Journal of Shellfish Research, Vol. 27, No. 3, 593–600, 2008.
FERTILIZATION INTERFERENCE BETWEEN CRASSOSTREA ARIAKENSIS
AND CRASSOSTREA VIRGINICA: A GAMETE SINK?
DAVID BUSHEK,* ANDREA KORNBLUH, HAIYAN WANG, XIMING GUO,
GREGORY DEBROSSE AND JOHN QUINLAN
Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers, The State
University of New Jersey, 6959 Miller Avenue, Port Norris, New Jersey 08349
ABSTRACT Published data indicate that spawning seasons for the Asian oyster Crassostrea ariakensis and the eastern oyster
C. virginica overlap. Hybrids can form, but the larvae are not viable. If C. ariakensis is introduced into Chesapeake Bay and
synchronous spawning occurs with native C. virginica, hybridization could reduce the production of viable larvae (¼gamete sink).
We examined the effects of gamete age, sperm concentration, and ratios of heterospecific gametes on fertilization rates and
hybridization between the two species. Interspecific fertilization rates were consistently lower than intraspecific rates. Fertilization
rates decayed linearly with gamete age, though intraspecific fertilization rates remained above 50% for 4–6 h, indicating that long
dispersal of viable gametes is possible. Fertilization rates decayed in a log-linear manner with decreasing sperm density for intra
and interspecific crosses. Fertilization rates declined significantly when sperm were (1) given a choice of eggs from each species to
fertilize or (2) required to compete to fertilize eggs from a single species. Hence, a gamete sink will likely occur if these two species
spawn synchronously. The magnitude of the gamete sink will depend on both gamete concentrations and the relative proportion
of interspecific gametes in the water column. Furthermore, genetic analysis of individual 2-day old larvae indicated that C.
virginica sperm was more likely to fertilize C. ariakensis eggs than any other interspecific cross. All else being equal, the removal of
C. ariakensis eggs through this mechanism may provide C. virginica with a competitive edge.
KEY WORDS: Oyster, non-native, introduction, competition, Chesapeake Bay, Suminoe oyster, Crassostrea ariakensis
INTRODUCTION
The Eastern oyster Crassostrea virginica (Gmelin 1791) was
once so abundant in Chesapeake Bay that some estimates
indicate the population had the potential to filter a volume of
water equivalent to the entire Bay in three to four days (Newell
1988). After a century of heavy fishery exploitation, habitat
degradation, and the spread of two detrimental oysters diseases
(MSX and dermo), the commercial Chesapeake Bay oyster
fishery is struggling to survive. The extensive oyster populations
that once provided a variety of ecological services (e.g., water
filtration, nutrient cycling) are no longer large enough to fill
those roles. Moreover, diseases have inhibited sustainable and
economically viable aquaculture efforts. In an attempt to
resolve these issues, efforts to identify a disease-resistant oyster
species that could prosper in present day Chesapeake Bay have
been pursued for many years. The current species of interest is
the Suminoe oyster C. ariakensis (Fujita 1913) (formerly C.
rivularis). Recently, the state of Maryland has proposed to
introduce diploid C. ariakensis into Chesapeake Bay to establish naturally reproducing populations.
The proposed introduction of Crassostrea ariakensis into
Chesapeake Bay presents a number of potential risks that
require careful examination and research prior to approval
(see Breitburg et al. 2004, NRC 2004, Hallerman et al. 2001).
Crassostrea ariakensis was identified as a candidate for introduction into Chesapeake Bay because of its apparent resistance
to MSX and dermo disease and its ability to survive and grow in
estuarine habitats. Populations of C. virginica are, however, still
present in portions of the Bay, as well as adjacent estuaries, and
there are multiple active efforts to restore or enhance native
populations. Thus, it is almost a forgone conclusion that the
two oyster species will compete for resources. Just how this
*Corresponding author. E-mail: [email protected]
interaction will unfold is difficult to predict. It is possible that
the two will find their own niches and coexist with little impact
on one another. Alternatively, one may compete so effectively
that it eliminates the other. Reality is likely to fall somewhere in
between, but data to predict the outcome of their interactions
are lacking. One potentially significant interaction that can be
examined experimentally in the laboratory is the extent that
gametes may compete during spawning.
Hybridization studies have shown that gametes of these two
species can form larvae, but the larvae do not survive (Allen
et al. 1993). These results have lead to concerns over gamete
competition, sometimes called the ‘‘gamete sink hypothesis,’’ in
which synchronous spawning may lead to the formation of
inviable larvae, therefore removing the potential contribution
of those gametes to the next generation. If the ratio of inter to
intraspecific crosses is high, the impact could be significant. This
concern has been regularly cited in workshops and reviews in
the existing literature (NRC 2004, Breitburg et al. 2004, Hallerman et al. 2001), but there is little information to substantiate
the concern. With essentially no information on the potential
for gamete competition, other than the fact that the two species
can form inviable larvae under typical hatchery conditions
(Allen et al. 1993), it is nearly impossible to predict what might
happen under field conditions.
