MOLECULAR AND CELLULAR BIOLOGY, Mar. 2003, p. 1961–1967
0270-7306/03/$08.00⫹0 DOI: 10.1128/MCB.23.6.1961–1967.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Vol. 23, No. 6
RNA Polymerase II Accumulation in the Promoter-Proximal Region
of the Dihydrofolate Reductase and ␥-Actin Genes
Chonghui Cheng1 and Phillip A. Sharp1,2,3*
Center for Cancer Research,1 Department of Biology,2 and McGovern Institute for Brain Research,3
Massachusetts Institute of Technology, Cambridge, Massachusetts
Received 23 July 2002/Returned for modification 4 September 2002/Accepted 19 December 2002
The carboxyl-terminal domain (CTD) of RNA polymerase II (Pol II) can be phosphorylated at serine 2
(Ser-2) and serine 5 (Ser-5) of the CTD heptad repeat YSPTSPS, and this phosphorylation is important in
coupling transcription to RNA processing, including 5ⴕ capping, splicing, and polyadenylation. The mammalian endogenous dihydrofolate reductase and ␥-actin genes have been used to study the association of Pol II
with different regions of transcribed genes (promoter-proximal compared to distal regions) and the phosphorylation status of its CTD. For both genes, Pol II is more concentrated in the promoter-proximal regions than
in the interior regions. Moreover, different phosphorylation forms of Pol II are associated with distinct regions.
Ser-5 phosphorylation of Pol II is concentrated near the promoter, while Ser-2 phosphorylation is observed
throughout the gene. These results suggest that the accumulation of paused Pol II in promoter-proximal
regions may be a common feature of gene regulation in mammalian cells.
mammalian guanylyltransferase is stimulated by the phosphorylated CTD at Ser-5 (11). Moreover, other RNA processing
events, such as splicing and polyadenylation, have been shown
to be coupled to transcription via phosphorylation of CTD.
The phosphorylated form of CTD has been demonstrated to
stimulate splicing, while the hypophosphorylated form inhibits
splicing. Furthermore, the phosphorylated form of CTD, but
not the hypophosphorylated form, interacts with the splicing
factors known as SR proteins (7, 9, 10, 22).
One basis of transcriptional regulation in higher eukaryotes
is promoter-proximal pausing of Pol II. Escape of the paused
Pol II is thought to represent a rate-limiting step in transcription (16, 17, 28, 33, 37). An increasing number of genes have
been shown to be regulated by promoter-proximal pausing of
Pol II. These genes include the Drosophila hsp70 and hsp26
genes, as well as the mammalian c-Myc and c-Fos genes (2, 6,
16, 23, 25, 33, 34). Studies of the Drosophila hsp70 heat shock
gene promoter have demonstrated that promoter-proximal
pausing of Pol II occurs after elongating 20 to 50 nucleotides
downstream from the transcription initiation site (19). Using
KMnO4 footprinting and nuclear run-on assays, Krumm and
colleagues have shown that Pol II pauses in the promoterproximal region of the Myc gene in both proliferating and
differentiating cells (15, 16). However, there is a higher density
of Pol II complexes engaged in elongation in the coding region
in proliferating cells than in resting cells (16).
We have performed chromatin IP assays to address the
distribution of different phosphorylated forms of Pol II along
two endogenous genes, those encoding dihydrofolate reductase (DHFR) and ␥-actin, in mammalian cells. For both genes,
Pol II is more concentrated in the promoter-proximal regions
than in the interior regions. There is a distinct difference in the
distribution of different phosphorylated forms of Pol II. Ser-5
phosphorylation of Pol II is concentrated near the promoter.
Interestingly, Ser-2 phosphorylation of Pol II is found throughout the gene.
The carboxyl terminal domain (CTD) of RNA polymerase II
(Pol II) is composed of multiple heptad repeats of YSPTSPS,
whose consensus is fully conserved among most eukaryotes.
The serines at positions 2 and 5 (Ser-2 and Ser-5) of the
repeats are targets for phosphorylation and dephosphorylation
during transcription (14, 24, 29, 38). Kinases that are involved
in phosphorylation of the Pol II CTD include the cyclin-Cdk
complexes cyclin H-Cdk7, cyclin T-Cdk9, and cyclin C-Cdk8.
The cyclin H-Cdk7 complex belongs to the TFIIH complex,
which is responsible for Ser-5 phosphorylation (14, 29). Cyclin
T-Cdk9 is a component of P-TEFb, which is responsible for
Ser-2 phosphorylation and is also involved in facilitating Pol II
elongation (4, 26). Cyclin C-Cdk8 belongs to the mediator
complex, and its role in transcription regulation is not yet fully
elucidated. Pol II CTD is thought to be hypophosphorylated in
the preinitiation complex and to become phosphorylated upon
initiation.
Studies with Saccharomyces cerevisiae using the chromatin
immunoprecipitation (chromatin IP) assay have demonstrated
that Pol II is uniformly associated with a transcribed gene from
the promoter to the 3⬘ end of the gene (14, 29). However,
different phosphorylated forms of Pol II are associated with
the gene at different stages of transcription. In the promoterproximal region, the Ser-5-phosphorylated form is predominant. During elongation, Ser-5 is dephosphorylated while Ser-2
becomes phosphorylated (14). It was proposed that different
phosphorylation forms of the Pol II CTD function at different
stages of transcription to recruit appropriate factors, including
the capping enzyme, elongation factors, and termination factors, to transcription sites. Indeed, recruitment of capping enzyme to the newly made transcripts is dependent on Ser-5
phosphorylation (5, 14, 21, 27, 29). The catalytic activity of the
* Corresponding author. Mailing address: Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, MA
02139-4307. Phone: (617) 253-6421. Fax: (617) 253-3867. E-mail:
[email protected].
