JOURNAL
OF
VIROLOGY, May 1986,
p.
450-458
Vol. 58, No. 2
0022-538X/86/050450-09$02.00/0
Copyright C) 1986, American Society for Microbiology
DNA Requirements at the Bacteriophage G4 Origin of
Complementary-Strand DNA Synthesis
PAUL F. LAMBERT,t DAVID A. WARING, ROBERT D. WELLS,t
Department
of Biochemistry,
AND
WILLIAM S. REZNIKOFF*
College of Agricultural and Life Sciences, University of Wisconsin, Madison,
Wisconsin 53706
Received 11 June 1985/Accepted 7 January 1986
Bacteriophage G4 is a single-stranded DNA phage which
infects Escherichia coli C (11). Upon infection, the singlestranded G4 genome is converted to a double-stranded
replicative intermediate. This replication event is dependent
upon the synthesis of an RNA primer by the host dnaG gene
product, primase, at a unique position on the G4 genome, the
origin of complementary-strand DNA synthesis (3). The
mechanism by which primase interacts on the G4 genome is
different from its mode of interaction on other genomes,
such as that of bacteriophage (X174, in which a multiprotein
complex termed the primosome is required for primase
activity (1). The primosome is also thought to be necessary
for the synthesis of RNA primers by primase during E. coli
chromosomal replication as well as lambda DNA replication
(9, 10). On the other hand, both in vivo and in vitro studies
indicate that primase activity on the bacteriophage G4
genome does not require the primosome (2, 4, 27) but is
dependent solely upon the addition of stoichiometric
amounts of single-stranded DNA-binding protein (SSB). The
features of the G4 origin that cause primase to interact
independently of the primosome are not understood.
The DNA sequence of the G4 genome was determined,
and the position of primase-dependent RNA synthesis was
mapped to a location within the gene F-G intercistronic
region (8, 13). Sequence comparison with the primasedependent (primosome-independent) origins of three closely
related, single-stranded DNA bacteriophages, ~k, a3, and
st-1 (25), revealed several interesting features. First, there
are two regions of strong sequence conservation within the
intercistronic regions of these phages. Second, these regions
of conserved sequence can potentially form secondary structures (stemloops I and II; see Fig. 2 and 8). Whether these
sequence homologies are significant with respect to origin
function or are simply a consequence of the relatedness
between the phages has not been determined; however, the
high degree of sequence conservation within this region
compared with other regions of these genomes implicates a
functional role (25).
In this study, the DNA sequence requirements at the G4
origin are defined. We used an in vivo assay for origin
activity that measured the ability of a DNA fragment to
restore normal infectious growth character to a defective
M13 phage. Normal infectious growth was found to correlate
with proficient rifampin-resistant DNA replication assayed
in vitro. The boundaries of the G4 origin as well as the
requirements for regions within this DNA sequence were
determined. In addition, the effect of destroying G4 origin
activity within phage G4 was addressed.
MATERIALS AND METHODS
Bacterial strains and phage stocks. E. coli K12 strains JM101
[F' traD-36 lacIqZm]5 proA+B+/l(lac-pro)supE thi] and
CSH26/Pox38-gen (CSH26 is described below; Pox38-gen is
an F' plasmid encoding gentamycin resistance which was
constructed as described by Johnson and Reznikoff [15]) were
used for infectious growth curves and efficiency of infection
experiments. Strain CSH26 [ara A(lac-pro) thi] was used for
transfection experiments. E. coli C was used for infectious
growth of bacteriophage G4 and derivatives constructed in
this study. Bacteriophage M13mp8 was purchased from
Bethesda Research Laboratories. M13AE101 was a gift from
D. Ray, University of California at Los Angeles, Los
Angeles. Construction of all other phages is described below.
Biochemicals. Restriction enzymes, E. coli DNA polymerase I, and DNA nucleases were purchased from New England BioLabs, Bethesda Research Laboratories, Inc., or
Promega Biotec and used as specified by the supplier. T4
*
Corresponding author.
t Present address: Laboratory of Tumor Virus Biology, National
Cancer Institute, Building 41, Bethesda, MD 20205.
Present address: Department of Biochemistry, University of
Alabama at Birmingham School of Medicine and Dentistry, University Station, Birmingham, AL 35294.
450
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
An in vivo assay was used to define the DNA requirements at the bacteriophage G4 origin of complementarystrand DNA synthesis (G4 origin). This assay made use of an origin-cloning vector, mRZ1000, a defective M13
recombinant phage deleted for its natural origin of complementary-strand DNA synthesis. The minimal DNA
sequence of the G4 genome sufficient for the restoration of normal M13 growth parameters was determined to
be 139 bases long, located between positions 3868 and 4007. This G4-M13 construct was also found to give rise
to proper initiation of complementary-strand synthesis in vitro. The cloned DNA sequence contains all the
regions of potential secondary structure which have been implicated in primase-dependent replication initiation
as well as additional sequence information. To address the role of one region which potentially forms a DNA
secondary structure, the DNA sequence internal to the G4 origin was altered by site-directed mutagenesis. A
3-base insertion at the Avall site as well as a 17-base deletion between the AvaI and Avall sites both resulted
in loss of origin function. The 17-base deletion was also generated within the G4 genome and found to
dramatically reduce the infectious growth rate of the resulting phage. These results are discussed with respect
to the role of the G4 origin as the recognition site for primase-dependent replication initiation and its possible
role in stage II replication.
VOL. 58, 1986
G4 ORIGIN OF COMPLEMENTARY-STRAND DNA SYNTHESIS
FIG. 1. Origin cloning vector mRZ1000. The a-complementing
region of lacZ (indicated by arrows), as present in M13mp8, is
inserted into the filled-in EcoRI site of M13AE101 at the position of
the deleted origin of complementary-strand DNA synthesis (indicated by broken line). The M13 genes are indicated by Roman
numerals.