The extent that gametes compete will depend upon a variety
of factors including the timing of spawning, the ability of one
species to stimulate the other to spawn, gamete longevity, and
the density of sperm (Levitan et al. 1991, Levitan et al. 1992,
Levitan 1998, Yund & Meidel 2003). Spawning seasons for
oysters are long and generally occur during the warmer months
of the year. Reports in the literature for C. ariakensis support
this pattern (reviewed in Zhou & Allen 2003, NRC 2004),
although recent studies indicate that species identifications may
have been confused in previous studies of Asian oysters (Wang
et al. 2004a). To better understand how C. ariakensis might
593
BUSHEK ET AL.
594
behave in Chesapeake Bay, Erskine (2003) documented and
compared gonadal development of triploid C. ariakensis concurrently deployed with diploid C. virginica at several locations
in the Bay. Whereas his data demonstrate that the triploid
gonads failed to mature, his data indicate that, had diploid
C. ariakensis been deployed, the two species could have
followed essentially identical gametogenic cycles. Thus, whereas
gamete competition requires synchronous spawning, it seems
that such events are possible both within and outside the
Chesapeake Bay.
Little information exists on gamete competition among
coexisting oyster species. Information available on gamete
competition for other marine broadcast spawners is also
limited, but extensive work on sea urchins (e.g., Levitan et al.
1991, Levitan et al. 1992, Levitan 1998, 2002, Yund & Meidel
2003) provides insight that helps identify those critical data
needed to begin to estimate gamete interactions between closely
related species. In the present study, we address gamete
longevity (i.e., the time that gametes remain viable and capable
of forming larvae), the effects of sperm density on fertilization
success in both intra and interspecific crosses, and how the
relative abundance of competing gametes might affect fertilization success.
METHODS
Experimental Design
A series of experiments were conducted to develop a better
understanding of potential gamete interactions between
C. virginica and C. ariakensis. First, we examined gamete
longevity by determining the ability of gametes to form larvae
over time for intra and interspecific (hybrid) crosses. Next we
determined how sperm concentration affects fertilization rate
for intra and interspecific crosses. Finally, two series of experiments manipulated gamete concentrations to examine gametic
interactions directly. In one series, sperm from either C. virginica or C. ariakensis, not both, were added to mixtures of eggs
from both species and allowed to ‘‘choose’’ which species of
eggs to fertilize. Henceforth, these are referred to as ‘‘sperm
choice’’ experiments. In the other series, sperm from both
species were mixed in varying proportions and then added
to a suspension of eggs of one species or the other. In this
manner, sperm from the two species ‘‘competed’’ to fertilize
conspecific or congeneric eggs, hence these experiments are
termed ‘‘sperm competition.’’ All of these experiments were
performed at the Haskin Shellfish Research Laboratory
(HSRL) and its Cape Shore Hatchery facility during spring
and summer of 2005.
Brood Stock
Crassostrea virginica brood stock were obtained from Delaware Bay in ripe condition or conditioned in recirculating
tanks at HSRL. Crassostrea ariakensis of the North American
west coast lineage (WCA ¼ oysters that were inadvertently
introduced into Oregon with shipments of C. gigas) were
conditioned under quarantine in a parallel recirculating system
at HSRL. Once ripe, both species were maintained at 19°C in
20–25 psu recirculating 1 mm-filtered seawater (FSW), and fed a
mixed algal diet comprised of Isochrysis spp., Chaetoceros spp.
and Pavlova spp. until needed for experiments. All water
contacting C. ariakensis was chlorinated for a minimum of 24
h before disposal, and all C. ariakensis tissues remaining from
experiments were baked for a minimum of 24 h at 60°C before
disposal.
Gametes
Gametes were stripped from ripe brood stock using routine
hatchery methods (e.g., Allen & Bushek 1992). Each species was
handled separately in different areas of the laboratory to
prevent cross contamination of gametes. Oysters were separated
by sex and processed separately to prevent inadvertent fertilization. Eggs were combined from at least three ripe females,
passed through an 80-mm sieve, and retained on a 20- or 25-mm
sieve. The cleaned eggs were then resuspended in UV-irradiated
1-mm FSW and enumerated with a Sedgewick-Rafter counting
chamber. Sperm were combined from at least three males after
checking that sperm were motile and then passed through a
25-mm sieve into a clean beaker to remove large pieces of tissue.
For each experiment, a team of technicians worked together to
ensure that gametes were obtained more or less simultaneously
from each species.
The quantity of sperm used in experiments was based on
standard HSRL Cape Shore Hatchery protocols designed to
maximize fertilization rate for C. virginica, whereas minimizing
risks of polyspermy. Specifically, prior to each experiment,
sperm were added to test suspensions of 10,000 conspecific eggs
mL–1 until 5–7 active sperm were observed physically contacting each egg under microscopic examination. The amount of
sperm suspension added to any given treatment was based on
the volume needed to achieve the observed 5–7 sperm per egg
ratio. This protocol corrects for differences in sperm motility
among males, species, experiments and replicates.
