Epigenetic Regulation of TLR4 Gene
Expression in Intestinal Epithelial Cells for
the Maintenance of Intestinal Homeostasis
This information is current as
of June 16, 2017.
Kyoko Takahashi, Yutaka Sugi, Akira Hosono and Shuichi
Kaminogawa
J Immunol 2009; 183:6522-6529; Prepublished online 21
October 2009;
doi: 10.4049/jimmunol.0901271
http://www.jimmunol.org/content/183/10/6522
Subscription
Permissions
Email Alerts
This article cites 34 articles, 20 of which you can access for free at:
http://www.jimmunol.org/content/183/10/6522.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
References
The Journal of Immunology
Epigenetic Regulation of TLR4 Gene Expression in Intestinal
Epithelial Cells for the Maintenance of Intestinal Homeostasis1
Kyoko Takahashi,2 Yutaka Sugi, Akira Hosono, and Shuichi Kaminogawa
T
he intestinal immune system, which is the largest immune
system in the body, plays an essential role in the maintenance of health. In addition to food, pathogenic bacteria
and viruses enter the intestinal tract through the oral cavity. On the
other hand, an enormous number of commensal bacteria inhabit
the intestinal tract. The intestinal immune system accurately recognizes these different organisms, discriminates between safe/beneficial and dangerous components, and attacks only those that are
hazardous to the host.
Lately, the crucial role of the symbiosis between the commensal
bacteria and the intestinal immune system in maintaining good
health has attracted considerable attention. For instance, the development of GALTs such as Peyer’s patches and the induction of
oral tolerance are known to be impaired or delayed in germ-free
animals (1–5). Moreover, a correlation between the incidence of
atopic eczema in children and the composition of their intestinal
microbiota has been reported (6 –11). The following phenomena
observed specifically in the intestinal mucosa are thought to be
involved in establishment and maintenance of the symbiosis, although the precise underlying mechanisms have not yet been fully
elucidated. First, maturation of a specific population of dendritic
cells expressing CD103, which preferentially induce T cells with
regulatory properties, is accelerated in the intestine (12, 13). Second, the commensal bacteria regulate the differentiation of effector
T cells and achieve appropriate Th1/Th2 and Th17/regulatory T
Food and Physiological Functions Laboratory, College of Bioresource Sciences, Nihon University, Fujisawa-shi, Kanagawa, Japan
Received for publication April 22, 2009. Accepted for publication September 18,
2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
cell balances (14, 15). Third, production of IgA against the commensals is involved in keeping the number of the commensals at
an appropriate level (16). Additionally, it is also important that
intestinal epithelial cells (IECs),3 which form the boundary between the lumen and the internal milieu, acquire hyporesponsiveness to the commensals, because the lumenal surface of the epithelium is continually exposed to the commensals or their
components.
IECs not only physically separate luminal contents from the
internal milieu but also actively participate in the immune reactions as a frontline defense in the mucosal immune system. IECs
have been shown to receive stimulation from intestinal commensal
bacteria through TLRs, the pattern recognition receptors for microbial components, to maintain their homeostasis (17). However,
to prevent triggering excessive inflammatory reactions, they do not
respond in a sensitive manner to the commensals. Specifically,
IECs contribute to the maintenance of intestinal homeostasis by
partially tolerating the commensals and regulating mucosal inflammation. Decreased expression of specific TLRs and accessory molecules such as MD2 in IECs has been reported as one of the mechanisms controlling the hyporesponsiveness (18, 19). Additionally,
the expression of Toll-interacting protein, a negative regulator of
intracellular signals from TLRs, is known to be increased in IECs
(18). In contrast, excessive responses to the commensals and increased expression of specific TLRs, including TLR4, are often
observed in patients with inflammatory bowel disease (20). Therefore, expression of these molecules is thought to be regulated by
cell type-specific mechanisms in IECs to maintain the intestinal
symbiosis. Here we have analyzed the regulatory mechanisms of
TLR4 gene expression in IECs to elucidate one of the mechanisms
for maintaining the intestinal homeostasis.
1
This work was supported in part by a Grant-in Aid for Young Scientists from the
Ministry of Education, Culture, Sports, Science, and Technology of Japan (to K.T.)
and a Grant-in Aid for Scientific Research from Japan Society for the Promotion of
Science (to S.K.).