1961
1962
CHENG AND SHARP
MATERIALS AND METHODS
Cell culture and chromatin IP. HeLa cells were maintained in Dulbecco’s
modified Eagle’s medium supplemented with 10% fetal calf serum. Chromatin
IP was carried out essentially as described previously (8). For cross-linking,
⬃80% confluent cells on a 10-cm plate were incubated with 10 ml of 1%
formaldehyde in phosphate-buffered saline for 10 min at 37°C. Cross-linking
reactions were stopped by addition of glycine to a final concentration of 0.125 M.
Cells were then washed with phosphate-buffered saline and pelleted in an Eppendorf tube. One milliliter of buffer A (5 mM PIPES [pH 8.0], 85 mM KCl,
0.5% NP-40) was added to the cells and incubated for 20 min on ice. After
spinning, the isolated nuclei were lysed in 200 ␮l of lysis buffer (1% sodium
dodecyl sulfate [SDS], 10 mM EDTA, 50 mM Tris-HCl [pH 8.0]) for 10 min on
ice. The 200 ␮l of lysate was diluted with immunoprecipitation buffer (0.01%
SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl [pH 8.0], 167 mM
NaCl) to a final volume of 2 ml and then subjected to sonication to obtain DNA
fragments averaging approximately 200 to 500 bp in length. One-tenth of the
total chromatin solution was used in each chromatin IP. Chromatin solutions
were precleared and incubated with various antibodies prebound to protein
A-Sepharose CL-4B beads or anti-mouse-immunoglobulin M-coupled protein A
beads (H5 and H14 antibodies). The beads were washed five times in the
following buffers: TSE-150 (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM
Tris-HCl [pH 8.0], 150 mM NaCl), TSE-500 (like TSE-150 but with 500 mM
NaCl), buffer III (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10
mM Tris-HCl [pH 8.0]), and 2⫻ Tris-EDTA buffer. Immunocomplexes were
eluted from the beads with elution buffer (1% SDS and 0.5% NaHCO3) for 30
min at 65°C. The protein-DNA complex was then treated with proteinase K
followed by reverse cross-linking at 65°C overnight. DNA was extracted with
phenol-chloroform and precipitated with ethanol. Antibodies were obtained
from the indicated sources: anti-capping enzyme, S. Shuman, Sloan-Kettering
Institute; N20, Santa Cruz Biotechnology; C21, Santa Cruz Biotechnology;
8WG16, Covance; H5, Covance; H14, Covance; and p62, Santa Cruz Biotechnology.
PCR analyses. Chromatin-immunoprecipitated DNA was subjected to PCR.
For each chromatin IP, the resulting DNA was used as a template for PCRs with
the set of primers along a gene. One-fortieth of the chromatin immunoprecipitate was added to a 20-␮l reaction mixture containing 0.15 mM MgCl2, 2.5 mM
deoxynucleoside triphosphates, and 1 U of Hotstar DNA polymerase. After
denaturation at 95°C for 15 min, 30 cycles of PCR were performed; each cycle
consisted of 1 min at 95°C, 45 s at 60°C, and 45 s at 72°C. Under these conditions,
PCR product yield depended linearly on the amount of genomic DNA added to
each reaction mixture. PCR products were analyzed on 2% agarose gels by
ethidium bromide staining. PCRs using chromatin DNA before immunoprecipitation (input DNA) was performed for control of PCR amplification efficiency.
Real-time PCR using the Sybr green reagent was performed for quantification
of DNA. Twenty microliters of reaction mixture containing 10 ␮l of 2⫻ PCR mix
(Applied Biosystems), primers, and genomic DNA were incubated in an ABI
cycler. The PCR products were detected with the Sybr green reagent, which
increases in fluorescent efficiency when intercalated into double-stranded DNA.
Data were analyzed by SDS application (Applied Biosystems). For adjustment of
amplification efficiency of each primer set, PCR signal intensities from chromatin-immunoprecipitated DNA were normalized to those from the input genomic
DNA and expressed as a percentage of the input. Relative levels of Pol II
association with regions along a gene were further determined by comparison of
the normalized PCR signal intensities to that at the promoter region.
Primer sequences. The following primer sequences correspond to those illustrated in Fig. 1, 2, and 4 to 6: DHFR-1-forward, ACCTGGTCGGCTGCACCT;
DHFR-1-reverse, TTGCCCTGCCATGTCTCG; DHFR-2-forward, AACAGA
ATCTGGTGATTATGGG; DHFR-2-reverse, TACTGATCTCCACTATGAG
ACATG; DHFR-3-forward, GTTCTATAGTCACTGCATCTTAGTC; DHFR3-reverse, TGCTAATTCTGGTTGTTCAGTAAG; DHFR-4-forward, GAGTA
TGTTTCTGTCTTAGATTGG; DHFR-4-reverse, ATGAGAACCTGCTCGCT
GAC; DHFR-5-forward, TTGTTTCAGGGACAGGGTCTT; and DHFR-5reverse, CTGTGGTGGGAAGATGGCT. The ␥-actin primers are as follows:
Act-1-forward, GGAAAGATCGCCATATATGGAC; Act-1-reverse, TCACCG
GCAGAGAAACGCGAC; Act-2-forward, GCTGTTCCAGGCTCTGTTCC;
Act-2-reverse, ATGCTCACACGCCACAACATGC; Act-3-forward, GTGACA
CAGCATCACTAAGG; Act-3-reverse, ACAGCACCGTGTTGGCGT; Act-4forward, TCTGTCAGGGTTGGAAAGTC; Act-4-reverse, AAATGCAAACC
GCTTCCAAC; Act-5-forward, TGTGGATCGCTAGGAGTGGA; and Act-5reverse, TGACAAGGCTGCAGAGCAAT.
