474, T47D) that overexpress erbB-2 (5
kilobases), as well as one (MDA-MB-231) of the two cell lines that
overexpress EGF receptor. Much lower hybridization signals were
detected in the control cell lines (MCF-7, HBL-IOO) that have low
erbB-2 levels. These results suggested to us a relationship between the
LI9 mRNA level and erbB-2 overexpression.
In order to quantitatively compare the expression of the L19 clone
to erbB-2 levels, dot-blot analysis was carried out on these same
samples, and the amount of loaded mRNA was normalized by a
comparative hybridization with a ß-actinprobe. As shown in Table 1,
the breast cancer cell lines that express the highest levels of erbB-2
(-128) also express the highest L19 mRNA levels (-64). Cell lines
Table 1 LIV. erbB-2. ami ECFR expression und gene amplification levels in human breast cancer cell lines
Relative expression in L19 in human breast cancer cell lines normalized to their ß-actinexpression determined by dot-blot analysis.
Cell line
(reference)"SK-BR-3
(14)BT474U4)MDA-MB-453
(14)T47D
study)MDA-MB-468(I4)MDA-MB-231
(current
mRNA
mRNA
expression
level646464824221erhB-2
expression
amplification128
level
4-8128
4-864
216EGF
erbB-2 gene
receptor mRNA
expression
level11_
gene
amplification111ND32+4-811
bND
'32•f1611EGFR
study)BT20U4)HBL-IOO
(Ref. 17 and current
(14)MCF-7
(14)LI9
The erbB-2 and epidermal growth factor receptor mRNA and gene amplification levels where determined by Kraus et al. ( 14), Hynes et al. ( 17), or the current study.
* -, No evident expression.
' ND. Not determined.
1404
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
L19 IN HUMAN
BREAST TUMORS THAT OVERKXPRKSS erhB-2
that express an intermediate level of erbB-2 (>8) also express ele
vated L19 levels (>4). The cell lines that do not overexpress erbB-2
express low levels of L19. Through the two-tier screening procedure
L19 displayed the most dramatic differences in expression of the
candidate cDNA clones. For this reason, L19 is the focus of this study.
Other candidate cDNAs were isolated. These may represent mRNAs
the expression of which also varies according to erbB-2 levels, sug
gesting that gene expression alterations associated with erbB-2 overexpression may be complex. Somewhat surprisingly, none of the final
four clones examined represented the erbB-2 mRNA. It is therefore
likely that additional sequences exist that have very different expres
sion levels between the MCF-7 cell line and the SK-BR-3 cell line.
DNA Sequence Determination of Human L19 Clone. The cDNA
insert of the clone was subcloned into the pUC 18 and M13 vectors and
found to be 690 base pairs long (including the polyadenylated tail), by
dideoxy nucleotide sequencing. A computer search of the Genebank
DNA database found 87% and 84% homology with the rat and mouse
ribosomal protein L19 cDNA sequences, respectively. The computer
program generated protein translation of the L19 sequence gave a
protein sequence of 196 amino acids that had 100% identity to the rat
L19 protein sequence (18) of 196 amino acids (Fig. 2). These data
indicated that we had isolated a cDNA copy of the human L19 mRNA
on the basis of its differential expression.
gggccgcagccATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTCTAGT
---- .---- + ---- .---- + ---- .---- + ---- .---- + ---- .---- +
m lrlqkrlass
m
50
GTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGACCCCAATGAGACCAA
100
---- .---- + ---- .---- +---- .---- + ---- .---- + ---- .---- +
n
n
vl
rcgkkkvwldp
kkvwld
TGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAG
---_---- + --->---- + ---_ ---- + ---. ---- + ---. ----
150
+
eianansrqqirklikd
ATGGGCTGATCATCCGCAAGCCTGTGACGGTCCATTCCCGGGCTCGATGC
----
t -----
1-----
. -----
1-----
t ----
4-----
t ----
4-----
. -----
100
K
gliirkpvtvhsrarc
CGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACATGGGCATAGGTAA
---- .--- _+ --- _ ._„-+---- p---- + ---- .---- + ---- .---- +
rkntlarrkgrhmgigk
250
GCGGAAGGGTACAGCCAATGCCCGAATGCCAGAGAAGGTCACATGGATGA
---- .---- + ---- .---- + ---- .---- + ---- .---- + ---- .---- +
300
rkgtanarnpekvtwmr
GGAGAATGAGGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAG
m
350
ilrrllrryresk
AAGATCGATCGCCACATGTATCACAGCCTGTACCTGAAGGTGAAGGGGAA
---- .---- + ---- .---- + ---- .---- + ---- .---- + ---- .---- +
kidrhmyhslylkvkgn
400
TGTGTTCAAAAACAAGCGGATTCTCATGGAACACATCCACAAGCTGAAGG
450
fk
n
hklk
CAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGG
---- .---- + ---- .---- + ---- .---- + ---- .---- + ---- .---- +
500
dkarkklladqaearr
TCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGCCTCCAGGCCAA
---- .---- + ---- .---- + ---- .---- + ---- .----- 1----- .---- +
550
sktkearkrreerlqak
12
IE
24
RELATIVE EXPRESSION LEVEL
Fig. 3. Frequency distribution of L19 expression levels inhuman breast tumor samples.