DNA ligase was a gift from R. Simoni, Stanford University,
Stanford, Calif. SSB was a gift from M. Cox. Deoxy- and
dideoxy-nucleoside triphosphates were purchased from P-L
Pharmacia Biochemicals, and radioisotopes were purchased
from Amersham Corp.
Phage constructions. The origin vector mRZ1000 was
constructed by ligating the 761-base-pair (bp) fragment of
M13mp8 containing the lac region, generated by cleavage at
the AvaII and HgaI sites and purified by polyacrylamide gel
electrophoresis, into the filled-in EcoRI site of M13AE101.
The resulting DNA was transformed into competent JM101
cells, and minute lac+ plaques were screened for on TYE
agar containing 5-bromo-4-chloro-3-indolyl-,-D-galactoside
and isopropyl-f3-D-thiogalactopyranoside (19). DNAs from
these phage were further analyzed by extensive restriction
enzyme cleavage analysis. The resulting phage genome
organization is illustrated in Fig. 1. The 274-bp AluI restriction fragment from duplex G4 DNA was blunt-end ligated
into the filled-in EcoRI site of mRZ1000 to generate
mRZ1200 (Fig. 2). This phage gave rise to normal-sized
plaques which were still lac+, owing to the generation of a
fusion protein which starts at a G4 translational start codon
and continues in frame into the a-complementing region of
lacZ. Minute lac- plaques were also found which have the
opposite orientation of the G4 fragment inserted into the
origin-cloning vector (mRZ1205). The constructs mRZ1211mRZ1213 were generated by inserting the respective restric-
tion fragment, with staggered ends filled in by the action of
E. coli DNA polymerase I, into the SmaI site in mRZ1000.
Deletion endpoints at the right side of the G4 origin,
mRZ1216-mRZ1220 were generated, and phage mRZ1200
was linearized with HindIII and treated with S1 nuclease for
various times as described previously (30). The DNA was
subsequently cleaved with EcoRI, and the fragments released were isolated by elution from a polyacrylamide gel.
The DNA fragments were then recloned into EcoRI-SmaIcleaved mRZ1000. Endpoints were determined by both
restriction enzyme analysis and dideoxy sequencing (16).
Deletion endpoints at the left end of the G4 origin were
constructed by an identical approach, but with Bal 31
nuclease in place of S1 nuclease; the conditions described
previously were used (17), and mRZ1200, linearized at the
EcoRI site, was used as the substrate.
Site-directed mutagenesis. Single-stranded DNA prepared
from stocks of mRZ1200 and mRZ1205 were mixed at a 1:2
molar ratio in a buffer containing 10 mM Tris (pH 7.9), 6 mM
MgCl2, and 6 mM NaCl and incubated at 65°C for 45 min.
After the sample was cooled to room temperature, AvaI or
AvaII or a mixture of the two was added and digestion was
carried out at 37°C for 60 min. The 5' overhangs generated
by these restriction enzymes were made blunt ended (filled
in) by incubation at room temperature for 30 min with DNA
polymerase I and 0.1 mM deoxynucleoside triphosphates.
Ligation was carried out at 14°C for 10 h in the presence of
0.1 mM ATP and 1 U of T4 ligase. This was followed by the
addition of the same restriction enzyme used in the initial
cleavage of the partial duplex. This step is important,
because it causes the linearization of partial duplexes not
altered in their DNA sequence, thus reducing their efficiency
of transformation. Competent JM101 was transformed with
the DNA sample and plated on TYE agar (19) supplemented
with 5-bromo-4-chloro-3-indolyl-3-D-galactoside and
isopropyl-,-D-thiogalactopyranoside. DNA from phages
which gave rise to blue (lac+) plaques were screened for loss
of the appropriate restriction enzyme site and sequenced.
Efficiency of infection assays. Aliquots of host bacterium
(0.3 ml of fresh overnight cuiltures grown in LB medium),
JM101 and CSH26(Pox38-gen), were infected with 100-,lI
portions of serial dilutions of phage stocks and plated on
TYE plates (19) with T top agar (19). The concentrations of
phage stocks were made equal by quantitating the concentration of viral DNA on agarose gels and correcting for
differences in the DNA content. The DNA content was
determined by incubating 20 ,ul of phage stock containing
0.1% sodium dodecyl sulfate and 0.001% bromphenol blue at
65°C for 30 min, followed by electrophoresis on a 0.8%
agarose gel. The gel was stained in 0.05 ,ug of ethidium
bromide per ml for 30 min and photographed under shortwave UV irradiation on Polaroid type 55 positive/negative
film. The negative was scanned densitometrically, and the
DNA content was approximated by using DNA standards
run on the same gel. After the concentration of each phage
stock was adjusted, the DNA concentrations were measured
again and found to be equal. On the basis of densitometric
scanning of duplicate samples, the error of this quantitation
was found to be less than 5%. The titrating of these phage
stocks was done in triplicate; less than 10% difference in the
titers was found.
Infectious growth assays. Strain JM101 was introduced into
fresh LB medium (19) and grown at 37°C. At early log-phase
growth (optical density at 550 nm, 0.2), the cells were
infected with 104 PFU. The production of phage was monitored during the rest of the cell culture growth by taking a
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
Bam HI
451
452
LAMBERT ET AL.