In nuclear run-on assays (see Fig. 3), primer sets 1 and 3 were identical to
those of DHFR-1 and DHFR-3, as described above. Primer sets 2 and 4 were
MOL. CELL. BIOL.
used to amplify the DHFR cDNA, and the sequences are as follows: primer set
2, forward, GAATGAATTCAGATATTTCCAGAGA, and reverse, AGGAAT
GGAGAACCAGGTC; primer set 4, forward, AAGCCATGAATCACCCAGG,
and reverse, TACTTAATGCCTTTCTCCTCCTG.
Nuclear run-on assay. The nuclear run-on assay was carried out under highsalt conditions, essentially as described elsewhere (3) with slight modifications. A
total of 108 cells were used in each nuclear run-on assay. Nuclei were isolated
with NP-40 lysis buffer (10 mM Tris-HCl [pH 7.4], 10 mM NaCl, 3 mM MgCl2,
0.5% NP-40). Nuclei (225 ␮l) in NFB buffer (50 mM Tris-HCl [pH 8.3], 40%
glycerol, 5 mM MgCl2, 0.1 mM EDTA) were added to 60 ␮l of 5⫻ run-on buffer
(25 mM Tris-HCl [pH 8.0], 12.5 mM MgCl2, 750 mM KCl, 1.25 mM ATP, 1.25
mM GTP, 1.25 mM CTP) and 15 ␮l of 40-␮Ci/ml [␣-32P]UTP, followed by
incubation at 30°C for 30 min. DNase I (25 U) and CaCl2 (final concentration,
10 mM) were then added to the mixture and incubated for 15 min at 30°C. The
reactions were deproteinized with 80 ␮g of proteinase K in 1% SDS at 37°C for
2 h. The transcripts were phenol extracted, ethanol precipitated, and DNase I
treated. The RNAs were then partially hydrolyzed in 0.2 M NaOH for 10 min on
ice, and the reaction was quenched by the addition of HEPES buffer (pH 7.0) to
a final concentration of 0.2 M. The transcripts were then ethanol precipitated
and resuspended in 1 ml of hybridization buffer (10 mM Tris-HCl [pH 7.5], 0.1%
SDS, 0.4 M NaCl, 10 mM EDTA, 2⫻ Denhardt’s reagent, 50 ␮g of salmon sperm
DNA per ml, and 100 ␮g of tRNA per ml). Slot blot membranes were hybridized
with the probe for 40 h at 65°C followed by washing in 2⫻ SSC (1⫻ SSC is 0.15
M NaCl plus 0.015 M sodium citrate) at 65°C for 1 h, 2⫻ SSC with 10 ␮g of
RNase A per ml at 37°C for 30 min, and 2⫻ SSC with 0.5% SDS at 65°C for 1 h.
The membrane was exposed with a phosphorimage screen.
RESULTS
Chromatin IP assay. To understand the role of RNA Pol II
phosphorylation in transcription in mammalian cells, we used
a chromatin IP assay to dissect the distribution along genes of
Pol II and its phosphorylated forms. Briefly, living cells were
first cross-linked with formaldehyde solution. The cross-linked
protein-chromatin material was then sonicated to obtain 200to 500-bp DNA fragments (Fig. 1A), which were then immunoprecipitated with specific antibodies to obtain protein-DNA
complexes of interest. The amount of specific DNA immunoprecipitated, which was proportional to the amount of protein
at that region, was then analyzed by PCR amplification using
specific primers. The DHFR gene in a DHFR-amplified HeLa
cell line (31) has been analyzed, as this cell line expresses high
levels of RNA from multiple copies of the gene. The DHFR
gene is about 36 kb in length, and thus, sonication of cellular
DNA into 200- to 500-bp segments allows promoter-bound and
elongating transcription complexes to be easily resolved. Pol II
association with the ␥-actin gene has additionally been tested.
For each gene tested, four PCR primer sets sampling the 5⬘
end, the coding region, and the 3⬘ untranslated region (UTR)
were designed. Each primer set amplifies a PCR fragment
approximately 120 to 150 nucleotides in length. In addition, a
set of primers amplifying a nontranscribed intergenic region
was used as an internal background control.
As an initial test, we performed chromatin IP assays using an
antibody against mammalian guanylyltransferase, a subunit of
the capping enzyme. This enzyme has been clearly documented
to catalyze cap formation at the 5⬘ end of a transcript (30);
therefore, we anticipated that antisera to this protein would
immunoprecipitate segments from the 5⬘ end of a gene when
used in chromatin IP analysis. Indeed, this was observed; the
PCR product from the 5⬘ end of a gene was preferentially
amplified (Fig. 1C). In contrast, little or no signal was detected
in control experiments with either no antibody or a nonspecific
antibody (Fig. 1C). Similarly, little or no signal was observed in
VOL. 23, 2003
ASSOCIATION OF RNA POL II WITH TRANSCRIBED GENES
1963
FIG. 1. Capping enzyme is concentrated at the promoter of the
DHFR gene. HeLa cells containing high numbers of copies of the
DHFR gene were cross-linked with formaldehyde. Following sonication, a specific antibody recognizing capping enzyme was added to the
chromatin solution for immunoprecipitation of a DNA-capping enzyme complex. PCR was performed to analyze amounts of DNA along
the gene that were associated with the capping enzyme. (A) Sonication
efficiency of chromatin DNA. The sonicated chromatin solution was
analyzed on an ethidium bromide-stained agarose gel after proteinase
K treatment and reversal of the cross-links. Two samples are shown,
with a 1-kb DNA ladder on the left of the gel. (B) Schematic diagram
of the DHFR gene. Black boxes represent exons and thin lines represent introns. DNA fragments for PCR amplification (about 150 nucleotides [nt] long) are depicted as bars under the gene. A pair of primers
amplifying an intergenic region downstream of the DHFR gene served
as an internal background control. Sequences of primer pairs are
presented in Materials and Methods. Numbers below each gel correspond to individual primer sets along the DHFR gene. (C) Chromatin
IP with a capping enzyme antibody. PCRs with input DNA (before
immunoprecipitation) were performed as controls for amplification
efficiency of individual PCR primer sets. Chromatin IP without any
antibody and with a nonspecific antibody (Oct2) served as negative
controls. Agarose gel analyses of PCR products are shown, with lane
numbers corresponding to regions of the gene.