Gamete Longevity
The amount of time that gametes remain viable was
estimated on July 6, 2005 by repeatedly conducting intra and
interspecific crosses with the same set of gametes over a period
of 17 h. Fertilizations were conducted in 20 psu FSW in 50-mL
conical centrifuge tubes at 27°C. Gametes from three females
and three males were collected and combined as described
above. Initial fertilizations were conducted as soon as all
gametes had been collected and then at intervals of 1.8, 3.5,
4.75, 7.75, and 17 h. Gametes were added to achieve a concentration of 5–7 sperm in contact with each egg as described
above. Between intervals, gametes were left suspended in 20 psu
UV-irradiated 1 mm FSW at room temperature (23.5°C to
28.0°C) during the course of the experiment. Following a 1–2 h
incubation period, a few drops of the mixed gamete suspension
were examined on a depression slide. The fertilization rate was
calculated as the percentage of eggs that had begun dividing up
to this point. A minimum of 100 eggs was examined for each
estimate and at least two replicate samples were counted for
each fertilization by separate observers. The experiment was not
replicated, but gametes from multiple parents were used to
reduce the chance that results were dependent on the quality of
gametes from any one oyster. Data were arcsine-transformed
for analysis as a standard protocol for proportional data, then
back-transformed for presentation here (Sokal & Rohlf 1981).
A GAMETE SINK BETWEEN ASIAN AND EASTERN OYSTERS
Effects of Sperm Density
To compare the effects of sperm density on fertilization rates
for intra and interspecific crosses, eggs of each species were
exposed separately to conspecific or heterospecific sperm from a
dilution series as follows. A concentration of 31 represented
the 5–7 sperm per egg concentration determined empirically as
described earlier for intraspecific crosses; other concentrations
were created by diluting the original sperm suspension accordingly to achieve 2-fold, 5-fold, and 10-fold serial dilutions up to
a maximum of a 500-fold dilution. The experiment was repeated
on July 6, July 20, August 10, and August 17, 2005 for intraspecific crosses. On July 6 and August 17, interspecific crosses
were also completed, and on July 6 sperm concentrations were
increased above 31 for these hybrid crosses. For each treatment, eggs were suspended at a concentration of 10,000 mL–1 in
20 mL of 20 psu UV-irradiated 1 mm FSW in 50-mL conical
centrifuge tubes. After adding sperm, the tubes were capped and
inverted several times to thoroughly mix the gametes. Fertilization rates were estimated as described above 1 h after the
addition of sperm. Developing embryos were then diluted to a
concentration of 10 mL–1 in a static culture without aeration
and the number of larvae surviving to D-stage determined on
day two for each treatment.
595
were collected on a 25-mm sieve, enumerated and a sample
preserved in 95% EtOH for genotyping (see below) to determine the proportions of pure and hybrid individuals. Replicates
were successfully completed on July 12, August 10, and August
17, 2005 using multiple parents on each date.
Sperm Competition Experiments
For these experiments, two series of 50-mL tubes were
established with tubes in one series containing 200,000 C.
ariakensis eggs per tube in 20 mL of sterile FSW and the other
series containing an equal number of C. virginica eggs. Each
series was fertilized with reciprocal mixtures of sperm with one
species decreasing from 100–90% to 50–10% to 0%, whereas
the other increased in an equivalent manner (Table 1). The total
final concentration of sperm in each tube was one tenth of the
standard HSRL hatchery concentration or 0.5–0.7 sperm
contacting each egg upon visual inspection. As earlier mentioned, only straight or hybrid crosses were possible in tubes at
either end of each series. Fertilization rates, maintenance to day
two, and subsequent sampling were conducted as described
earlier for sperm choice experiments. These experiments were
completed simultaneously with the sperm competition experiments above using the same sets of gametes for a total of three
replicate trials.
Sperm Choice Experiments
Two series of 50-mL conical centrifuge tubes were established, each containing a total of 200,000 eggs in 20 ml of sterile
FSW (Table 1). The percentage of eggs from one species
decreased along the series 100%, 75%, 50%, 25%, or 0%,
whereas eggs from the other species increased reciprocally. Each
series was fertilized with only one species of sperm, using a 10fold dilution of the empirically determined 5–7 sperm per egg
hatchery concentration (i.e., final concentration of sperm was
0.5–0.7 sperm observed contacting each egg within 1–2 min). At
each end of the series only straight or hybrid crosses were
possible. Fertilization rates were estimated from samples collected between 1 and 2 h after sperm was added. The embryos
were then added to separate buckets containing 15 L of sterile
FSW and allowed to develop for two days. On day two, larvae
TABLE 1.
Experimental design of fertilization trials for sperm choice and
sperm competition experiments. Capital letters denote eggs, lower
case letters denote sperm. A $ C. ariakensis, V $ C. virginica.
See text for detailed description.
Sperm Choice
Sperm Competition
A
V
a
v
A
V
a
v
100%
75%
50%
25%
—
100%
75%
50%
25%
—
—
25%
50%
75%
100%
—
25%
50%
75%
100%
100%
100%
100%
100%
100%
—
—
—
—
—
—
—
—
—
—
100%
100%
100%
100%
100%
100%
100%
100%
100%
100%
—
—
—
—
—
—
—
—
—
—
100%
100%
100%
100%
100%
100%
90%
50%
10%
—
100%
90%
50%
10%
—
—
10%
50%
90%
100%
—
10%
50%
90%
100%
Genotyping of Larvae
Individual larvae from the gamete competition experiments
were isolated using a micromanipulator and placed in 10 mL
sterile water. DNA was extracted by incubating individual larva
in 20 mL lysis buffer (3 mM Tris-HCl PH 8.0, 15 mM KCl,
0.015 mM EDTA, 0.5% Tween-20, 0.5 mg/mL proteinase-K)
for 3 h at 55°C, followed by heating for 30 min at 90°C (Taris
et al. 2005). Larvae were individually classified as pure C.
virginica, hybrids or pure C. ariakensis using the ITS (internal
transcribe spacers between major ribosomal RNA genes) assay
developed by Wang and Guo (2008). The two species differ in
both ITS1 (between 18S and 5.8S) and ITS2 (between 5.8S and
28S) length, and can be readily separated. Primers for ITS1 were
5#-AAGGTTTCCGTAGGTGAACCTGC (forward) and 5#CACACGAGCCGAGTGATCCACC (reverse); those for
ITS2 were 5#-AATTGCAGGACACATTGAACATCG (forward) and 5#-GTCTCGCCTGATCTGAGGTCGG (reverse).