J. VIROL.
(AluI)
Hinf I
v
I
StemloopIl
I0
3800
3820
3840
3860
3880
3900
3900
,- _-*
AvaIl Avol
jHinf I StnioopI
1
W
,
lI
I
(AluI)
_l
l-
I2
3920
3940 3960 39804000402040404060
in vitro DNA
s
replication;
pmoles dTMP
incorporated
86
mRZ 1200
4070
3792
TCGA
mRZI206
34
3792
4070
3955
GAC
69
mRZ1207
3792
3935
4070
3792
3935 3955
4070
3792
3935
56
mRZ 1208
57
mRZ121
mRZ 1212
32
3955
mRZ 1216
3792
4070
3989
m RZ 1217
mRZ I219
mRZ 1220
mRZ 1221
25
47
27
3792
4007
3792
n.d
4016
3792
nd
4027
3892
mRZ 1222
n-d
4027
3868
3852
mRZ 1223
nd
4027
nd
4027
FIG. 2. Phage constructs. The top line indicates the 274-bp AluI restriction fragment from bacteriophage G4, containing the G4 origin. The
numbers below the line represent nucleotide positions on the G4 genome. The wavy line and arrowhead indicate the position and direction
of primase-dependent RNA synthesis. Inverted complementary sequences, stemloops I and II, are indicated above the line by converging
arrows. The boxed region (positions 3992 through 4034) indicates the region homologous to the DNA origin. Relevant restriction enzyme
sites are indicated above the line. The portion of the 274-bp fragment present in each construct is indicated below the lines. Nucleotides
inserted in mRZ1206 and mRZ1207 are indicated above each line. The internal deletion present in mRZ1208 is indicated by the boxed area.
In the far right column is indicated the number of picomoles of [3H]dTMP incorporated into a trichloroacetic acid-insoluble precipitate as
measured by the fraction II replication assay. These assays were done in triplicate in the presence of rifampin (see Materials and Methods).
0.2-ml portion at each time point, diluting it into 1.8 ml of
ice-cold M9 salts (19), and filtering the phage stock through
a 0.2-,um-pore-size filter to remove cells. These phage stocks
were titrated. Rates of infectious growth were determined by
performing linear regression analysis on the initial time
points (usually five points, representing the first 2.5 h postinfection).
Transfection assay. Competent F- cells (CSH26) were
transfected for 30 min on ice with 50 ng of phage DNA
prepared by the method of Sanger et al. (23) and quantitated
on agarose gels by using appropriate standards. After heat
shock at 42°C for 2 min, a small portion was plated in top
agar containing 0.3 ml of a saturated culture of F+ cells
[CSH26/Pox38-gen] and underlaid with gentamycin 1 h after
plating. This allowed the determination of the number of
transfectants for each type of phage DNA. The rest of the
transfection stock was outgrown in 4 ml of LB medium for 6
h, during which time portions were removed and the phage
produced were titrated as described for the infectious growth
assay. The maximal rate of progeny phage production (Table
1) was determined by maximizing the value for the quotient
(Yn - Yn )/(Xn - Xn 1) where Yn is the number of phage per
transfectant at time point n, y, 1 is the number of phage per
transfectant at the previous time point, n - 1, Xn is the time
(in minutes) at time point n, and xn _ 1 is the time at the
previous time point, n 1.
Bacteriophage G4 infectious growth assays. The burst size
-
-
-
for wild-type phage G4 was determined by infecting a 5-ml
culture of E. coli C with 1 PFU at early log phase. Because
the rate of progeny phage production for the G4Aori mutant
was extremely low, cells were infected with 10 PFU in this
case. Portions were taken every 10 minutes, and the phage
TABLE 1. In vivo growth characteristics of origin-cloning vector
mRZ1000
Transfection
Efficiency of infectiona of:
Construct
(Lmg)
vRalue
JM101 CSH26(Pox38-gen)
M13
2.2
x
1012
3.1 x 1012
Single-stranded DNA
24 2.3
24 2.4
Double-stranded DNA
mRZ1000
3.1 x 1011
3.5 x 1011
45 0.005
38 0.030
Single-stranded DNA
Double-stranded DNA
2.0 x 1012
mRZ1200
Single-stranded DNA
Double-stranded DNA
2.3 x 1012
24 1.6
24 1.9
a Number of PFU for an equivalent amount of phage, as indicated in
Materials and Methods.
b Time in minutes at which 0.01 PFU
per transfectant occurs.
c Rate of progeny phage production (maximal rate is given in phage per
minute per transfectant).
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
3958
3863
mRZ 1213
VOL. 58, 1986
G4 ORIGIN OF COMPLEMENTARY-STRAND DNA SYNTHESIS
453
-0a-mRZ1216~~~~~~~~~~~~~21
~,~mZ1000//*-ZI6
Fg
2
a 7.tmRZ 1213
r
7/e
-Metho8
0
6.0
5.0
-
-
3.0
-~~~~~~~~~~~~~~~~
2.0
I
A
I
0.0 0.5 1.015 2.0 2. 3.0
4.0
ff
I
11.0
I
I
I
I
0.0 Q5 101L5 2. 2.5 3.0
I
4.0
11.0
Time of infection (hours)
FIG. 3. Infectious growth curves. The yield of phage as a function of time (ini hours) afte'r infection is given for the phage constructs listed
in Fig. 2. In addition, the control phage, mRZ1000, mRZ1200, and M13 are represented in panel A. See Materials and Methods for further
details.
titers were determined. Phage G4 was found to produce a
burst of approximately 200 to 400 phage at a time between 20
and 30 min after infection, while the G4Aori mutant gave rise
to only 15 progeny phage after approximately 60 min.