The mRNA levels of the human breast tumor samples were determined by dot-blot
analysis and normali/ed to their ß-actinmRNA levels. The distribution of the various
expression levels suggests two families of LI9 expression, a low-expressing group (<8)
and a high-expressing group (>8).
L19 Expression Level in Human Breast Tumor Samples. We
next attempted to determine if the coincidence of high-level expres
sion of L19 and erbB-2 also occurs in primary human breast cancers.
Quantitative determination of L19 and erbB-2 expression levels was
accomplished by dot-blot analysis on total RNA from the tumor
samples. The samples were judged by histological evaluation to con
tain an average of 43% tumor cells (SE = 3.1). Hybridization intensity
using probes for L19 or erbB-2 was determined and normalized to
ß-actinhybridization signal intensity as previously described. Total
RNA from the SK-BR-3, T47D, and MCF-7 cell lines were used as
high-, medium-, and low-expression level controls on each blot. As
shown in Fig. 3, relative expression levels of L19 in the tumor samples
varied from 1 to 64, while the SK-BR-3, T47D, and MCF-7 controls
gave 128, 16, and 2 values, respectively. For these experiments the
lowest hybridization intensity was arbitrarily assigned the value of 1.
Based on these results the tumor samples were divided into two
groups according to their L19 expression levels determined by the
population distribution of these samples. The low group had LI9
relative expression values of <8, while the high group had relative
expression values of >8 and comprised 18 of 54 of the sample
population. These groups were analyzed for the association of highlevel L19 expression with available clinical information for each
tumor. These included estrogen receptor status, progesterone receptor
status, nuclear and histological grading, Ki-67 values, node status,
tumor size, and erbB-2 expression levels (Table 2). The expression
level for erbB-2 mRNA was measured and varied from 1 to 64, as
previously reported (19). High-level L19 mRNA expression was very
closely associated with the erbB-2 mRNA levels (P < 6 X 10~7; Fig.
4). This strong association confirms the predictions of our screening
approach and suggests that L19 gene expression may be caused by
overexpression of erbB-2. Comparison of L19 expression found a
possible association to the excised tumor size (P < 0.03 by \2 anal
ysis). No statistical relationship between L19 expression and either
estrogen receptor or progesterone receptor histological or nuclear
grade or lymph node status was observed. In the case of lymph node
AAaacctcccactttgtctgtacatactggcctctgtgattacatagatc
650
status, the number of samples for which relevant diagnostic informa
---. ---4----. ---+ ---f ----1----t ----1----t ----1
tion was available makes a conclusion difficult. Unfortunately, no
agccattaaaataaaacaagccttaaaaaaaaaaaaaacc
690
follow-up information was available for these patients.
---- .---- + ---- .---- + ---- .---- + ---- .---- +
Since L19 is a ribosomal protein, we reasoned that high-level
Fig. 2. DNA and amino acid sequence of human rihosomal protein L19. The 5' und 3'
expression might reflect an increased protein synthesis capability and
rumtranslated sequences arc in /mrc/raw letters with the polyadenylation site umlcrlitii'il.