The PCR mixture (25 mL) contained 5–10 mL template DNA,
2.0 mM of MgCl2, 200 mM each of dNTP, 0.2 mM of each
primer, and 0.5 U Taq DNA polymerase in 2.5 mL 3 10 buffer.
PCR was performed on a PE 9700 thermal cycler with the
following protocol: 5 min at 95°C; 40 cycles of 1 min at 95°C, 1
min at 60°C, and 1 min extension at 72°C; and a final 5 min
extension at 72°C. PCR products were then separated on 1.5%
(w:v) agarose gels and visualized by ethidium bromide staining
(1 mg/ml).
Statistics
For all experiments, fertilization rates (as proportions) were
arcsine-square root transformed for statistical analyses and
then means and errors back-transformed for presentation.
Effects of time (gamete longevity) and sperm dilution among
crosses were compared graphically. The effect of sperm dilutions was log-linear and therefore plotted as such to reveal a
BUSHEK ET AL.
596
more linear relationship. Log10 sperm concentrations were used
for statistical analyses. Regressions were calculated to determine the effect of time (gamete age) and the effect of sperm
dilution on fertilization. Analysis of covariance (ANCOVA)
was used to compare regressions among the different crosses
after checking for homogeneity of slopes with a two-factor
general linear model (GLM). For sperm choice and sperm
competition experiments, the end members of each treatment
series, where only pure or hybrid crosses were possible, provided internal standards for percent fertilization success in the
other treatments. That is, assuming fertilization success is a
result of gamete encounter rates and that gamete encounter
rates occur indiscriminately with respect to species (i.e., no
preference), an expected fertilization rate was calculated by
multiplying the observed fertilization rates of the end members
from each series by the gamete proportions in the intervening
treatments. One-way analysis of variance (ANOVA) was used
to compare means of pure and hybrid crosses. Observed
fertilization rates of intervening crosses were tested against
expected rates using a two-tailed, paired t-test. Expected
hybridization rates were determined as the possible number of
pure and hybrid crosses, based on gamete mixtures and
compared against observed values with a two-tailed chi-square
analysis. Statistical analyses were completed using the software
program SYSTAT (Wilkinson 1990) after validating that data
met statistical assumptions for respective analyses.
RESULTS
Gamete Longevity
Regardless of the particular cross, fertilization rate declined
as gametes aged (Fig. 1). After 17 h, little or no fertilization
(<20%) was observed in all crosses. Linear regressions of
percent fertilization against gamete age explained 60% to
92% of the observed variation and had P values less than or
near 0.05 (Table 2). A two-factor GLM on all four crosses
Figure 1. Results of gamete longevity experiment showing effects of time
on fertilization success. Fertilization rate was measured 1–2 h postfertilization (n $ 1). Each cross contained multiple male and female parents.
Legend indicates parentage: ÔAÕ $ C. ariakensis females, ÔaÕ $ C.
ariakensis males, ÔVÕ $ C. virginica females, ÔvÕ $ C. virginica males.
Age represents time lapse after gametes had been stripped from mature
adults, rinsed and resuspended in FSW.
TABLE 2.
Results of regression analyses for gamete longevity and sperm
concentration experiments. Notation for crosses: capital letters
denote eggs, lower case letters denote sperm. A $ C. ariakensis,
V $ C. virginica.
Gamete Longevity
Sperm Dilution
Cross
Slope
R-square
P-value
Slope
R-square
P-value
Aa
Av
Va
Vv
–0.043
–0.015
–0.018
–0.061
0.63
0.75
0.60
0.92
0.058
0.026
0.070
0.002
–0.46
–0.33
–0.22
–0.28
0.90
0.86
0.85
0.84
<0.0005
<0.0005
<0.0005
<0.0005
contained a significant interaction (P ¼ 0.016) between cross
and gamete age indicating that slopes were different among
crosses. Inspection of Figure 1 reveals that the significant
interaction among all crosses is largely caused by the inherently
higher fertilization for intra versus interspecific crosses: intraspecific fertilization rates were 80% to 90% at time zero and
remained above 50% for 4–6 h, whereas interspecific fertilization rates were only 30% to 40% at time zero and fell below
20% within 4–6 h. Slopes were not different within intraspecifc
(P ¼ 0.698) or interspecific (P ¼ 0.384) crosses, and subsequent
ANCOVAs were not significant (P ¼ 0.538 and P ¼ 0.109,
respectively). Survival to D-stage followed the same patterns
(data not shown). Although not quantified, the percentage of
abnormally developing larvae appeared to be greater with older
gametes.