2
Address correspondence and reprint requests to Dr. Kyoko Takahashi, Food and
Physiological Functions Laboratory, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa-shi, Kanagawa 252-8510, Japan. E-mail address:
[email protected]
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901271
3
Abbreviations used in this paper: IEC, intestinal epithelial cell; DN, dominant negative; qPCR, quantitative PCR; ChIP, chromatin immunoprecipitation; 5-aza-dC,
5-aza-2⬘-deoxycytidine; TSA, trichostatin A; siRNA, small interfering RNA; KRAB,
Kruppel-associated box; KAP, KRAB-associated protein; ICSBP, interferon consensus sequence-binding protein.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Intestinal epithelial cells (IECs) are continuously exposed to large numbers of commensal bacteria but are relatively insensitive
to them, thereby averting an excessive inflammatory reaction. In this study, we show that the low responsiveness of human IEC
lines to LPS was mainly brought about by a down-regulation of TLR4 gene transcription. Additionally, the presence of an
IEC-specific repressor element in the 5ⴕ region of the TLR4 gene and binding of a NF to the element was shown. The transcription
factor ZNF160, which was expressed more abundantly in a LPS-low responder IEC line than in a LPS-high responder IEC line,
repressed TLR4 gene transcription. ZNF160 is known to interact with the scaffold protein KAP1 via its N terminus to recruit
histone deacetylase. Histone deacetylation, as well as DNA methylation, at the 5ⴕ region of the TLR4 gene was significantly higher
in LPS-low responder IEC lines than in a monocyte line or a LPS-high responder IEC line. It was demonstrated that TLR4 gene
transcription was repressed by these epigenetic regulations, which were, at least in part, dependent on ZNF160. Down-regulaton
of TLR4 gene expression by these mechanisms in IECs possibly contributes to the maintainance of homeostasis in the intestinal
commensal system. The Journal of Immunology, 2009, 183: 6522– 6529.
The Journal of Immunology
Materials and Methods
Cell culture
The human epithelial colonic adenocarcinoma cell lines Caco-2 and HT-29
and the human epithelial colonic carcinoma cell lines HCT 116 and T84,
as well as the human monocyte line THP-1, were purchased from DS
Pharma Biomedical. The human epithelial colonic adenocarcinoma cell
line SW480 was provided by the Cell Resource Center for Biomedical
Research Institute of Development, Aging, and Cancer Center at Tohoku
University (Miyagi, Japan). Caco-2 cells were cultured in Eagle’s MEM
(Nissui) supplemented with nonessential amino acids (Invitrogen). HCT
116 and HT-29 cells were cultured in McCoy’s 5a medium (MP Biomedicals). T84, SW480, and THP-1 cells were cultured in a 1/1 mixture of
Ham’s F12 (Nissui) and DMEM (Nissui), a 1/1 mixture of L15 (MP Biomedicals) and DMEM, and RPMI 1640 (Nissui), respectively. All media
were supplemented with 10% (v/v) FBS (Biowest), 100 U/ml of penicillin
(Meiji), 100 ␮g/ml streptomycin (Meiji), and 5 ⫻ 10⫺5 M 2-ME. Cells
were cultured at 37°C in a humidified incubator with 5% CO2.
Measurement of IL-8 production
Measurement of NF-␬B activation by a reporter gene assay
nt ⫺675/⫹188 region, 5⬘-gcggtacCTTCAGTATATTCCATTCTGAAA
TC-3⬘; for amplification of the nt ⫺218/⫹188 region, 5⬘-gcggtacCACC
GTCATCCTAGAGAGTTACAAG-3⬘; for amplification of the nt
⫺6/⫹188 region, 5⬘-gcggtacCAGAATGCTAAGGTTGCCGCTTTC-3⬘.
The nucleotides denoted by lowercase letters were inserted to introduce a
KpnI site (underlined). The synthetic oligonucleotide 5⬘-gaagatctCTGG
CATCATCCTCACTGCTTCTG-3⬘ was used as a common reverse primer
(nucleotides denoted by small letters were inserted to introduce a BglII site
(underlined)).