The deduced amino acid sequence is written on the htitluin lini' in single letter Conn.
that this might mirror cellular proliferation. To test the association of
1405
GAAGGAGGAGATCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAAT
---- .---- + ---- .---- + ---- .---- + ---- _---- + ---- .---- +
keeiiktlskeeetkk
600
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
LI9
Table 2 Clinical cnrrelalions
IN HUMAN
BREAST TUMORS
with LI 9 overexpression in minor samples
frf.B-2
Neither S16 nor L26 expression was consistently elevated with
high-level L19 expression for either cell lines or primary tumor sam
ples. The expression levels for three cell lines are shown in Table 3.
The maximum difference in expression for both S16 and L26 among
the tested lines and tumors was 4- and 12-fold, respectively. Evidence
of coordinated expression for S16 and L26 is shown in Fig. 5. No
evidence of coordination of expression was detected with either L19
or erbB-2. These results suggest that the L19 gene is not a member of
a tightly coregulated set of genes encoding ribosomal proteins. These
results also suggest that erbB-2 overexpression is not a general stim
ulator of ribosomal proteins.
Excised tumor size was measured as the greatest dimension in centimeters. Positive
estrogen and progesterone receptors samples had values of >45 fmol/mg. Ki-67-positive
samples had values of >I5. P values were determined by \2 analysis. The erbB-2positives (+ ) had mRNA levels of >4, while the L19-positives had mRNA levels of >8.
High-level L19 mRNA
/><erbB-2
THAT OVKRKXPRESS
+
overexpressionTumor
sizeEstrogen
receptorProgesterone
receptorHislological
DISCUSSION
gradeNuclear
Our results indicate that the human ribosomal protein L19 is ex
pressed at increased levels up to a 64-fold greater level in erbB-2overexpressing tumors and cell lines. Our analysis of cell lines sug
gradeKi-67Lymph
gests that high-level expression of LI9 is not a consequence of EOF
receptor overexpression. The association of high-level expression of
L19 with erbB-2 overexpression in the human breast cancers was
remarkably consistent among 46 samples (P < 6 X 10~7). High-level
nodes•f-0-11-22-3>3•f-+-1234123+_+-141149413310600480II35II82526018102191413200111172247II161266E-Ü70.030.10.20.60.40.50.6
L19 expression with the division rate, we measured the Ki-67 values
determined by automated image analysis (20). No statistical correla
tion was found. These results indicate that high-level L19 expression
is most tightly associated with erbB-2 overexpression of the clincal
parameters measured for the primary tumor samples.
Expression of S16 and L26 Ribosomal Proteins Compared to
L19. In order to determine if high-level L19 expression is indicative
of a general increase in the ribosomal content, we examined the
expression levels of two other ribosomal proteins. The identical dotblot hybridization filters containing mRNA from human breast cancer
cell lines and primary human tumor samples were hybridized with
specific DNA probes corresponding to mRNA for encoding the S16
and L26 ribosomal proteins (21, 22). Determination of relative hy
bridization intensity was again normalized to the ß-actinhybridization
signal.
LI9 expression was more weakly associated (P = 0.03) with the
excised tumor size. This is not unexpected, since previous studies
have indicated a link between erbB-2 overexpression and tumor size.
In fact, in the present study erbB-2 overexpression was associated
with increased tumor size (P < 0.01).
Our results are not consistent with a model in which erbB-2 overexpression causes a coordinated increase in activity of protein syn
thesis machinery and L19 levels simply reflect an increased synthesis
of ribosomes. Among different tumor samples there were limited
differences in the expression level of the S16 and L26 ribosomal
proteins. Higher levels of S16 mRNA were associated with higher L26
mRNA levels (P < 6 x 10~4). In contrast, the variation of S16 and
L26 mRNA levels was independent of L19 and erbB-2 expression.
These results suggest that LI9 expression is not tightly linked to the
expression of other ribosomal proteins in breast cancers. Variation in
the expression of mRNAs of specific ribosomal proteins has been
demonstrated in association with other cancers. Studies comparing
12 .
CM
Fig. 4. Scatter plot of LI9 expression versus
erbB-2 expression in human breast tumors. The relationship between the relative expression levels of
erbB-2 and L19 in human breast tumors, as determined by dot-blot and normalized to their ß-actin
expression levels. Insel, contingency table showing
relationship between erbB-2 (+ defines > 4-fold)
and L19 (+ defines >8-fold) reflected by the scatter
plot with a P value of <6 x 10~7.
g
^
|
¿j
»
5
:¿
"
¿
•¿1
.