In vitro DNA replication assay. DNA synthesis was measured by using the fraction II protein extract described by
Fuller et al. (9). The fraction II protein extract was prepared
from E. coli E177 (CGSC strain no. 5029; thr-1 leuB6 thi-J
thyA6 deoCI dnaAJ77 lacYl strA67 tonA21 supE44) exactly
as described, with a 28% ammonium sulfate cut. The concentration of fraction II protein used in the DNA synthesis
reactions described below was optimized by using singlestranded M13 DNA as template. The DNA synthesis reactions were carried out in a final volume of 20 p1l and
contained the following components: 40 mM N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)
buffer (pH 7.6), 10 mM magnesium acetate, 40 mnM creatine
phosphate, 0.5 mM CTP, GTP, and UTP, 2 mM ATP, 0.1
mM dATP, dCTP, and dGTP, 0.1 mM [methyl-3H]dTTP
(specific activity, 2,000, dpm/pmol of dTTP), 0.1 mg of
creatine kinase per ml, 1 ,xg of SSB, 7% (wt/vol) polyvinyl
alcohol 24,000 (Sigma), and 200 ng of single-stranded DNA
template. Rifampin was added, when indicated, at a final
concentration of 300 ,ug/ml. After the components were
combined at 0°C, 325 ,ug of fraction II protein was added,
and the reaction mixtures were incubated at 30°C for 20 min.
Incorporation of nucleotide into trichloroacetic acidprecipitable material was measured by liquid scintillation
quantitation.
RESULTS
Construction of the origin-cloning vector mRZ1000. To
study G4 origin function in vivo, we constructed an origin-
cloning vector, mRZ1000, the growth of which strongly
relies upon the introduction of a functioning origin of complementary-strand DNA synthesis. The design of this vector
and its use in screening DNA inserts for origin function is
based on studies of M13 mutants deleted for their origin of
complementary-strand DNA synthesis (16). The phage grow
very poorly, giving rise to minute, turbid plaques; however,
normal growth can be restored by the introduction of a DNA
fragment carrying the G4 origin (21). This observation has
led to the use of these M13 mutants as vectors for the
isolation of single-stranded DNA replication determinants
from bacterial episomes (20). For our study, we modified one
of these mutant phages, M13AE101, by introducing the
region of lacZ encoding the a chain, as present in M13mp8
(28). The resulting construct, mRZ1000 (Fig. 1), has several
advantages over the parent phage M13AE101 as a cloning
vector. The presence of unique restriction enzyme sites
within the coding region for lacZ permits the insertion of
DNA fragments and the screening of resulting clones owing
to the insertional inactivation of lacZ. In addition, complementarity to the universal primer permits rapid DNA sequence determination by using the dideoxy sequencing protocol (23).
Characterization of mRZ1000 and cloned G4 origin activity.
The viability of the phage was measured by infectious
growth assays, in which early-log-phase cultures of host
bacteria (F+ strain, JM101) were infected with phage at a low
multiplicity of infection and the production of phage was
monitored over the remaining period of log-phase growth
(Fig. 3). The origin-cloning vector mRZ1000 grew very
poorly in comparison with wild-type M13; however, introduction of the 274-bp AluI restriction fragment from phage
G4, containing the G4 origin of complementary-strand DNA
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
;-2mRZ121.0Q85
0L5Sa
.01.
7.0 Q5 1./5
4.0 -A
454
J. VIROL.
LAMBERT ET AL.
cussion).
To measure DNA replication on the mRZ1000 template in
comparison with wild-type M13 and the G4 origin clone
mRZ1200, in vitro replication assays were performed by
using the Kornberg fraction II system (9). DNA synthesis
progratnmed by single-stranded mRZ1200 DNA, as measured by the incorporation of [methyl-3H]dTTP into acidprecipitable DNA (220 and 186 pmol of dTTP incorporated in
the absence and presence of rifampin, respectively) was
more than 5 times greater than synthesis programmed by
mRZ1000 (39 and 21 pmol of dTTP incorporated in the
l000
100
I0i
0
4.-
4.-
-0
0.1
.0 110000
0 110
-10 120
2
80 90 100
10 20 30 40 50 660 770 809
Period of outgrowth (minutes)
FIG. 4. Transfection assay. Yields of progeny phage per
transfectant are given as a function of outgrowth period. Strain
CSH26 was transformed with 20 ng of each phage DNA, and the
production of phage was monitored by titrating portions from each
time point on JM101 cells. Curves are labeled. See Materials and
Methods for further details.
absence and presence of rifampin, respectively). DNA synthesis programmed by mRZ1200 was not due to RNA
polymerase-tnediated primer formation, since rifampin had
little effect on the extent of DNA synthesis, in contrast to a
6-fold reduction in DNA synthesis seen with the wild-type
M13 template (114 and 18 pmol of dTTP incorporated in the
absence and presence of rifampin, respectively). The data
indicate that the origin-cloning vector is indeed deficient in
DNA replication initiation and that the efficient rate of DNA
synthesis measured on mRZ1200 is due to rifampin-resistant
replication initiation, as expected from the primasedependent G4 origin.
Defining the DNA requirements at the G4 origin. To define,
level, the DNA requirements at the G4 origin,
subfragments of the 274-bp AluI restriction fragment from
G4 were cloned into mRZ1000 and screened for origin
function. Three subclones were chosen for study: mRZ1211,
at a gross
which contains the left half of the 274-bp region up to the
Avall sites; mRZ1212, which contains the central region
between the two Hinfl sites; and mRZ1213, which contains
the right half of the 274-bp region starting from the AvaI site
(Fig. 2). All three subclones were deficient in origin activity,
as measured by infectious growth assays (Fig. 3A) and in
vitro replication assays (Fig. 2).
The second approach taken was to determine the boundaries of the G4 origin. The right boundary was defined by
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
synthesis (see mRZ1200, Fig. 2), restored normal growth
parameters (Fig. 3A). In addition, the efficiency of infection
for mRZ1000, as measured in two different strains, was only
11 to 14% that of wild-type M13, while the efficiency of
infection for the G4 origin clone mRZ1200 was between 75
and 90% that of wild-type M13 (Table 1).