The TLR4 siRNA expression plasmid was constructed as follows: a
double-stranded DNA was generated by annealing the following
synthetic oligonucleotides: top strand, 5⬘-GATCCGCTCACAATC
TTACCAATCTCTGTGAAGCCACGATGGGAATTGGTAAGATTGTG
AGCTTTTTTA-3⬘; bottom strand, 5⬘-AGTTAAAAAGCTACAATTTA
TCAATCTCCATCGTGGCTTCACAGAGATTGGTAAGATGTGACG3⬘. The double-stranded DNA was inserted into pBAsi-hU6 Pur vector
(Takara Bio) at the BamHI/HindIII site. After confirming the sequence, the
resulting plasmid was named pBAsi-TLR4. The control plasmid, pBAsicont, carrying the insert with the same A, T, C, and G composition as seen
in pBAsi-TLR4 was similarly constructed using the following synthetic
oligonucleotides: top strand, 5⬘-GACGACATATCTTCACACCATCTT
GAAGCACAGATGGATGGTGTGAAGATATGTCTTTTT-3⬘; bottom
strand, 5⬘-AGCTTAAAAAGACATATCTTCACACCATCCCTCTGTGG
TTCACGATGGTGTGAAAGAAATGTCG-3⬘.
To construct an expression plasmid for ZNF160, full-length ZNF160
cDNA was reverse-transcribed and amplified from total RNA prepared
from Caco-2 cells. The following synthetic oligonucleotide primers were
used for PCR amplification: forward, 5⬘-GGATGGCCCTTACTCAGGTA
CGGTTGACA-3⬘; reverse, 5⬘-TTTGTAAAAATTAACTGATGTGAAAG
GAGTG-3⬘. The amplified product was cloned into pcDNA3.1 vector (Invitrogen) in the correct and reverse directions to yield pcDNA3.1-ZNF160
sense and pcDNA3.1-ZNF160 antisense, respectively. The control empty
vector pCDNA3.1-empty was generated by self-ligation of BstXI-digested
pcDNA3.1.
Cells were transfected with 1.5 ␮g of NF-␬B reporter plasmid carrying
NF-␬B binding sites upstream of the luciferase gene using FuGene HD
transfection reagent (Roche). Alternatively, cells were cotransfected with
1.5 ␮g of NF-␬B reporter plasmid and 1.5 ␮g of an expression plasmid
encoding the dominant-negative (DN) form of MyD88. The plasmid phRLCMV (1.25 ng/well; Promega) carrying the Renilla luciferase gene under
the control of the CMV promoter was introduced to normalize the transfection and cell lysis efficiencies in every experiment. Four hours after
transfection, ultra-pure E. coli K12 LPS (InvivoGen) was added to the
cells. After culturing the cells for an additional 20 h, the cells were harvested. Cell lysis and determination of luciferase activity were conducted
using a dual-luciferase assay kit (Promega) according to the manufacturer’s
instructions. Luminescence was measured with a Tristar LB941 luminometer (Berthold).
Cells were transfected with pBAsi-TLR4 or pBAsi-cont, both of which
carry a puromycin resistance gene as a selectable marker, using FuGene
HD transfection reagent (Roche) and cultured for 24 h. After adding 5
␮g/ml puromycin (Sigma-Aldrich) to select the transfected cells, cells were
cultured for an additional 48 h. Cells were then employed for measurement
of IL-8 production upon LPS stimulation as described above.
Quantitative RT-PCR (qRT-PCR)
FACS
Total RNA was prepared from each cell line using an RNeasy Mini Kit
(Qiagen) or a High Pure RNA isolation kit (Roche), and the first-strand
cDNA synthesis was then conducted using SuperScript II reverse transcriptase (Invitrogen). Messenger RNA expression was quantified by real-time
PCR with a LightCycler 480 (Roche) using SYBR Green I Master reagent
(Roche). The sequences of the synthetic oligonucleotides used as primers
are as follows: for detection of TLR4 gene expression, forward, 5⬘-AAGC
CGAAAGGTGATTGTTG-3⬘; reverse, 5⬘-CTGAGCAGGGTCTTCTCC
AC-3⬘; for detection of GAPDH gene expression as a control, forward, 5⬘TGAACGGGAAGCTCACTGG-3⬘; reverse, 5⬘-TCCACCACCCTGTTGC
TGTA-3⬘.