12
16
20
LI9 Relative Expression Level
1406
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
LI9
IN HUMAN
BREAST
TUMORS
Relative expression levels
T47D
rrAB-2
test if artificially induced high-level expression of L19 mRNA can
impart to a transfected cell a distinct characteristic that may contribute
to the highly malignant behavior of some cancers.
At present, our studies do not indicate the mechanism responsible
for high-level LI9 expression found in p^B-2-overexpressing
tumors.
However, one mechanism can be ruled out. Coamplification of the
erbB-2 and LI9 genes does not occur in any cell lines analyzed as
determined by comparative Southern blot analysis (data not shown).
Moreover, no apparent structural alterations to the L19 genes were
identified, as evidence by identical Southern blot band patterns. Two
potential mechanisms that might be responsible for increases in LI9
mRNA are transcriptional activation or mRNA stabilization. Our data
do not allow us to discriminate between these possibilities. Either
mechanism would suggest a role for erbB-2 overexpression in altering
cellular gene expression. In this context, our data are consistent with
erbB-2 overexpression regulating the "phenotype" of the cancer cell.
Table 3 Sift and L26 expression levels in cell lines
Relative mRNA expression levels (normalized to the /3-actin levels) of erbB-2. L19.
L26, and S16 in the human breast cancer cell lines used as controls on the primary tumor
sample dot blots.
SK-BR-3
THAT OVEREXPRESS
MCF-7
erbB-2L19L26S1664641-228831-21211
6-
If high-level L19 expression is characteristic of a phenotype it may be
interesting to explore whether LI9 protein expression can be used to
evaluate the malignant potential of breast or other cancers.
ACKNOWLEDGMENTS
The authors are grateful to the Molecular Oncology clinical laboratory of
Molecular Oncology. Inc., for analysis of primary tumor samples. We thank
Dr. Edward Barker and Dr. K. Porter-Jordan. (Molecular Oncology, Inc.) for
their assistance in the analysis and interpretation of the clinical information
obtained on the tumor samples. A special thanks to Dr. Fran Kern (George
town University) for the MCF-7 AgtlO cDNA library and to Dr. Ira Wool
(University of Chicago) for the gift of the ribosomal proteins S16 and L26
cDNAs.
L26
RELATIVE
EXPRESSION
Fig. 5. Scatter plot S16 expression versus L26 expression in human breasl tumors. The
relationship between the relative expression levels of S16 and L26 in human breast
tumors, as determined by dot-blot and normalized to their ß-actinexpression levels. Inset,
contingency table showing relationship between S16 (+ defines >2-fold) and L26
( + defines >4-fold) reflected by ihe scatter plot with a P value of <6 X I0~*.
REFERENCES
malignant colon carcinomas to normal colon mucosa have reported
increases in the mRNA for the acidic ribosomal phosphoprotein p2
(23) and L3I (24). More recently, the ribosomal protein mRNAs S3,
S6, S8, S12. PO (25), and S19 (26) have been shown to be expressed
at increased levels in both colon carcinomas and polyps. As yet, none
of these changes have been implicated in the process of malignant
transformation.
As is the case for many ribosomal proteins, it is not known what
exact function is contributed by the L19 protein. Changes in L19
expression independent of other ribosomal proteins suggest that L19
is not simply a required structural element. Other ribosomal proteins
have been implicated in regulatory processes that may be important in
carcinogenesis. The ribosomal protein S6 is a serine kinase and is
involved in the regulation of oocyte maturation (27). The trk-2h gene,
isolated as a genetic rearrangement occurring during transfection ex
periments, encodes a fusion protein which has as one component the
ribosomal L7a protein. The NH2-terminal truncation of c-trk is re
sponsible for activation of the oncogene's tyrosine kinase. Interest
ingly, the trk-2H fusion protein assumes a new location in transfected
cells, bound to ribosomes. The ribosomal location of trk-2H has been
suggested to be important in cell transfomation (28). It is also con
ceivable that L19 may serve functions other than contributing to the
ribosomal structure. Interesting evidence for this comes from a study
of a highly homologus protein in D. discoideum. A M, 22,000 protein
was isolated as capable of binding calmodulin and was found to have
69% homology to the rat L19 at the amino acid sequence level (29).
Since calmodulin mediates intracellular calcium signaling (30), these
findings were intrepreted to suggest that the L19 protein may be a
target of such regulation. As a consequence, it may be interesting to
Coussens, L.. Yang-Feng, T. L., Liao, Y. C.. Chen, E., Gray, A., McGrath, J.. Seeberg.