FIG. 2. Distribution of RNA Pol II along the DHFR gene. Chromatin IP was performed with antibodies against Pol II. C21 and N20
are antibodies against the C and N termini of the largest Pol II subunit
and recognize both hyperphosphorylated and hypophosphorylated Pol
II. 8WG16 is a Pol II antibody that preferentially recognizes the hypophosphorylated form of Pol II. Chromatin IP without specific antibody served as a negative control. (A) Agarose gel analyses of PCR
products from chromatin IP. Lane numbers correspond to the region
of the gene depicted at the top of the figure. (B) Real-time PCR results
for quantification of Pol II association with the different regions of the
DHFR gene. The numbers on the y axis represent the levels of Pol II
association with different regions of the DHFR gene relative to that of
the promoter region.
the intergenic region (Fig. 1C, lane 5). The above results suggest that these experimental conditions can be used to measure
the relative levels of different proteins across genes.
Accumulation of RNA Pol II at the promoter of the DHFR
gene. Three different Pol II antibodies were used to examine
the distribution of Pol II across the DHFR gene. 8WG16 is a
Pol II antibody which preferentially recognizes the hypophosphorylated form of the CTD. N20 and C21 are antibodies
against the N-terminal and C-terminal regions, respectively, of
the large subunit of Pol II. These antibodies bind Pol II in a
phosphorylation-independent manner, i.e., they recognize Pol
II with either the hyperphosphorylated or the hypophosphorylated CTD. Figure 2A shows that the 8WG16 epitope specifically immunoprecipitated DNA from the promoter regions
much more efficiently than from either the coding regions or
the 3⬘ end, which agrees with the findings that the hypophosphorylated form of Pol II is concentrated at the promoter (23).
Interestingly, the N20 and C21 antibodies generated the same
cross-linking pattern; that is, these epitopes immunoprecipitated DNA much more efficiently from the promoter regions
than from the coding regions or the 3⬘ end (Fig. 2A). In all
three cases, little cross-linking occurred at the intergenic region (Fig. 2A, lane 5). In addition, cross-linking signals were
not observed when a nonspecific antibody was used (data not
shown). These results suggest that the density of Pol II in the
5⬘-proximal region of the DHFR gene is much higher than that
in other downstream regions.
To determine relative levels of Pol II association between
regions, real-time PCR analysis was performed, where multiple
PCRs can be compared in the linear range of amplification
even if these reactions acquire very different kinetics. As shown
in Fig. 2B, the levels of Pol II association with different regions
were compared to that at the promoter region. We observed
that Pol II, recognized by either the 8WG16 or the N20 and
C21 antibodies, is enriched at the promoter at least eightfold
compared to the density in the coding region of the DHFR
gene. This suggests that a significant fraction of Pol II is paused
at the promoter region, perhaps with short nascent transcripts.
Comparison of the quantitative levels of Pol II associated with
the coding region to that of the intergenic background revealed
no significant difference. Thus, the eightfold Pol II enrichment
is a minimal estimate. The lack of detection of Pol II associated
with the intergenic region is probably due to the low level of
transcription of the DHFR gene (see below).
To further verify the high levels of occupancy of Pol II near
the promoter and test whether they were engaged in elongation, we carried out a nuclear run-on assay under high-salt
conditions, where the transcriptional engaged Pol II elongates
1964
CHENG AND SHARP
MOL. CELL. BIOL.
FIG. 3. RNA Pol II density determined by nuclear run-on analysis
of the DHFR gene. Nuclear run-on analysis was performed as described in Material and Methods. Newly synthesized, 32P-radiolabeled
transcripts were hybridized to PCR products containing specific regions of the DHFR gene. The locations of PCR fragments are diagramed at the top and indicated on the left of the filters. PCR fragments 1 and 3 are genomic DNA, whereas 2 and 4 are cDNA
encompassing parts of two adjacent exons. Radiolabeled DHFR RNA
was transcribed with SP6 polymerase from each of the four fragments
and then pooled and hybridized to the filter as a positive control for
hybridization efficiencies among different DHFR probes. Analysis of
labeled RNA from the nuclear run-on assay is shown on the right.
FIG. 4. Different forms of phosphorylated RNA Pol II associate
with different regions of the DHFR gene. Chromatin IP and real-time
PCR were performed as for Fig. 2. Antibodies H5 and H14, which
specifically recognize Ser-2 and Ser-5 phosphorylation of the CTD
repeats, respectively, were used for chromatin IP. (A) Agarose gel
analyses of PCR products from chromatin IP. Lane numbers correspond to regions of the gene depicted at the top. (B) Real-time PCR
results for quantification of relative levels of phosphorylated Pol II
associated with different regions of the DHFR gene.
for a short distance in the presence of a limiting, labeled
nucleotide triphosphate. The elongating Pol II density at a
particular region is then measured as a readout of newly synthesized transcripts from that region. This is a direct indication
of the amounts of transcriptional engaged Pol II along the
gene. We tested the level of run-on transcription at four different regions across the DHFR gene, similar to the chromatin
IP experiments (Fig. 3). We observed that RNA produced by
Pol II elongation hybridized primarily to the 5⬘-proximal region of the DHFR gene. Other regions of the gene showed
little detectable signals. Quantification of these results indicated that the elongating Pol II was at least eightfold more
concentrated near the 5⬘-proximal region than the internal
regions.