The production of progeny phage was also measured by a
single-cycle transfection assay. This assay, in which competent F- cells are transfected with viral DNA and the production of progeny phage is monitored during outgrowth, provides several advantages over the standard infectious growth
assay. First, by introducing the viral DNA directly into the
cells, potential differences in the accessibility of packaged
DNA templates to the cellular replication apparatus are
eliminated. This may be of importance, as it is known that
the M13 genome is oriented specifically within the virion,
such that the M13 origin of complementary-strand DNA
synthesis is located at the end of the filament which is
attached to the cell surface upon adsorption (29). Also, the
viral DNA does not finish entering the cell until after
complementary-strand DNA synthesis has begun (5). Therefore, the successful establishment of an infection could be
affected by these packaging constraints. Second, introduction of the DNAs into competent cells is synchronized by the
heat shock step followed by the addition of media at the start
of outgrowth. This permits the determination of the lag
period before which progeny phage appear. Third, because
the competent cells are F-, they cannot be infected by
progeny phage (filamentous phage require the F plasmidencoded pili for adsorption to the cell surface). Consequently, by determination of the frequency of transfection,
the rate of progeny phage production per transfectant may
be determined.
The results of such an experiment are presented in Fig. 4
(the lag times and rates of progeny phage production derived
from this experiment are presented in Table 1). The rate of
mRZ1000 progeny phage production was less than 1% that of
wild-type M13, and the lag time for the detection of
mRZ1000 progeny phage was 45 min, in comparison with 24
min for wild-type M13. In contrast, the G4 origin construct
mRZ1200 behaved very similarly to wild-type M13, having a
rate of progeny phage production 90% that of wild-type M13
and a lag time equivalent to that of wild-type M13. In a
parallel experiment, double-stranded replicative form DNAs
were transfected and the production of progeny phage was
monitored (Fig. 4). There was little difference in the behavior
of single-stranded versus double-stranded DNAs for M13
and mRZ1200, whereas double-stranded mRZ1000 DNA had
a shorter lag time, 38 versus 45 min, and a rate of progeny
phage synthesis 6 times higher than that of single-stranded
mRZ1000 DNA (Table 1). The values obtained for doublestranded mRZ1000 were, however, much lower than the
values for the origin-competent phages M13 and mRZ1200.
This observation suggests a role for the origin of complementary-strand replication in stage II replication (see Dis-
G4 ORIGIN OF COMPLEMENTARY-STRAND DNA SYNTHESIS
VOL. 58, 1986
1I
C:
°G4
0
0
8
(D
~0
9J
-AG4Aori
cp2
I
~~~I
I
I
I
I
I
__
4.0
2.5 3.5(hours)
F
510Time of infection
5
0 1.5 20
3.0
FIG. 5. Bacteriophage G4 production in liquid culture. E. coli C
infected at early log phase of growth, and the production of G4
phage was monitored for wild-type G4 and G4Aori. See Materials
was
and Methods for details.
deleting the G4 DNA sequence from the right end of the
274-bp AluI restriction fragment by using S1 nuclease as a
double-stranded DNA exonuclease (deletion constructs are
shown in Fig. 2). The boundary was found to lie between
bases 3990 and 4007 as defined by infectious growth characteristics (Fig. 3B) and in vitro DNA synthesis properties
(Fig. 2) of the deletion constructs mRZ1216 and mRZ1217.
Phage mRZ1216 was completely deficient in origin activity,
whereas mRZ1217, and the deletion constructs mRZ1219
and mRZ1220 are functional in G4 origin activity, equivalent
to that of mRZ1200. The left boundary, defined by a similar
approach with mRZ1220 as the template for deletion formation and Bal 31 nuclease for removing the G4 DNA sequence
from the left end, was found to lie between positions 3892
(deletion construct mRZ1221) and 3868 (deletion construct
mRZ1222) (Fig. 2). The in vivo infectious growth assay was
used to show that there was complete loss of origin activity
in mRZ1221, whereas 100% origin activity was observed in
the next deletion constructs, mRZ1222 and mRZ1223 (Fig.
3B). The in vitro DNA synthesis assays were not performed
on these constructs. These results indicate that the G4 origin
lies within the 139 bases defined by the deletion endpoints at
positions 3868 and 4007.
Site-directed mutagenesis within the G4 origin. The DNA
sequence within the G4 origin was altered by site-directed
mutagenesis. A partial duplex was formed between the viral
DNAs of two recombinant M13 phages, mRZ1200, containing the viral strand of the 274-bp AluI restriction fragment,
and mRZ1205, containing the complementary strand from
the same fragment. The partial duplex was linearized by the
restriction enzyme AvaI or AvalL. Both of these enzymes
have more than one restriction site in the two M13 templates; however, only one site for each enzyme is found
within the double-stranded region of the partial duplex. The
staggered ends generated by cleavage with either enzyme
were made double stranded by being filled in with DNA
polymerase I; the linear partial duplex with blunt ends was
then ligated closed with T4 ligase. Before transformation,
the partial duplexes were again subjected to cleavage by the
restriction enzyme used originally. This step enriches for the
desired product altered in its DNA sequence at the restriction enzyme site.
This technique was very efficient in generating small
duplications at the AvaI (mRZ1206) and Avall (mRZ1207)
sites within the G4 DNA sequence. Likewise, a deletion
between these restriction sites was generated (mRZ1208;
Fig. 2). These constructs were analyzed for origin activity by
the infectious growth assay (Fig. 3B) and in vitro replication
assay (Fig. 2). The AvaI duplication mRZ1206 retained some
origin activity, while the Avall duplication mRZ1207 and the
17-base deletion construct mRZ1208 were completely deficient for origin activity.