P. H.. Libermann, T. A., Schlessinger, J., Franke, U., Levinson. A., and Ullrich, A.
Tyrosine kinase receptor with extensive homology to EGF receptor shares chromo
somal location with the neu oncogene. Science (Washington DC), 230: 1130-1139,
1985.
Yamamoto. T. Ikawa. S., Akiyama., T, Semba, K.. Nomura. N.. Miyajima, N., Saito,
T., and Toyoshima. K. Similarity of protein encoded by human cerbB-2 gene to
epidermal growth factor receptor. Nature (Lond.), }I9: 230-234, 1986.
Bargmann, C. I., Hung, M. C., and Weinberg. R. A. The neu oncogene encodes are
epidermal growth factor receptor related protein. Nature (Lond.), 319: 226-230. 1986.
DiFiore. P. P.. Pierce, 1. H.. Kraus, M. H., Segallo, O.. King, C. R., and Aaronson, S.
A. erbB-2 is a potent oncogene when overexpressed in NIH/3T3 cells. Science
(Washington DC), 237: 178-182, 1986.
Hudziak. R. M.. Schlessinger. J., and Ullrich. A. Increased expression of the putative
growth factor receptor pl85 (HER2) causes transformation and tumorigenesis of
N1H/3T3 cells. Proc. Nati. Acad. Sci. (USA), 84: 7159-7163. 1987.
Slamon. D. J.. Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire. W.
L. Human breast cancer: correlation of relapse and survival with amplification of the
HER-2/neu oncogene. Science (Washington DC). 235: 177-182, 1987.
Tandon. A. K.. Clark. G. M.. Chamness. G. C., Ullrich, A., and McGuire, W. L.
HER-2/rtf» oncogene protein and prognosis in breast cancer. J. Clin. Oncol., 7:
1120-1128. 1989.
Slamon. D. J.. Godolphin. W., Jones, L. A., Holt, J. A.. Wong. S. G., Keith, D. E..
Levin, W. J., Stuart, S. G., Udove, J., Ullrich, A., and Press. M. F. Studies of the
HER-2/neu proto-oncogene in human breast and ovarian cancer. Science (Washington
DC). 244: 707-712. 1989.
Paik. S.. Kazan. R.. Fisher. E. R.. Sass. R. E.. Fisher, B.. Redmond. C.. Schlessinger,
J.. Lippman. M. E.. and King. C. R. Pathological findings from National Surgical
Adjuvant Breast Project (protocol B-06), prognostic significance of erbB-2 protein
overexpression in primary breast cancer. J. Clin. Oncol.. N: 103-112. 1990.
ID Paterson. M. C.. Dietrich. K. D.. Danyluk. J., Paterson. A. H. G., Lees, A. W.. Jamil.
N., Hanson, J., Jenkins, H., Krause, B. E.. McBlain, W. A.. Slamon, D. J.. and
Fourney, R. M. Correlation between c-erhB-2 amplification and risk of recurrent
disease in node-negative breast cancer. Cancer Res.. 51: 556-567. 1991.
Press. M. F., Jones, L. A., Godolphin, W., Edwards. C. L.. and Slamon, D. J.
HER-2/npH oncogene amplification and expression in breast and ovarian cancers.
Prog. Clin. Biol. Res., 354A: 209-221, 1990.
Gusterson, B. A., Gelber. R. D.. Goldhirsch, A., Price. K. N., ti al. Prognostic
importance of c-Ã-T/>B-2expression in breast cancer. J. Clin. Oncol., 10: 1049-1056,
1992.
Chirgwin. J., Przybyla, A. E.. MacDonald, R. J., and Rutler, W. J. Isolation of
biologically active ribonucleic acid from sources enriched in ribonuclease. Biochem
istry. 18: 5294-5299. 1979.
14 Kraus. M. H.. Popescu. N. C., Amsbaugh, C., and King, C. R. Overexpression of the
EGF receptor-related proto-oncogene erbB-2 in human mammary tumor cell lines by
1407
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
U 9 IN HUMAN
BREAST TUMORS THAT OVEREXPRESS erhn-2
different molecular mechanisms. EMBO J., 6: 605-610, 1987.