Different phosphorylated forms of RNA Pol II associated
with different regions of the DHFR gene. The RNA Pol II CTD
repeat sequence YSPTSPS can be phosphorylated at Ser-2 and
Ser-5. In yeast, Ser-5-phosphorylated Pol II is concentrated in
the promoter-proximal region, while Ser-2-phosphorylated Pol
II is associated with the coding region but not the promoterproximal region (14). This suggested a dynamic change of
serine phosphorylation of the Pol II CTD at the promoterproximal region. In order to determine the distribution of
Ser-2- and Ser-5-phosphorylated Pol II along the DHFR gene,
chromatin IP assays were performed with antibodies H5 and
H14, which recognize CTD repeats phosphorylated at Ser-2
and Ser-5, respectively (24). Consistent with the results in
yeast, the H14 epitope (Ser-5 phosphorylation) cross-linked
more strongly to the promoter-proximal region than to the
coding region or 3⬘ UTR of the DHFR gene (Fig. 4). Realtime PCR analysis revealed that at least 90% of the Ser-5phosphorylated form is concentrated near the promoter. In
contrast, the H5 epitope (Ser-2 phosphorylation) cross-linked
to regions both near the promoter and in the coding regions
(Fig. 4). In this case, about 50% of the Pol II which interacted
with this monoclonal antibody was distributed across the coding regions. This suggests that phosphorylation of Pol II at the
Ser-2 position occurs while the polymerase is promoter-proximal and remains during elongation. This unique occurrence of
Ser-2 phosphorylation on the DHFR gene may indicate an
additional step of transcriptional regulation of Pol II at the
promoter-proximal region in mammalian cells. Furthermore,
the distinct distribution across the DHFR gene of different Pol
II phosphorylation forms is consistent with a dynamic change
in CTD phosphorylation during elongation.
Distribution of the Pol II kinase TFIIH. The phosphorylation status of the CTD is thought to reflect the kinases associated with RNA Pol II, TFIIH (Ser-5) and P-TEFb (Ser-2).
To test whether the distinct pattern of CTD phosphorylation
corresponded to the binding of the kinase complex, we performed the chromatin IP assay with antisera to p62, a TFIIH
subunit. The results indicate that p62 associates only with the
DHFR gene near the promoter (Fig. 5), which overlaps with
the distribution of Ser-5 phosphorylation of Pol II, and this is
VOL. 23, 2003
ASSOCIATION OF RNA POL II WITH TRANSCRIBED GENES
1965
FIG. 5. TFIIH subunit p62 associates with the DHFR gene in the
promoter-proximal region. Chromatin IP and PCR were performed as
for Fig. 1. Antibody against TFIIH subunit p62 was used in chromatin
IP assays. Agarose gel analyses of PCR products are shown; lane
numbers correspond to regions of the gene.
consistent with the TFIIH kinase activity being responsible for
phosphorylation at Ser-5 (14, 29). Attempts to localize the
distribution of Cdk9 and cyclin T of P-TEFb failed, probably
due to the quality of the antibodies. A low background level
signal was detected across the gene with these antisera.
Coupling of RNA splicing to transcription is also thought to
be dependent upon the phosphorylation status of the CTD of
Pol II (10, 21, 22). We attempted to assay the association of
splicing factors (SR proteins, SRm160, hnRNP A1, etc.) by
chromatin IP. Interestingly, we either did not detect any signals
(possibly due to antibody quality) or observed signals throughout the gene. For the latter set, the antibodies not only precipitated segments throughout the gene but also showed high
signals from an intergenic region. This would be consistent
with a nonspecific immunoprecipitation and thus, in the absence of other results, cannot be interpreted.
Conservation of Pol II distribution on the ␥-actin gene. To
examine the generality of the distribution of Pol II on a transcribed gene, we also analyzed the ␥-actin gene. This gene is
3.5 kb in length and is constitutively expressed. It is significantly different from the DHFR gene, which is much longer
(36 kb) and highly regulated through the cell cycle. The densities of Pol II on these genes were considerably different as
well. Calculations using the number of DHFR mRNAs per cell
and their half life (6 h [18]) revealed that, on average, only
⬃0.003 of the distal regions of the sonicated DHFR gene
(ⱕ500 nucleotides) is associated with Pol II. The estimated Pol
II density on the ␥-actin gene is approximately 10- to 100-fold
higher than that of the DHFR gene. Four primer sets were
designed corresponding to the promoter, coding region, and 3⬘
UTR of the ␥-actin gene (Fig. 6A). Each primer set amplifies
a fragment of approximately 120 bp. Another set of primers
which amplifies an intergenic region was included as a control.
Antibodies against both the N and C termini of the large
subunit of Pol II (N20 and C21, respectively) and indicated
that the Pol II was associated predominantly near the promoter. The density of Pol II near the promoter was sixfold
higher than that in the coding region (Fig. 6). This distribution
is consistent with the results obtained with DHFR as a reporter
gene. We also examined the association of different phosphorylated forms of Pol II along the ␥-actin gene. Consistent with
the DHFR gene, Ser-2 phosphorylation of Pol II, recognized
by the H5 antibody, was distributed relatively uniformly across
the gene. In contrast, Ser-5 phosphorylation, recognized by the
H14 antibody, was enriched near the promoter (Fig. 6). The
FIG. 6. Distribution of RNA Pol II on ␥-actin gene. Schematic
diagram of the ␥-actin gene is shown at the top of the figure. Black
boxes represent exons and thin lines represent introns. PCR products
are depicted as bars under the gene. Amplification of an intergenic
region served as an internal background control. (A) Specific antibodies used for chromatin IP are shown on top of each gel. Chromatin IP
without any antibody or with a nonspecific antibody, Oct2, served as
negative controls. PCR analyses of chromatin IP for different regions
of the gene are shown. (B) Real-time PCR results are shown for
quantification of DNA associated with specific proteins.