To determine whether the 17-base deletion present in
mRZ1208 results in the loss of G4 origin function in the
parent phage, we repeated the site-specific mutagei esis
procedure described above, with bacteriophage G4 viral
DNA in place of mRZ1200 viral DNA. The resulting G4
phage DNA was transformed into E. coli C and found to give
rise to small plaques. These small-plaque variants were
grown up, and replicative-form DNA was isolated. The
destruction of the Avall site as a result of the deletion was
confirmed by restriction analysis, indicating that the smallplaque variant is the result of the alteration of the DNA
sequence within the G4 origin. In infectious growth assays,
the small-plaque variant (G4Aori) grew poorly in comparison
with wild-type bacteriophage G4 (Fig. 5), having a burst size
of approximately 15 phage in comparison with 200 to 400
phage for wild-type G4.
DISCUSSION
Use of mRZ1000 to assay origin function. We used the
origin-cloning vector mRZ1000 to define the DNA requirements at the G4 origin. This vector was shown to be deficient
in DNA replication in vitro and to grow poorly in vivo.
Introduction of the 274-bp restriction fragment from
bacteriophage G4, containing the G4 origin, resulted in
efficient rifampin-resistant DNA replication in vitro and
restored near-normal infectious growth in vivo. The G4
origin did not restore 100% of the wild-type M13 growth rate,
as measured by both the infectious growth and transfection
assays, which may simply indicate that the primasedependent G4 origin is not perfectly equipped to replace the
RNA polymerase-dependent M13 origin of complementarystrand DNA synthesis. The vector mRZ1000 has been used
for the isolation of single-stranded DNA replication initiation
determinants from a mini-F plasmid (referred to as
M13AElac in this study) (14) as well as studies of the
bacteriophage G4 origin of complementary-strand DNA synthesis (this study; P. F. Lambert, E. Kawashima, and W. S.
Reznikoff, submitted for publication).
The characterization of this vector suggested an interesting insight concerning the mechanism of M13 replicativeform DNA synthesis. In the transfection experiment (Fig. 4),
the rate of progeny phage production seen for doublestranded mRZ1000 DNA was extremely low, similar to that
of the single-stranded form. This result strongly supports the
hypothesis that the M13 RNA polymerase-dependent origin
of complementary-strand DNA synthesis is necessary not
only for the initial conversion of viral DNA to a doublestranded replicative intermediate (stage I replication), but
also for the subsequent amplification of this replicative
intermediate (stage II replication). This proposal is consistent with those made by Staudenbauer et al. (26), but is in
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
UA_ -A-
455
456
LAMBERT ET AL.
J. VIROL.
Stemloop
II
T A
A C
G=C
A-T
C-G
T C - 3920
G=C
G-C
T=A
Stemloop
AC AT
3980 I,
U C TG
A C
3900 C
GE
C=G
TI40
39OAAT
42
C7G /Aa
CE-G
CEG
GEC
Avail
G C
IIolGlC
AvC=G
C=G mRZ
C=G
4020
~~~~~A=T 1216 4000
GACTCAATCATCATGACCTCGTAACGCAACAAAG ,CGTGCCTACGGAGATACTCGAGTCTCCGATACATG=EC,TACTGCAAAGCCAAAAGGACTAACATATGTTCCAGAAATIC~AT
=
mR
122 1
903960
ImRZ
4036
1217
,1 1
\
/
FIG. 6. G4 origin region sequence. The sequence is drawn with secondary structures, stemloops I and II. Nucleotide positions on the G4
genome are indicated, as is the position of the primase-dependent RNA primer (broken line). Relevant deletion endpoints and restriction
enzyme sites are shown. The boxed area is the region partially homologous to the DNA sequence within the X DNA origin.
contrast with studies on the thermosensitivity of M13 replication in dnaG and dnaB strains. These results led to an
alternative proposal for the mechanism of complementarystrand DNA synthesis during stage II replication, involving
discontinuous synthesis (22). The proposed utilization of the
M13 origin of complementary-strand synthesis in stage II
replication is also consistent with the models for DNA
replication for bacteriophage Fl, 4)X174, and G4 (6, 7, 12).
One caveat to this interpretation of the results of the
transfection assay (Fig. 3) is that, while it permits the
determination of sequences that are essential for normal
growth of mRZ1000, it cannot distinguish whether the function being rescued is merely a replicative function (our
hypothesis), or whether there is some other additional function which may have been impaired by the original deletion
in this M13 mutant. Although we have no evidence for the
existence of an impaired function in addition to the origin of
complementary-strand synthesis, we cannot preclude this
possibility. Several facts, however, are consistent with the
origin of complementary strand synthesis as the only defective function in this M13 mutant. First, the defective infectious-growth phenotype found with mRZ1000 and its parent
deletion mutant M13AE101 is rescued by the introduction of
DNA sequences from heterologous sources, including plasmids as well as bacteriophages (14, 20, 21). In each case, the
DNA sequence was found to contain a single-stranded DNA
replication initiation determinant. It seems highly implausible that in every case a second function, hypothetically
impaired in the M13 mutant, has been fortuitously supplied
in addition to the replication functions. Second, in our study,
in all cases in which in vitro rifampin-resistant DNA replication assays were performed (Fig. 2), mRZ1200 derivatives
defective in vivo were also found to be deficient in DNA
replication in vitro. We did not find mutations which were
proficient in DNA replication but defective in growth, nor,
vice versa, a phenotype which could be expected were a
second function encoded on the cloned G4 DNA sequence.
These arguments are consistent with there being one function impaired in the M13 mutant, mRZ1000, and one function
encoded for by the G4 DNA sequence; that is, the origin of
complementary-strand synthesis.
DNA requirements at the G4 origin. In this study, the
minimal region of the bacteriophage G4 genome sufficient for
origin activity was determined to be 139 bp long. The DNA
sequence includes all regions conserved among the origins of
complementary-strand synthesis in the single-stranded DNA
bacteriophages 4k, x3, st-1, and G4.