Effects of Sperm Density
Fertilization rates declined linearly across the log dilution of
sperm in all crosses (Fig. 2). As with the gamete longevity,
Figure 2. Results of sperm dilution experiments. Fertilization rate was
measured 1–2 h postfertilization. Data are means %1 sd; n $ 4 for
intraspecific crosses and n $ 2 for hybrid crosses; some error bars are
smaller than symbols and data for dilution factors <1 were not replicated.
Legend indicates parentage: ÔAÕ$ C. ariakensis females, ÔaÕ C. ariakensis
males, ÔVÕ $ C. virginica females, ÔvÕ $ C. virginica males. A sperm
dilution factor of 1$ empirically determined concentration that produced
an average of 5–7 active conspecific sperm contacting each egg within 1–2
min after the addition of sperm to a suspension of 10,000 eggs ml–1. Higher
dilution factors $ lower sperm concentrations. Egg concentration
remained constant at 10,000 eggs ml-1 across all sperm dilutions.
A GAMETE SINK BETWEEN ASIAN AND EASTERN OYSTERS
survival to D-stage on day two followed the same pattern and is
not shown. Linear regressions were highly significant for each
cross and accounted for 84% to 90% of the observed variation
(Table 2). Two factor GLMs indicated significant interactions
when all crosses were compared (P < 0.0005), within intraspecific crosses (P < 0.0005), and within interspecific crosses (P ¼
0.006), indicating that slopes were significantly different and
precluding any ANCOVA comparisons. As with longevity,
fertilization rates were greater for intra versus interspecific
crosses (Fig. 2). Fertilization rates for intraspecific crosses
remained high, averaging more than 75%, until concentrations
were diluted 10-fold or more. Furthermore, C. virginica sperm
was consistently better at fertilizing C. ariakensis eggs than the
converse. Note that increasing C. virginica sperm densities by a
factor of two or more above the 5–7 sperm per egg concentration increased fertilization rates of C. ariakensis eggs to levels
near maximum rates observed when C. ariakensis sperm was
used (Fig. 2). In contrast, only a marginal increase in fertiliza-
597
tion rate of C. virginica eggs was observed when concentrations
of C. ariakensis sperm were increased by a factor of four.
Sperm Choice
Fertilization rates declined across gamete mixtures as conspecific eggs were gradually replaced with congeneric eggs (Fig.
3). A single factor ANOVA comparing the 100% congeneric
mixtures with the 100% conspecific mixtures (the two center
columns vs. the two outer columns in Fig. 3) demonstrated that
fertilization rates were significantly lower when hybridization
was required for fertilization to occur (P ¼ 0.01). A two-tailed
paired t-test indicated that observed values for intervening
mixtures of eggs were significantly lower than expected (P ¼
0.011). Note that for both 100% conspecific and 100% congeneric gamete mixtures, the observed and expected values, by definition, were equivalent and were therefore excluded from statistical
analyses here and for sperm competition described below.
Figure 3. Results from sperm choice (upper) and sperm competition (lower) experiments. Data are means of three replicates +/–1 sd. Legend indicates
parentage: ÔAÕ $ C. ariakensis females, ÔaÕ C. ariakensis males, ÔVÕ $ C. virginica females, ÔvÕ $ C. virginica males. Solid columns are calculated
expectations based on pure straight and pure hybrid crosses (see text); open columns represent observed values. Pure C. ariakensis gamete mixtures are
depicted on the far left and pure C. virginica gamete mixtures are depicted on the far right. The two center columns represent forced hybrid crosses where
only one kind of gamete from each species was present.
BUSHEK ET AL.
598
Sperm Competition
Similarly to the sperm choice experiments, fertilization rates
declined as conspecific sperm was gradually replaced with
congeneric sperm. In agreement with observations described
above for gamete longevity, sperm dilution and sperm choice
experiments, fertilization rates were significantly lower in the
100% congeneric treatments compared with the 100% conspecific treatments (single factor ANOVA, P ¼ 0.036, Fig. 3). In
contrast to the sperm choice results, however, the observed
values for intervening mixtures under conditions of sperm
competition were significantly greater than expected (two-tailed
paired t-test P ¼ 0.003, Fig. 3).
Genotyping of Larvae
Genetic analysis of two-day old larvae allowed discrimination of hybrid and straight crosses for individual larvae as well
as an estimation of cross-contamination for both sperm choice
and sperm competition experiments (Fig. 4). From a total of
1,499 individual larvae, 1,026 produced successful PCR amplifications. In 17 cases (<2%), the observed genotype was not
possible from the mixture of gametes used, indicating potential
cross-contamination in the hatchery, cross-contamination
when picking larvae for genotyping, or genotyping error. These
larvae were excluded from statistical analyses and an error rate
of <2% would not alter interpretations of results. Figure 5
compares the observed and expected proportions of straight
and hybrid larvae for each cross. Chi-square analyses indicated
that hybrids were less likely to be present on day two than
expected (P < 0.05), with the exception of crosses where
C. virginica sperm was used to fertilize mixtures of C. ariakensis
and C. virginica eggs. When C. virginica sperm fertilized a
mixture of eggs of the two species, the proportion of hybrids
observed reflected the proportionate mixture of eggs.