After treatment with Fc block (anti-mouse CD16/CD32; BD Biosciences),
cells were incubated with anti-human TLR4 mAb (clone HTA125;
eBioscience) or mouse IgG2a isotype control (eBioscience) in FACS
buffer (DMEM (pH 7.2) containing 0.5% BSA, 1 mM EDTA, 10 mM
HEPES, 2 mM sodium pyruvate, and 0.05% sodium azide) on ice for 30
min. After washing, the cells were incubated with biotinylated antimouse IgG (H⫹L) (eBioscience) on ice for 30 min followed by incubation with streptavidin-labeled PE (Invitrogen) and then analyzed on a
FACSCanto (BD Biosciences).
Plasmid construction
A DNA fragment corresponding to the nt ⫺1013/⫹188 region of the human TLR4 gene (nucleotide numbers are counted from the major transcription start site as ⫹1) was amplified by PCR from a human genomic
DNA library (Clontech). The following synthetic oligonucleotides were
used as primers: forward, 5⬘-CATACTGTATGATTCCACTTCTAAGA
GCTGCCT-3⬘; reverse, 5⬘-CTGGCATCATCCTCACTGCTTCTGTGAG
CAGCAG-3⬘. The amplified product was cloned into the pCR2.1 vector
(Invitrogen) to confirm the nucleotide sequence and then inserted into the
pGL3-basic vector (Promega) at the KpnI/XhoI sites upstream of the luciferase gene. The resulting plasmid was named pGL3-TLR4⫺1013/⫹188.
A series of deletion mutants of pGL3-TLR4⫺1013/⫹188, which carried nt
⫺675/⫹188, nt ⫺427/⫹188, nt ⫺218/⫹188, and nt ⫺6/⫹188 regions upstream of the luciferase gene, was constructed as follows: pGL3TLR4⫺427/⫹188 was generated by self-ligation of blunt-ended products
of KpnI/ApaI digested pGL3-TLR4⫺1013/⫹188. The other three fragments, nt ⫺675/⫹188, nt ⫺218/⫹188, and nt ⫺6/⫹188, were amplified by
PCR, digested with KpnI and BglII, and then inserted into KpnI/BglIIdigested-pGL3-basic vector. The sequences of the synthetic oligonucleotides used for the forward primers are as follows: for amplification of the
Knockdown of TLR4 expression
Measurement of transcriptional promoter activity by a reporter
gene assay
The reporter plasmid pGL-TLR4⫺1013/⫹118 (0.7 ␮g/well) was introduced into cells using FuGene HD transfection reagent (Roche). For overexpression experiments, cells were cotransfected with 0.5 ␮g of the reporter plasmid pGL-TLR4⫺1013/⫹188 and 0.5 ␮g of pcDNA3.1-ZNF160
sense, pcDNA3.1-ZNF160 antisense, or pcDNA3.1-empty. The plasmid
phRL-CMV (1.25 ng/well) was introduced to normalize the transfection
and cell lysis efficiencies in every experiment. After 20 –24 h of culture,
cells were harvested and washed with PBS. Cell lysis and determination of
luciferase activity were performed as described above.
Immunoprecipitation
Cells were washed with ice-cold PBS and incubated on ice for 30 min in
lysis buffer (20 mM Tris (pH 7.6), 1% Nonidet P-40, 60 mM octyl-␤glucoside, 2 mM PMSF, 10 ␮g/ml aprotinin, 2 ␮g/ml leupeptin, 2 ␮g/ml
pepstatin). Cell lysates were immunoprecipitated with anti-TLR4 mAb (clone
HTA125; eBioscience) or anti-TLR2 mAb (clone TL2.1; eBioscience) using
protein A-Sepharose (GE Healthcare). Immunoprecipitated proteins were detected by immunoblotting with anti-TLR4 or anti-TLR2 mAb. Part of each
nonimmunoprecipitated cell lysate was subjected to immunoblotting with
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Cells were stimulated for 18 h with 0.1–1000 ng/ml ultra-pure Escherichia
coli K12 LPS (InvivoGen), which is guaranteed to only activate the TLR4
pathway. Concentrations of secreted IL-8 in the culture supernatants were
measured with a human IL-8 ELISA kit (BioSource International) or Quantikine human CXCL/IL-8 (R&D Systems) according to the manufacturers’
instructions.