Just to the right of stemloop I, there is a 42-base-long A+T
rich region which shares 70% homology with the origin of
replication for bacteriophage lambda (Fig. 6). Since the
bacteriophage lambda origin is also primase dependent (16),
it was postulated that this region of homology may be the site
for primase binding. In addition, the location of this homologous sequence just upstream of the RNA primer site in the
G4 origin also supports the concept of its being a binding
site. The deletion endpoint in mRZ1217, however, contains
less than half of this region of homology, and yet the
mRZ1217 origin is fully functional in vivo. It is not clear
whether the remaining portion of homology is important, as
the next deletion endpoint, in mRZ1216, removes not only
this region but also part of stemloop I. That at least part of
this region homologous to the bacteriophage lambda origin is
not necessary for origin function may not be surprising,
since the mechanism of primase action at these origins is
quite different. McMacken et al. (18) have suggested that
primase binding to the lambda origin is primosome dependent at positions where the assembly of the primosome is
directed by lambda 0 and P proteins. This is quite different
from the primosome-independent binding by primase at the
G4 origin. A significant aspect of this region of homology
may be its A + T richness (21 of 26 bases conserved between
these origins were A or T).
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
3863 mZ3880
1222
VOL. 58, 1986
G4 ORIGIN OF COMPLEMENTARY-STRAND DNA SYNTHESIS
secondary structure.
Site-specific mutagenesis was also used to alter the G4
origin DNA sequence within the G4 genome. This resulted in
a small-plaque phenotype, which may be similar to the
phenotype of M13 mutants defective in their origin of
complementary-strand DNA synthesis (16). That this 17base deletion resulted in a defective phenotype in bacteriophage G4 is consistent with the effect it had on the G4 origin
when assayed in the origin cloning vector mRZ1000. We also
noticed that this G4 mutant reverted at a high frequency,
giving rise to medium-sized plaques (data not shown). These
revertants appear to be quite stable, although their rate of
infectious growth is still quite poor in comparison with that
of wild-type G4. It would be interesting to determine
whether these revertants are due to a compensating change
in the origin region or perhaps to the generation of a more
functional secondary origin.
In conclusion, we have determined that the minimal
sequence sufficient for G4 origin activity is no longer than
139 bases. Within this minimal origin are the two segments of
DNA sequence highly conserved within the origins of the
single-stranded DNA bacteriophages 4k, a3, st-1, and G4.
Not contained within the sequence is over 50% of the region
of homology to the bacteriophage lambda origin of DNA
replication. The role of secondary structure at primasedependent origins of complementary-strand DNA synthesis
has been suggested both by in vitro studies on primase
interaction at these origins and by the sequence conservation
within the regions of potential secondary structure. More
recently, single-base substitutions which disrupt intrastrand
basepairing at stemloop I have been found to affect G4 origin
function in vivo (Lambert et al., submitted). The results
presented in this study confirm the requirement of these
regions of potential secondary structure for G4 origin function in vivo and indicate the need for additional G4 DNA
sequence outside of these regions.
ACKNOWLEDGMENTS
We acknowledge Barbara Funnell and Ross Inman for their
assistance in the electron microscopy and Anne Griep for editorial
assistance. We thank Dan Ray for supplying us bacteriophage
M13AE101.
This study was supported by Public Health Service grants (number GM30822 to R.D.W. and number GM19670 to W.S.R.) from the
National Institutes of Health and National Science Foundation grant
number 08644 to R.D.W. P.F.L. was supported in part by a
University of Wisconsin Biochemistry Department Wharton fellowship. D.A.W. was supported in part by a University of Wisconsin
undergraduate research grant.
LITERATURE CITED
1. Arai, K., and A. Kornberg. 1981. Unique primed start of phage
4X174 DNA replication and mobility of the primosome in a
direction opposite chain synthesis. Proc. Natl. Acad. Sci. USA
78:69-73.
2. Benz, E., D. Reinberg, R. Vicuna, and J. Hurwitz. 1980. Initiation of DNA replication by the dna G protein. J. Biol. Chem.
255:1096-1106.
3. Bouche, J.-P., L. Rowen, and A. Kornberg. 1978. The RNA
primer synthesized by primase to initiate G4 DNA synthesis. J.
Biol. Chem. 253:765-769.
4. Bouche, J.-P., K. Zechel, and A. Kornberg. 1975. Dna G gene
product, a rifampicin resistant RNA polymerase, initiates conversion of a single stranded coliphage DNA to its duplex
replicative form. J. Biol. Chem. 250:5995-6001.
5. Brutlag, D., R. Schekman, and A. Kornberg. 1971. A possible
role of RNA polymerase in the initiation of M13 DNA synthesis.
Proc. Natl. Acad. Sci. USA 68:2826-2829.
6. Dressier, D., D. Howicade, K. Koths, and J. Sims. 1979. The
DNA replication cycle of the isometric phages, p. 187-214. In
D. Denhardt, D. Dressler, and D. Ray (ed.), The single stranded
DNA phages. Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.
7. Dumas, L., S. Goltz, and D. Benesh. 1974. Host cell DNA chain
initiation protein requirements for replication of bacteriophage
G4 replicative form DNA. J. Virol. 31:370-375.
8. Fiddes, J., B. Barrell, and N. Godson. 1978. Nucleotide sequences of the separate origins of synthesis of bacteriophage G4
viral and complementary DNA strands. Proc. Natl. Acad. Sci.
USA 75:1081-1085.
9. Fuller, R. S., J. M. Kaguni, and A. Kornberg. 1981. Enzymatic
replication of the origin of the E. coli chromosome. Proc. Natl.
Acad. Sci. USA 78:7370-7374.
10. Furth, M. E., and S. H. Wickner. 1983. Lambda DNA replication, p. 145-173. In R. Hendrix, J. Roberts, F. Stahl, and R.
Weisberg (ed.), Lambda II, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
11. Godson, N. 1974. Evolution of 4~X174: isolation of four new
4X-like phages and comparison with 4X174. Virology 58:
272-289.