DISCUSSION
Crassostrea ariakensis and C. virginica are closely related
oyster species whose evolutionary history has enabled them to
exploit comparable sedimentary estuaries along the western
coasts of the Pacific and Atlantic oceans. Although recent data
suggest that there may be some confusion in identification of
C. ariakensis in literature referencing populations from the
Figure 4. Example larval identification by multiplex PCR with ITS1 and
ITS2 primers. Intraspecific crosses contained two bands in different
locations for each species, whereas hybrids contain bands in all four
locations. Lane 1 $ C. virginica control; lane 2 $ C. ariakensis control;
lanes 3, 5–8 $ larvae identified as C. ariakensis; lanes 9–11 $ larvae
identified as C. virginica; and lane 4 $ a hybrid larva.
Figure 5. Comparison of observed genetic frequencies versus expected
values. Open, shaded and black areas of columns represent observed
proportions of C. ariakensis, hybrids and C. virginica, respectively. Dots
within columns represent expected values based on the proportions of
gametes that were mixed together.
Western Pacific (Wang et al. 2004a, Wang et al. 2004b) reviews
of that literature suggest that the two species have overlapping
spawning cycles (see Zhou & Allen 2003 and references therein).
Accumulating data support the contention that the two species
inhabit physically similar systems in their native ranges (Guo
et al. 2006, Wang et al. 2006b) and that their reproductive cycles
will likely overlap in Chesapeake Bay (Erskine 2003, Merritt
et al. 2004a). Data from continuing and additional efforts will
further test the extent that reproductive cycles overlap and what
conditions in Chesapeake Bay might stimulate C. ariakensis to
spawn (Merritt et al. 2004a, Merritt et al. 2004b, Newell et al.
2006). Allen et al. (1993) demonstrated that whereas hybrids
can form, they do not survive under hatchery conditions
implying that such crosses would not likely survive in the
environment. Their observations clearly indicate that a ‘‘gamete
sink’’ will occur if the two species are provided the opportunity
to spawn in close proximity and synchronous spawning occurs.
The present study demonstrates that the gamete sink may
include a reduction in fertilization rate that compounds the
losses caused by the formation of inviable larvae. That is,
synchronous spawning could reduce larval production through
a decrease in fertilization rates and the formation of inviable
hybrid larvae.
The ability for either C. ariakensis or C. virginica to stimulate
the other to spawn is an important question that researchers at
other laboratories are currently addressing (MD DNR 2006). If
gametes from one species stimulate the other species to spawn as
A GAMETE SINK BETWEEN ASIAN AND EASTERN OYSTERS
some preliminary data suggests (Merritt et al. 2004a, Merritt
et al. 2004b), then gamete competition would be intensified.
If, on the other hand, spawning of one species inhibits the
spawning of the other, then gamete competition is less likely
to occur. Such stimulatory and inhibitory interactions may be
moot, however, because other environmental factors such as
changes in temperature and/or salinity apparently trigger
spawning in both species (Thompson et al. 1996, Zhou and
Allen 2003). Whether temperature and salinity act as spawning
stimuli in the same way for both species is currently under
investigation by researchers at other institutions (MD DNR
2006). Until data are produced that demonstrate otherwise,
existing information leads to the conclusion that synchronous
spawning and therefore gamete competition is likely to occur in
Chesapeake Bay at some level. The present study is the first
attempt to quantify the extent to which gametes will interact to
create a sink, assuming synchronous spawning occurs in
reasonably close proximity. Results indicate the magnitude of
the sink is dependent on gamete concentrations, proportions,
dispersal, and longevity.
Gamete longevity defines the time span available for fertilization to occur and determines potential dispersal distances,
both of which influence the probability of encountering other
gametes. In theory, a density of one sperm per egg is all that is
needed to obtain 100% fertilization, but each sperm must find
an unfertilized egg and successfully penetrate the egg membrane. As demonstrated by Levitan et al. (1992), fertilization
rates can plummet dramatically even when sperm densities are
several times higher than one per egg. (Note that Levitan et al.
(1992) and others often use absolute densities when referring to
sperm concentration, but our densities refer to the number of
sperm in contact with each egg (i.e., the absolute concentration
of sperm in our fertilization suspensions was greater than 5–7
per egg). Hence, as gametes disperse in the environment sperm
density changes, sperm interactions change, and sperm-egg
interactions change. Our results indicate that fertilization still
occurs even after several orders of magnitude of dilution, and
that the amount or density of sperm required to initiate hybrid
fertilization is much higher than that required for straight
crosses as reported by Lyu and Allen (1999). Intuitively, one
would suspect that the species whose sperm are most abundant
would be most likely to fertilize most of the available eggs.
Which species provides the most abundant sperm is likely to
vary temporally and spatially during any given spawning season
and which sperm is successful is influenced by longevity and
sperm density. Such variation may provide the opportunity for
coexistence or lead to local extinction of the species with the less
successful sperm. Sperm may, however, be more likely to
fertilize eggs from their own species when both are present.
Intuitively, it makes sense that naturally coexisting species
with genetic incompatibilities that would lead to a gamete sink
will have coevolved mechanisms to maximize the likelihood of
fertilization with conspecific gametes, whereas minimizing
hybridization and the production of nonviable larvae (Levitan
1998, Levitan 2002, Yund & Meidel 2003). Such mechanisms
may include separation of reproductive cycles or differences in
spawning cues, but may not exist when a novel species is
introduced. In the current study, fertilization rates and the formation of larvae were consistently lowest in treatments where
only hybrids could form (i.e., Va or Av crosses). Furthermore,
hybrid fertilization and larval production was consistently
599
greater when C. virginica sperm fertilized C. ariakensis eggs
compared with the reverse hybrid cross. Both of these observations agree with those of Allen et al. (1993). This pattern is
further substantiated by our genetic analysis (see Fig. 5) that
shows only C. virginica sperm in mixtures of eggs from both
species produced hybrids at expected frequencies. These data
indicate that interspecific barriers to hybridization exist and
may explain the observed reductions in expected hybridization.