6523
6524
REGULATION OF TLR4 GENE EXPRESSION IN IECs
anti-␤-actin mAb (Abcam) to quantify the amounts of proteins present in
each lysate before immunoprecipitation.
Nuclear extract preparation
Nuclear extract was prepared from Caco-2 and THP-1 cells as described
previously (21).
EMSA
Double-stranded DNAs were prepared as probe A, B, and C by annealing
Alexa 647-labeled synthetic oligonucleotides. Nucleotide sequences of the
probes were as follows: probe A, 5⬘-GACTGTATATGGAGAGAGAGCC
TTG-3⬘; probe B, 5⬘-CCTTGAAAGAGGTATGTAAGGTAGA-3⬘; probe
C, 5⬘-GTAGAATGAGGTCATTATGGTGGGC-3⬘.
Fifteen micrograms of nuclear extract and 5 pmol of DNA probe were
incubated at room temperature in 10 mM HEPES buffer (pH 7.9) containing 400 ng of poly(dI:dC), 1 mM MgCl2, 30 mM KCl, 1 mM DTT, and 5%
glycerol for 20 min. The mixtures were separated by electrophoresis on 4%
polyacrylamide gels at 120 V for 2.0 –2.5 h in 0.25⫻ TBE buffer (22.5 mM
Tris, 22.5 mM boric acid, 0.5 mM DTT). Fluorescence was detected using
a Typhoon 9410 (GE Healthcare).
cDNA subtraction
cDNAs of the genes that were expressed more abundantly in Caco-2 cells
than in SW480 cells were enriched with a PCR-Select cDNA subtraction
kit (Clontech) according to the manufacturer’s instructions. Obtained
cDNA candidates were inserted into the pcDNA3.1/V5-His-TOPO vector
(Invitrogen) to yield their expression plasmids. The expression plasmids
were introduced into SW480 cells as groups of five clones together with the
reporter plasmid pGL3-TLR4⫺1013/⫹188 for a transient expression assay. Expression plasmids, contained in mixtures that gave luciferase activity less than half of that of the empty vector generated by self-ligation of
BstXI-digested pcDNA3.1/V5-His-TOPO, were separately introduced into
the cells to analyze the effects of each cDNA clone. The nucleotide sequences of the cDNA clones that repressed TLR4 gene transcription were
then determined.
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were performed as described previously (22) with slight modifications. Briefly, cells were exposed to 1% formaldehyde to crosslink the
chromatin, solubilized, and then sonicated with a Sonifier 450 (Branson) to
shear the genomic DNA to an average length of 500-1000 bp. Precleared
lysates were immunoprecipitated with anti-acetyl histone H3 Ab (Upstate
Biotechnology) or rabbit IgG as control (Upstate Biotechnology) using
salmon sperm DNA/protein A-agarose (Upstate Biotechnology). After
washing sequentially with four different wash buffers, the immunoprecipitated chromatin was eluted to reverse the cross-links. The 5⬘ region of the
TLR4 gene corresponding to nt ⫺529/⫺339 was amplified by PCR from
the recovered DNA using the synthetic oligonucleoides 5⬘-ACATATCG
AAGTCCTAACCCCTCTAC-3⬘ and 5⬘-GAGGCTTCCAGTCTGAACTC
AAG-3⬘ as primers. The GAPDH promoter region was amplified as a control using primers with the sequences 5⬘-TACTAGCGGTTTTACGGG
CG-3⬘ and 5⬘-TCGAACAGGAGGAGCAGAGAGCGA-3⬘.
For the ZNF160 overexpression experiment, cells were transfected with
pcDNA3.1-ZNF160 sense or pcDNA3.1-empty using FuGene HD transfection reagent. After 8 h, G418 (Sigma-Aldrich) was added to select for
transfected cells. Cells were cultured for an additional 40 h, harvested, and
subjected to ChIP assays employing anti-acetyl histone H3 Ab. The 5⬘
region of the TLR4 gene and that of the GAPDH gene in the immunoprecipitated DNA were quantified by real-time PCR analyses using the same
primers described above.