15. Saiki, R. K., Gelfand, D. H., Stoffel, S., Schärft.S. J., Higurchi, R., Hörn,G. T.,
Mullis. K. B., and Erlich. H. A. Primer-directed enzymatic amplification of DNA with
a thermostable DNA polymerase. Science (Washington DC). 239: 487-491, 1988.
Ih. Tabor, S., and Richardson, C. C. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Nati. Acad. Sci. USA. 84: 4767-4771, 1987.
17. Hynes, N. E.. Gerber. H. A., Saurer. S„and Groner. B. Overexpression of the
c-erhB-2 protein in human breast tumor cell lines. J. Cell. Biochem., 39: 167-173,
1989.
18. Chan, Y. L., Lin. A., McNally, J.. Peleg, D., Meyuhas, O., and Wool. I. G. The primary
structure of rat ribosomal protein LI9. J. Biol. Chem.. 262.- 1111-1115. 1987.
19. King. C. R.. Swain. S. M.. Porter. L., Steinberg, S. M.. Lippman. M. E.. and Gelmann.
E. P. Heterogeneous expression of erhB-2 messenger RNA in human breast cancer.
Cancer Res., 49: 4185-4191, 1989.
20. Schwartz, B. R., Pinkus, G., Bacus, S.. Toder, M., and Weinberg, D. S. Cell prolif
eration in non-Hodgkin's lymphomas. Digital ¡mageanalysis of Ki-67 antibody
staining. Am. J. Palhol., 134: 327-336. 1989.
21. Chan. Y-L., Paz, V.. Olvera, J., and Wool, I. G. The primary structure of rat ribosomal
protein S16. FEBS J.. 26.Ì:
86-88. 1990.
22. Paz, B.. Olvera. J., Chan, Y-L., and Wool, I. G. The primary structure of rat ribosomal
protein L26. FEBS J.. 251: 89-93. 1989.
23. Sharp, M. G. E.. Adams, S. M., Elvin, R.. Walker, R. A., Brammar, W. J.. and Varley.
J. M. A sequence previously identified as metastasis-related encodes an acidic phos-
phoprotein. P2. Br. J. Cancer, 61: 83-88, 1990.
24. Chester, K. A., Robson, L., Begent, R. H. J., Talbot, I. C.. Pringle, J. H.. Primrose, L.,
Macpherson, A. J. S., Boxer, G., Southall, P.. and Malcolm, A. D. B. Identification of
a human ribosomal protein mRNA with increased expression in coloréela!tumors.
Biochim. Biophys. Acta, 1009: 297-300. 1989.
25. Pogue-Geile. K., Geiser, J. R., Shu, M.. Miller, C.. Wool. I. G.. Meisler, A. I., and
Pipas, J. M. Ribosomal protein genes are overexpressed in colorectal cancer: isolation
of a cDNA clone encoding the human S3 ribosomal protein. Mol. Cell. Biol.. II:
3842-3849, 1991.
26. Kondoh, N., Schweinfest, C. W., Henderson, K. W., and Papas. T. S. Differential
expression of S19 ribosomal protein, laminin-binding protein, and human lymphocyte
antigen class I messenger RNAs associated with colon carcinoma progression and
differentiation. Cancer Res., 52: 791-7%, 1992.
27. Erikson, E., and Mailer, J. L. In vivo phosphorylation and activation of ribosomal
protein S6 kinases during Xenopus oocyte maturation. J. Biol. Chem., 264: 1371113717. 1989.
28. Ziemiecki. A.. Müller,R. G., Fu, X-C, Hynes, N. E., and Kozma. S. Oncogenic
activation of the human trk proto-oncogene by recombination with the ribosomal large
subunit protein L7a. EMBO J.. 9: 191-196, 1990.
29. Sonnemann, J., Bauerle, A., Winckler, T., and Mutzel, R. A ribosomal calmodulinbinding protein from Dictyoaelium. !. Biol. Chem., 266: 23091-23096. 1991.
30. Tsunoda, Y. Oscillatory Ca2+ signaling and its cellular function. New Biol.. 3: 3-17,
1991.
1408
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.
High-Level Expression of the Ribosomal Protein L19 in Human
Breast Tumors That Overexpress erbB-2
John L. Henry, David L. Coggin and C. Richter King
Cancer Res 1993;53:1403-1408.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/53/6/1403
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1993 American Association for Cancer Research.