12. Horiuchi, K., and N. D. Zinder. 1976. Origin and direction of
synthesis of bacteriophage Fl DNA. Proc. Natl. Acad. Sci.
USA 73:2341-2345.
13. Hourcade, D., and D. Dressler. 1978. The site specific initiation
of a DNA fragment. Proc. Natl. Acad. Sci. USA 75:1652-1656.
14. Imber, R., R. Low, and D. Ray. 1983. Identification of a
primosome assembly site in the region of the ori 2 replication
origin of the E. coli mini-F plasmid. Proc. Natl. Acad. Sci. USA
80:7132-7136.
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
The minimal origin sequence includes regions of potential
secondary structure, stemloops I and II, present in the gene
F-G intercistronic region (Fig. 6). Neither region of secondary structure alone, however, was sufficient for origin function. Of particular interest are the subclones mRZ1212 and
mRZ1213, which contain stemloop II and stemloop I, respectively. The infectious growth related of these constructs
were no higher than that of the vector mRZ1000. DNA in
addition to these regions of potential secondary structure
must be necessary, based upon the origin-deficient character
of deletion endpoint mRZ1221. This deletion contains G4
DNA sequence information up to and including the last base
involved in stemloop II structure. The additional G4 DNA
sequence present to the left of stemloop II in deletion
endpoint mRZ1222 includes part of the direct repeat indicated in Fig. 6. This direct repeat is highly conserved in the
origin sequences of the other primase-dependent singlestranded DNA bacteriophage (25). Furthermore, both copies
of the direct repeat are located within the stemloop regions
of the 4~K origin protected by primase from nuclease digestion (24). Another characteristic of this region is its high
content of A residues, as is true of the region to the right of
stemloop I.
Site-directed mutagenesis. The formation of partial duplexes in vitro between recombinant M13 viral DNAs allows
for the alteration of DNA sequences at nonunique restriction
enzyme sites. In this study, small insertions and deletions
were generated within the G4 origin. The 3-base duplication
at the Avall site (mRZ1207), as well as the 17-base deletion
between the AvaI and Avall sites, resulted in the total loss of
origin function. Both of these mutations destroy 1 bp at the
base of stemloop II and affect the spacer region between
stemloop II and stemloop I. In contrast, the 4-base duplication at the AvaI site (mRZ1206), which only changes the
spacing between stemloop I and II, resulted in a slight
decrease in origin activity as measured by the in vivo and in
vitro assays. Therefore, the strong effect of the mutations in
mRZ1207 and mRZ1208 may be due to the disruption of
457
458
LAMBERT ET AL.
23.
24.
25.
26.
27.
28.
29.
30.
single strand DNA phages. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.
USA 74:5463-5467.
Sims, J., and E. Benz. 1980. Initiation of DNA replication by the
dna G protein: evidence that tertiary structure is involved. Proc.
Natl. Acad. Sci. USA 77:900-904.
Sims, J., D. Capon, and D. Dressler. 1979. DNA G dependent
origins of DNA replication. J. Biol. Chem. 254:12615-12628.
Staudenbauer, W., B. Kessler-Liebscher, D. Schneck, B. van
Dorp, and P. Hofshneider. 1978. Replication of M13 duplex
DNA in vitro, p. 369-378. In D. Denhardt, D. Dressler, and D.
Ray (ed.), The single strand DNA phages. Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.
Taketo, A. 1977. Conversion of bacteriophage G4 single
stranded DNA to double stranded replicative form in dna
mutants of E. coli. Biochim. Biophys. Acta 476:149-155.
Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7
derived system for insertion mutagenesis and sequencing with
synthetic universal primers. Gene 19:259-268.
Webster, R. E., R. A. Grant, and L. A. W. Hamilton. 1981.
Orientation of the DNA in filamentous bacteriophage Fl. J.
Mol. Biol. 152:357-374.
Yu, X.-M., and W. S. Reznikoff. 1984. Deletion analysis of the
CAP-cAMP binding site of the E. coli lac promoter. Nucleic
Acids Res. 12:5449-5464.
Downloaded from jvi.asm.org at Univ of Wisconsin - Mad on March 29, 2007
15. Johnson, R. C., and W. S. Reznikoff. 1984. Copy number control
of TnS transposition. Genetics 107:9-18.
16. Kim, M. H., J. C. Hines, and D. Ray. 1981. Viable deletions of
the M13 complementary strand origin. Proc. Natl. Acad. Sci.
USA 78:6784-6788.
17. Maniatis, T., E. Fritsch, and J. Sambrook. 1982. Molecular
cloning: a laboratory manual. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
18. McMacken, R., M. Wold, J. H. LeBowitz, J. D. Roberts, J.
Mallory, J. A. Wilkinson, and C. Loehrlin. 1983. Initiation of
DNA replication in vitro promoted by the bacteriophage X 0 and
P replication proteins, p. 819-848. In N. Cozzarelli (ed.),
Mechanisms of DNA replication and recombination. Alan R.
Liss, Inc., New York.
19. Miller, J. 1972. Experiments in molecular genetics. Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.
20. Nomura, N., R. L. Low, and D. Ray. 1982. Identification of Col
El DNA sequences that direct single strand to double strand
conversion by a fX174 type mechanism. Proc. Natl. Acad. Sci.
USA 79:3153-3157.
21. Ray, D., J. Cleary, J. Hines, M. H. Kim, M. Strathearn, L.
Kaguni, and M. Roark. 1981. DNA initiation determinants of
bacteriophage M13 and of chimeric derivatives carrying foreign
replication determinants, p. 169-193. In D. Ray (ed.), The
initiation of DNA replication. Academic Press, Inc., New York.
22. Ray, D. S. 1978. In vivo replication of filamentous phage DNA,
p. 325-340. In D. Denhardt, D. Dressler, and D. Ray (ed.), The
J. VIROL.