Bisulfite conversion reaction
Genomic DNA was prepared from cells using a PureLink Genomic DNA
Mini kit (Invitrogen) according to the manufacturer’s instructions. To analyze methylation of CpG motifs, 400 ng of genomic DNA was denatured
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 1. Responsiveness of human IEC lines to LPS correlates with their TLR4 mRNA expression levels. A, Several human IEC lines (Caco-2, HCT
116, T84, HT-29, and SW480) and a human monocyte line (THP-1) were stimulated with 0.1–1000 ng/ml LPS for 18 h. Secretion of IL-8 into the culture
supernatant was measured by ELISA. IL-8 production is represented on the graph by subtracting the concentrations in the supernatant of unstimulated cells
from those of stimulated cells. Results are represented as means ⫾ SD of two independent experiments. N.D. indicates not detected. B, Activation of NF-␬B
by stimulation with LPS was measured by reporter assays. Each cell line was cotransfected with a NF-␬B reporter plasmid and an expression plasmid
carrying MyD88 DN or an empty vector control and stimulated with the indicated concentrations of LPS. The fold increase in luciferase activity relative
to that of unstimulated cells transfected with the empty vector control is shown. Results are represented as means ⫾ SD of three independent experiments.
C, TLR4 mRNA expression in each cell line was determined by qRT-PCR. Relative values normalized using GAPDH mRNA levels are given. Results are
represented as means ⫾ SD of three independent experiments. D, A TLR4 siRNA expression plasmid or a control siRNA expression plasmid was
introduced into SW480 cells. After selection of the transfected cells with puromycin, TLR4 mRNA expression was determined by qRT-PCR. Relative
values normalized using GAPDH mRNA levels are given. Results are expressed as means ⫾ SD of four independent experiments: —, no transfection;
TLR4, transfected with the TLR4 siRNA expression plasmid; control, transfected with the control siRNA expression plasmid; ⴱ, p ⬍ 0.001. E, SW480 cells
were transfected with the TLR4 siRNA expression plasmid (filled bars) or the control siRNA expression plasmid (open bars). After selection with
puromycin, the transfected cells were stimulated with 0.1–1000 ng/ml LPS for 18 h to measure IL-8 secretion into the culture supernatant by ELISA. IL-8
production was calculated by subtracting the concentrations in the culture supernatant of unstimulated cells from those of stimulated cells. Results are
expressed as means ⫾ SD of four independent experiments. ⴱ, p ⬍ 0.05 and ⴱⴱ, p ⬍ 0.005 significantly different from control stimulated with the same
concentration of LPS.
The Journal of Immunology
6525
at 98°C for 10 min, modified by conversion reagent at 64°C for 2.5 h, and
then purified using a MethylCode bisulfite conversion kit (Invitrogen). The
5⬘ region of the TLR4 gene was amplified by PCR from the modified
genomic DNA. The sequences of the synthetic oligonucleotides used as
PCR primers are as follows: forward, 5⬘-GGTAGAGGTTAGATGATTAA
TTGGG-3⬘; reverse, 5⬘-CCCCAATAACTACCTCTAATACCCT-3⬘.
Following purification of PCR products, they were cloned into the
pCR2.1 vector for sequencing. Nucleotide sequences of 14 –16 clones for
each cell line were analyzed.
Inhibition of histone deacetylase and DNA methyltransferase
Caco-2 cells were treated with 10 ␮M 5-aza-2⬘-deoxycytidine (5-Aza-dC;
Calbiochem) for 4 days, with 80 nM trichostatin A (TSA; Cayman Chemical) for 24 h, or with TSA and 5-Aza-dC for 24 h after treatment with
5-aza-dC alone for 3 days. Cells were then harvested to obtain total RNA.
TLR4 mRNA expression was quantified by qRT-PCR as described above.