Because the two species are native to different oceans, such
incompatibilities could have evolved via genetic drift, but why
the incompatibility is not symmetrical between reciprocal
hybrid crosses is unclear. We did not combine both kinds of
gametes from both species simultaneously. Instead, one species
was always forced to form a hybrid or form nothing at all. This
simplified the interpretation of our results, but begs the
question, if given a choice, would hybrids form. The fact that
C. virginica sperm can more easily fertilize C. ariakensis eggs
suggests that C. virginica may have a slight competitive edge in
this struggle among gametes to form viable nonhybrid larvae.
Results from longevity and sperm dilutions experiments
point to life history strategies that should increase the probability of successful fertilization. Although fertilization success
declined linearly over time, it remained reasonably high (>50%)
over 4–6 h for intraspecific crosses. Likewise, intraspecific
fertilization remained reasonably high even after sperm had
been diluted several orders of magnitude from concentrations
that would be released during spawning. The log-linear relationship of fertilization rate with sperm dilution shown in
Figure 2 can be partially explained by the dilution of gametes
in three dimensions and the concomitant reduction in gamete
encounter rate. Levitan et al. (1991) found similar effects for
both sperm concentration and gamete age on fertilization rates
with sea urchins. They also found that diluted sperm lost
viability faster than concentrated sperm. Hence, as a cloud of
sperm drifts, dilution will likely reduce viability faster than
when sperm are maintained at high concentrations in the
laboratory. Most estuaries are defined as well-mixed systems,
but discrete water masses are often present and could reduce
dilution rates of gametes. Any physical processes that concentrate particles will also act on gametes. Such processes may be
important in the spawning and fertilization success of oysters
and could affect potential interactions between these two
species. Conceivably, a cloud of gametes from one species could
drift quite a distance over a relatively short period before
encountering a spawning population of the other species and
begin to form hybrids, thereby reducing the number of viable
larvae produced. Overall, gamete interactions between these
two species seem to be negative in the sense that their interaction
reduces successful fertilization and the production of viable
larvae. Furthermore, whereas a variety of factors could sway
the outcome of gamete interactions in favor of one species or the
other, all else being equal, C. virginica seems to have a competitive edge over C. ariakensis because viable C. virginica
larvae are more likely to form than are C. ariakensis larvae
when gametes of both species are mixed.
In conclusion, several outcomes of gamete competition are
possible. The data presented earlier provide an initial basis for
generating models to test hypotheses about how such interactions might proceed over time. For example, if C. virginica
sperm outcompete C. ariakensis sperm for eggs, then C. virginica may be able to prevent C. ariakensis from establishing itself
600
BUSHEK ET AL.
in areas where C. virginica still maintains viable populations. If
true, C. ariakensis may be limited to areas where disease
currently limits C. virginica. Carrying this speculation further,
C. ariakensis could act as a sink for dispersing stages of MSX
and dermo disease, locally reducing rates of transmission. After
reducing transmission, and assuming other interspecific competitive interactions are negligible, such an effect could eventually enable C. virginica to re-establish viable populations in
those formerly disease prone areas. It may be, however, that
fecundities are so high that losses caused by hybridization of
gametes are of little consequence. The extent that eggs and
sperm will sort themselves out by species when eggs and sperm
from both species are present may reduce the effects of gamete
competition observed in this study and warrants further
investigation. Unfortunately, predicting the outcome of gamete
competition and its impacts remains highly speculative and
ranges from having trivial to significant implications for the
success of a diploid introduction of C. ariakensis and its impact
on the native oyster population.
ACKNOWLEDGMENTS
I. Burt, D. Jones, R. Koehler and E. Scarpa assisted with
experiments. S. Ford, S. Allen and L. Coen provided helpful
reviews of this manuscript. NOAA Chesapeake Bay Office
Award NA04NMF4570428 provided financial support.
LITERATURE CITED
Allen, S. K., Jr. & D. Bushek. 1992. Large scale production of triploid
Crassostrea virginica (Gmelin) using ‘‘stripped’’ gametes. Aquaculture 103:241–251.
Allen, S. K., Jr., P. M. Gaffney, J. S. Scarpa & D. Bushek. 1993. Inviable
hybrids of Crassostrea virginica (Gmelin) with C. rivularis (Gould)
and C. gigas (Thunberg). Aquaculture 113:269–289.
Breitburg, D., M. Luckenbach & J. Kramer. 2004. Identifying and
prioritizing research required to evaluate ecological risks and
benefits of introducing diploid Crassostrea ariakensis to restore
oysters to Chesapeake Bay. Report of the STAC Workshop,
December 2–3, 2003. Annapolis, MD. STAC Publ. 04-002. 39 pp.
Erskine, A. J. 2003. Gametogenesis in genetic triploid C. ariakensis.
M.S. Thesis. Virginia Institute of Marine Science, 129 pp.