phosphorylated Ser-5 signal from the coding regions of the
␥-actin gene amounts to approximately 40% of the signal from
the promoter-proximal region. This is significantly lower than
the equivalent sum of 60 to 70% for the phosphorylated Ser-2
signal, which is consistent with an enrichment of the Ser-5phosphorylated Pol II near the promoter. Less than 10% of the
promoter-proximal Ser-5 phosphorylation from the DHFR
gene is found associated with all internal sites of this gene,
indicating a stronger bias towards accumulation of Ser-5-phosphorylated form at the promoter-proximal region than for the
␥-actin gene. This difference can probably be explained by
differences in promoter specificity, in that different promoter
structures may regulate transcription and its coupling to RNA
processing by finely regulating the degrees of Pol II phosphorylation at Ser-2 and Ser-5 sites.
DISCUSSION
Using a quantitative chromatin IP assay, we found that Pol
II, in mammalian cells, is approximately eightfold more concentrated near the promoter of the DHFR and ␥-actin genes
than at regions interior to the genes. The distribution of Pol II
1966
CHENG AND SHARP
along the gene differs for different phosphorylated forms. Pol
II phosphorylated specifically at Ser-5 is more concentrated
near the promoter while Pol II with Ser-2 phosphorylation is
distributed throughout the gene. The density along the gene of
elongating Pol II was examined by a run-on assay. Elongating
Pol II was concentrated at least eightfold more near the promoter, suggesting that many of the transcriptional complexes
were paused. These results suggest a dynamic change of Pol II
phosphorylation during transcription and potential regulation
at the stage of elongation in mammals.
The predominant promoter-proximal accumulation of Pol II
along the DHFR and ␥-actin genes is in stark contrast with
observations made in the yeast system, in which Pol II is uniformly associated with both promoter and coding regions (14,
29). This promoter specific association of mammalian Pol II
may reflect a greater role for regulation of Pol II elongation in
mammalian cells than in yeast.
The resolution of the chromatin IP assay is approximately
200 to 500 bp, the length of the chromatin fragments produced
by sonication. Thus, Pol II could be preferentially associated
with the promoter in a preinitiated stage or as a paused elongation complex. Conventional models suggest that preinitiated
Pol II would have a hypophosphorylated CTD, in contrast to
the elongating Pol II, which would have a hyperphosphorylated
CTD with either Ser-2 or Ser-5 phosphorylation. This is also
the case for both the DHFR and ␥-actin genes. In each case,
there is a strong enrichment of the hypophosphorylated Pol II
with the promoter region compared to internal regions. Preinitiation complexes containing Pol II in mammalian cells have
been recently described. In the case of the interferon-␤ gene,
a complex containing Pol II strongly binds the promoter but
initiation does not occur until subsequent association with a
SWI/SNF complex and the binding of the TFIID complex (1).
However, a significant fraction of the Pol II concentrated near
the promoter of the DHFR gene has undergone initiation and
is paused during elongation. This is indicated in this study by
the increased level of Pol II phosphorylated on Ser-5 in the
promoter-proximal region compared to the internal regions.
This conclusion is also strongly supported by the high density
of promoter-proximal elongating Pol II on the DHFR gene, as
detected by the run-on assay.
Studies of the heat shock genes of Drosophila melanogaster
by Lis and coworkers (20) have shown that Pol II can be
paused 20 to 40 nucleotides downstream from the transcription
start site. Even under induced conditions for these heat shock
genes, where they are actively transcribed, promoter-proximal
Pol II pausing is still evident, suggesting that pausing can be
the rate-limiting step during the process of transcription (19).
In mammalian cells, the pausing and concentration of Pol II in
the promoter-proximal region of genes is common as well (15,
16). The typical fate of such paused Pol II complexes is not
clear. They could either be released and rapidly elongate into
regions further downstream or terminate transcription with
dissociation from the gene. In either case, others have speculated that modification of Pol II at the pause site releases the
Pol II for elongation (15, 19).
Regulatory factors that may possibly switch the paused Pol
II to the elongation-competent Pol II complex include P-TEFb
and 5,6-dichlorobenzimidazole-riboside (DRB) sensitivity-inducing factor (DSIF). P-TEFb consists of Cdk9 and cyclin T, is
MOL. CELL. BIOL.
a positive regulator of elongation of transcription, and is
thought to phosphorylate the CTD at Ser-2. The transcription
elongation inhibitor DRB preferentially inhibits this kinase
activity. DSIF, which includes the Spt4 and Spt5 proteins, was
originally purified as an activity which binds Pol II at a preinitiation stage and necessitates the activity of P-TEFb for initiation, thus rendering transcription in vitro and sensitivity to
DRB (35, 36). Subsequent studies have suggested that P-TEFb
and Spt5 may be important for controlling the efficiency of
elongation of Pol II across the gene (2, 12, 20). In this case,
P-TEFb is conjectured to phosphorylate the CTD and/or
serines in a repetitive region of Spt5, regulating elongation of
the polymerase (13).
Recent results from studies of c-Myc regulation of the CAD
gene are consistent with the above model (6). Increased binding of c-Myc to sequences immediately downstream of the
initiation site of this gene, which occurs during the transition
from the G0 to the S phase of the cell cycle, correlates with
increases in the number of elongating Pol II molecules through
the 3⬘ end of the gene and not the number paused near the
promoter, which remains high during both stages. Furthermore, these studies show that tethering P-TEFb to this promoter-proximal region in the absence of c-Myc stimulates transcription of the CAD gene (6).