Guo, X., G. Zhang, L. Qian, H. Wang, X. Liu & A. Wang. 2006. Oysters
and oyster farming in china: A review. J. Shellfish Res. 25:734.
Hallerman, E., M. Leffler, S. Mills & S. Allen, Jr. 2001. Aquaculture of
triploid Crassostrea ariakensis in Chesapeake Bay: A symposium
report. Maryland and Virginia Sea Grant. October 18–19, 2001.
Williamsburg, VA. 18 pp.
Levitan, D. R. 1998. Does Bateman’s principle apply to broadcast-spawning
organisms? Egg traits influence in situ fertilization rates among congeneric sea urchins. Evolution Int. J. Org. Evolution 52:1043–1056.
Levitan, D. R. 2002. Density-dependent selection on gamete traits in
three congeneric sea urchins. Ecology 83:464–479.
Levitan, D. R., M. A. Sewell & F. S. Chia. 1991. Kinetics of Fertilization
in the sea urchin Strongylocentrotus franciscanus: Interaction of
gamete dilution, age, and contact time. Biol. Bull. 181:371–378.
Levitan, D. R., M. A. Sewell & F. S. Chia. 1992. How distribution and
abundance influence fertilization success in the sea urchin Strongylocentrotus fransicanus. Ecology 73:248–254.
Lyu, S. & S. K. Allen, Jr. 1999. Effects of sperm density on hybridization
between Crassostrea virginica (Gmelin) and C. gigas (Thunberg). J.
Shellfish Res. 18:459–464.
MD DNR. 2006. Attachment 2: Draft peer review plan for oyster EIS
‘‘Influential Scientific Information’’. 29 pp. Online at: http://www.dnr.
state.md.us/dnrnews/infocus/oysters.asp.
Merritt, D. W., S. K. Allen, Jr., A. Freeman & P. Kingsley-Smith. 2004a.
Spawning interactions between Crassostrea ariakensis and Crassostrea virginica—does the proposed introduction of a new species pose
a recruitment threat to native oysters. Report submitted to Maryland
Department of Natural Resources. October 25, 2004. 14 pp.
Merritt, D. W., S. K. Allen, Jr., A. Freeman & P. Kingsley-Smith. 2004b.
Evaluation of gametogenesis and spawning cues in diploid Crassostrea ariakensis for estimations of environmental risk and establishment of diploid brood stock populations. Report submitted to
Maryland Department of Natural Resources, December 12, 2005.
15 pp.
NRC. 2004. Nonnative Oysters in the Chesapeake Bay. Committee on
Nonnative oysters in the Chesapeake Bay, National Research
Council. 344 pp.
Newell, R. I. E. 1988. Ecological changes in Chesapeake Bay. Are they
the result of overharvesting the American oyster (Crassostrea virginica)? In: M. P. Lynch & E. C. Krome, editors. Understanding the
estuary: advances in Chesapeake Bay research. Publication 129.
Chesapeake Research Consortium, Solomons, MD. pp. 536–546.
Newell, R. I. E., D. Breitburg, M. Luckenbach & C. Dungan. 2006.
Competitive interactions between diploid eastern and diploid suminoe oysters from larval settlement through to development of reefs
and assessment of the habitat value of such reefs: Report for the
combined period 1/1/06 to 3/30/06 for the NOAA funded project:
#NA04NMF4570414. 15 pp.
Sokal, R. R. & F. J. Rohlf. 1981. Biometry, 2nd ed. San Francisco, CA:
WH Freeman.
Taris, N., S. Baron, T. F. Sharbel, C. Sauvage & P. Boudry. 2005. A
combined microsatellite multiplexing and boiling DNA extraction
method for high-throughput parentage analyses in the Pacific oyster
(Crassostrea gigas). Aquaculture Res. 36:516–518.
Thompson, R. J., R. I. E. Newell, V. S. Kennedy & R. Mann. 1996.
Reproductive processes and early development. In: Kennedy,
Newell & Eble, editors. The eastern oyster. Maryland Sea Grant
College, College Park, MD. pp. 335–370.
Wang, H., X. M. Guo, G. F. Zhang & F. S. Zhang. 2004a. Classification
of jinjiang oysters Crassostrea rivularis (Gould, 1861) from China,
based on morphology and phylogenetic analysis. Aquaculture
242:137–155.
Wang, H., L. Qian, G. Zhang, X. Liu, A. Wang, Y. Shi, N. Jiao & X.
Guo. 2006b. Distribution of Crassostrea ariakensis in China. J.
Shellfish Res. 23(2):789–790.
Wang, Y. & X. Guo. 2008. ITS length polymophism and it potential use
in species identification. J. Shellfish Res. 27:489–493.
Wang, Y., Z. Xu & X. Guo. 2004b. Differences in the rDNA-bearing
chromosome divide Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca). Biol. Bull. 206:46–54.
Wilkinson, L. (1990). SYSTAT: The System for Statistics. Evanston,
Illinois: SYSTAT Inc.
Yund, P. O. & S. K. Meidel. 2003. Sea urchin spawning in benthic
boundary layers: are eggs fertilized before advecting away from
females? Limnol. Oceanogr. 48:795–801.
Zhou, M. & S. K. Allen, Jr. 2003. A review of published work on
Crassostrea ariakensis. J. Shellfish Res. 22:1–20.