Other models for regulation of Pol II elongation are suggested by recent studies of the ␣-1-antitrypsin promoter (32).
In this case, phosphorylated Pol II is associated with the promoter region hours before transcription can be detected at
sites downstream. However, unlike the CAD gene example
above, the critical transition to activation of transcription correlated with association of the hBrm factor and displacement
of a positioned nucleosome. Thus, regulation at the stage of
release of paused Pol II can probably occur by a variety of
mechanisms.
Ser-2-phosphorylated Pol II is associated with both the promoter and coding regions of the DHFR and ␥-actin genes. In
contrast, Ser-5 phosphorylation is observed and highly enriched only in the promoter-proximal region of the DHFR and
␥-actin genes, respectively. These observations were consistent
with the results from studies of the ␣-1-antitrypsin gene (32).
Ser-5 phosphorylation is thought to be critical for conversion
of the preinitiation complex to an elongation complex and is
probably due to the activity of Cdk7 as part of the TFIIH
complex. We therefore examined the distribution along the
gene of the TFIIH complex. p62, a TFIIH subunit, is primarily
associated with the DHFR gene in the promoter-proximal region, completely overlapping the distribution of Ser-5 phosphorylation of Pol II. This is consistent with the proposal that
the TFIIH kinase activity is responsible for phosphorylation at
Ser-5. Similar results regarding TFIIH have previously been
obtained with yeast. This basal transcription factor also phosphorylates Ser-5 of the Pol II CTD in yeast, and both Ser-5
phosphorylation and TFIIH are associated only with promoter-proximal Pol II. These events are correlated with the timing
of the capping enzyme recruitment to the nascent transcripts:
the capping enzyme is recruited by the Ser-5 phosphorylation
of the CTD at the promoter, and its guanylyltransferase enzymatic activity is stimulated by the Ser-5 phosphorylation, suggesting the regulatory role of CTD phosphorylation in the
promoter region (11).
VOL. 23, 2003
ASSOCIATION OF RNA POL II WITH TRANSCRIBED GENES
Both these and previous results indicate that regulation at
the stage of paused Pol II is a common feature of gene expression in mammalian cells. Various mechanisms could control
such regulation of elongation, but the most common is probably differential phosphorylation by TFIIH and P-TEFb and
dephosphorylation of Pol II.
ACKNOWLEDGMENTS
We are very grateful to C. K. Ho and S. Shuman for the mouse
capping enzyme antiserum and to L. D. Mesner and J. L. Hamlin for
the DHFR amplified cell line. We thank D. Tantin, D. Dykxhoorn, W.
Fairbrother, S. Gilbert, J. Knowlton, and V. Wang for discussion
and/or critical readings of the manuscript.
This work was supported by U.S. Public Health Service grant PO1CA42063 to P.A.S. and partially supported by Cancer Center Support
(core) grant P30-CA14051 from the National Institutes of Health. C.
Cheng is a recipient of the Damon Runyon-Walter Winchell Foundation fellowship.
REFERENCES
1. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos.
2000. Ordered recruitment of chromatin modifying and general transcription
factors to the IFN-beta promoter. Cell 103:667–678.
2. Andrulis, E. D., E. Guzman, P. Doring, J. Werner, and J. T. Lis. 2000.
High-resolution localization of Drosophila Spt5 and Spt6 at heat shock genes
in vivo: roles in promoter proximal pausing and transcription elongation.
Genes Dev. 14:2635–2649.
3. Carey, M., and S. T. Smale. 1999. Protocol 3.1, nuclear run-on assay, p. 87.
In M. Carey and S. T. Smale (ed.), Transcriptional regulation in eukaryotes.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
4. Cho, E. J., M. S. Kobor, M. Kim, J. Greenblatt, and S. Buratowski. 2001.
Opposing effects of Ctk1 kinase and Fcp1 phosphatase at Ser 2 of the RNA
polymerase II C-terminal domain. Genes Dev. 15:3319–3329.
5. Cho, E. J., T. Takagi, C. R. Moore, and S. Buratowski. 1997. mRNA capping
enzyme is recruited to the transcription complex by phosphorylation of the
RNA polymerase II carboxy-terminal domain. Genes Dev. 11:3319–3326.
6. Eberhardy, S. R., and P. J. Farnham. 2001. c-Myc mediates activation of the
cad promoter via a post-RNA polymerase II recruitment mechanism. J. Biol.
Chem. 276:48562–48571.
7. Fong, N., and D. L. Bentley. 2001. Capping, splicing, and 3⬘ processing are
independently stimulated by RNA polymerase II: different functions for
different segments of the CTD. Genes Dev. 15:1783–1795.
8. Gilbert, S. L., and P. A. Sharp. 1999. Promoter-specific hypoacetylation of
X-inactivated genes. Proc. Natl. Acad. Sci. USA 96:13825–13830.
9. Hirose, Y., and J. L. Manley. 1998. RNA polymerase II is an essential mRNA
polyadenylation factor. Nature 395:93–96.
10. Hirose, Y., R. Tacke, and J. L. Manley. 1999. Phosphorylated RNA polymerase II stimulates pre-mRNA splicing. Genes Dev. 13:1234–1239.
11. Ho, C. K., and S. Shuman. 1999. Distinct roles for CTD Ser-2 and Ser-5
phosphorylation in the recruitment and allosteric activation of mammalian
mRNA capping enzyme. Mol. Cell 3:405–411.
12. Kaplan, C. D., J. R. Morris, C. Wu, and F. Winston. 2000. Spt5 and Spt6 are
associated with active transcription and have characteristics of general elongation factors in D. melanogaster. Genes Dev. 14:2623–2634.
13. Kim, J. B., and P. A. Sharp. 2001. Positive transcription elongation factor B
phosphorylates hSPT5 and RNA polymerase II carboxyl-terminal domain
independently of cyclin-dependent kinase-activating kinase. J. Biol. Chem.
276:12317–12323.
14. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors
during transcription. Genes Dev. 14:2452–2460.
15. Krumm, A., L. B. Hickey, and M. Groudine. 1995. Promoter-proximal pausing of RNA polymerase II defines a general rate-limiting step after transcription initiation. Genes Dev. 9:559–572.
1967
16. Krumm, A., T. Meulia, M. Brunvand, and M. Groudine. 1992. The block to
transcriptional elongation within the human c-myc gene is determined in the
promoter-proximal region. Genes Dev. 6:2201–2213.
17. Laspia, M. F., A. P. Rice, and M. B. Mathews. 1989. HIV-1 Tat protein
increases transcriptional initiation and stabilizes elongation. Cell 59:283–292.
18. Leys, E. J., G. F. Crouse, and R. E. Kellems. 1984. Dihydrofolate reductase
gene expression in cultured mouse cells is regulated by transcript stabilization in the nucleus. J. Cell Biol. 99:180–187.
19. Lis, J. 1998. Promoter-associated pausing in promoter architecture and
postinitiation transcriptional regulation. Cold Spring Harbor Symp. Quant.
Biol. 63:347–356.
20. Lis, J. T., P. Mason, J. Peng, D. H. Price, and J. Werner. 2000. P-TEFb
kinase recruitment and function at heat shock loci. Genes Dev. 14:792–803.
21. McCracken, S., N. Fong, K. Yankulov, S. Ballantyne, G. Pan, J. Greenblatt,
S. D. Patterson, M. Wickens, and D. L. Bentley. 1997. The C-terminal
domain of RNA polymerase II couples mRNA processing to transcription.
Nature 385:357–361.
22. Misteli, T., and D. L. Spector. 1999. RNA polymerase II targets pre-mRNA
splicing factors to transcription sites in vivo. Mol. Cell 3:697–705.
23. O’Brien, T., S. Hardin, A. Greenleaf, and J. T. Lis. 1994. Phosphorylation of
RNA polymerase II C-terminal domain and transcriptional elongation. Nature 370:75–77.
24. Patturajan, M., R. J. Schulte, B. M. Sefton, R. Berezney, M. Vincent, O.
Bensaude, S. L. Warren, and J. L. Corden. 1998. Growth-related changes in
phosphorylation of yeast RNA polymerase II. J. Biol. Chem. 273:4689–4694.
25. Plet, A., D. Eick, and J. M. Blanchard. 1995. Elongation and premature
termination of transcripts initiated from c-fos and c-myc promoters show
dissimilar patterns. Oncogene 10:319–328.
26. Price, D. H. 2000. P-TEFb, a cyclin-dependent kinase controlling elongation
by RNA polymerase II. Mol. Cell. Biol. 20:2629–2634.
27. Rodriguez, C. R., E. J. Cho, M. C. Keogh, C. L. Moore, A. L. Greenleaf, and
S. Buratowski. 2000. Kin28, the TFIIH-associated carboxy-terminal domain
kinase, facilitates the recruitment of mRNA processing machinery to RNA
polymerase II. Mol. Cell. Biol. 20:104–112.
28. Rougvie, A. E., and J. T. Lis. 1990. Postinitiation transcriptional control in
Drosophila melanogaster. Mol. Cell. Biol. 10:6041–6045.
29. Schroeder, S. C., B. Schwer, S. Shuman, and D. Bentley. 2000. Dynamic
association of capping enzymes with transcribing RNA polymerase II. Genes
Dev. 14:2435–2440.
30. Shuman, S. 1995. Capping enzyme in eukaryotic mRNA synthesis. Prog.
Nucleic Acid Res. Mol. Biol. 50:101–129.
31. Singer, M. J., L. D. Mesner, C. L. Friedman, B. J. Trask, and J. L. Hamlin.
2000. Amplification of the human dihydrofolate reductase gene via double
minutes is initiated by chromosome breaks. Proc. Natl. Acad. Sci. USA
97:7921–7926.
32. Soutoglou, E., and I. Talianidis. 2002. Coordination of PIC assembly and
chromatin remodeling during differentiation-induced gene activation. Science 295:1901–1904.
33. Strobl, L. J., and D. Eick. 1992. Hold back of RNA polymerase II at the
transcription start site mediates down-regulation of c-myc in vivo. EMBO J.
11:3307–3314.
34. Tang, H., Y. Liu, L. Madabusi, and D. S. Gilmour. 2000. Promoter-proximal
pausing on the hsp70 promoter in Drosophila melanogaster depends on the
upstream regulator. Mol. Cell. Biol. 20:2569–2580.
35. Wada, T., T. Takagi, Y. Yamaguchi, A. Ferdous, T. Imai, S. Hirose, S.
Sugimoto, K. Yano, G. A. Hartzog, F. Winston, S. Buratowski, and H.
Handa. 1998. DSIF, a novel transcription elongation factor that regulates
RNA polymerase II processivity, is composed of human Spt4 and Spt5
homologs. Genes Dev. 12:343–356.
36. Wada, T., T. Takagi, Y. Yamaguchi, D. Watanabe, and H. Handa. 1998.
Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase II-dependent transcription in vitro. EMBO J. 17:7395–7403.
37. Yankulov, K., J. Blau, T. Purton, S. Roberts, and D. L. Bentley. 1994.
Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77:749–759.
38. Zhang, J., and J. L. Corden. 1991. Identification of phosphorylation sites in
the repetitive carboxyl-terminal domain of the mouse RNA polymerase II
largest subunit. J. Biol. Chem. 266:2290–2296.