Results
Responsiveness of human IEC lines to LPS is down-regulated
mainly by repressing TLR4 gene transcription
FIGURE 2. LPS responsiveness of IEC lines is mainly regulated at the
transcriptional level. A, Cell surface expression of TLR4 on each IEC line
was determined by FACS using anti-TLR4 Ab. Results are representative
of three independent experiments. Shadowed areas, unstained; thin lines,
stained with isotype control Ab; bold lines, stained with anti-TLR4 Ab. B,
Transcriptional enhancing activity of the 5⬘ region of the human TLR4
gene (nt ⫺1013/⫹188) in each cell line was measured by a reporter gene
assay. Luciferase activities relative to that from a SV40 promoter control
are shown. Results are represented as means ⫾ SD of three independent
experiments. C, Protein expression of TLR4 and TLR2 in each cell line
was determined by immunoprecipitation. Amounts of protein included in
the cell lysates before immunoprecipitation were determined by immunoblotting with anti-␤-actin Ab. Data are representative of two independent
experiments.
shown that the responsiveness of IECs to LPS is down-regulated
mainly by suppressing transcription of the TLR4 gene.
Nucleotide ⫺489/⫺428 region of the TLR4 gene contains an
IEC-specific repressor element and is recognized by an
IEC-specific NF
To further examine the mechanisms of transcriptional repression
of the TLR4 gene in IECs, cis-acting elements in the 5⬘ region of
the TLR4 gene were compared between Caco-2 and THP-1 cells.
For this purpose, a series of deletion constructs were employed for
luciferase assays. Deletion of the nt ⫺675/⫺428 region increased
the luciferase activity in Caco-2 cells, while it hardly affected the
activity in THP-1 cells, suggesting that this region contains an
IEC-specific repressor element (Fig. 3A). Moreover, this region
was suggested to contain a responsive element that is repressed by
some microbe, because the transcriptional enhancing activity of nt
⫺675/⫹188 but not of nt ⫺427/⫹188 was decreased by the synthetic TLR2 ligand, Pam3CSK4 (Fig. 3B). Further mapping of the
repressor element in the nt ⫺675/⫺428 region by luciferase assays
using deletion constructs in Caco-2 cells revealed that the nt ⫺489/
⫺428 region acts as a repressor element (Fig. 3C). We next examined the presence of a NF binding to this region by EMSA using
three oligonucleotide probes covering this region and nuclear extracts prepared from Caco-2 and THP-1 cells. The shifted band
indicated by an arrow in Fig. 3D appeared when the nuclear extract
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Various human IEC lines were first analyzed for their ability to
respond to stimulation through TLR4. Five human IEC lines
(Caco-2, HCT 116, T84, HT-29, SW480) and a control monocyte
line (THP-1) were stimulated with LPS to measure IL-8 secretion
into the culture supernatant (Fig. 1A). Most IEC lines, with the
exception of SW480, showed low responsiveness to LPS compared with the monocyte line THP-1. Caco-2 and HCT 116 cells
barely responded, and HT-29 and T84 cells weakly responded to
LPS stimulation. In contrast, production of IL-8 from SW480 cells
was similar to, or even higher than, IL-8 production from the
monocyte line THP-1. The MyD88 dependency of these responses
was further examined by NF-␬B reporter assays (Fig. 1B). Consistent with the results for IL-8 production, activation of NF-␬B
was observed in SW480 and THP-1 cells when stimulated with
LPS, while it was hardly detected in Caco-2 cells. Activation of
NF-␬B was inhibited by exogenous expression of the DN form of
MyD88 in SW480 and THP-1 cells, indicating that the responses
to LPS were dependent on MyD88. The TLR4 mRNA expression
in each cell line was determined by qRT-PCR (Fig. 1C). The
amounts of TLR4 mRNA almost exactly correlated with the LPS
responsiveness of each cell line. Furthermore, TLR4 mRNA expression was reduced to about one-third in SW480 cells transfected with a TLR4 siRNA expression plasmid when compared
with the cells transfected with a control siRNA expression plasmid
(Fig. 1D), which led to a significant decrease in IL-8 production
upon stimulation with LPS (Fig. 1E). These results show that LPS
sensitivity is regulated by TLR4 gene expression in IECs. Next,
the cell surface expression of TLR4 and the transcriptional enhancing activity of the 5⬘ region of the gene upstream of the translation start codon were analyzed in each cell line (Fig. 2, A and B).
The cell surface expression of TLR4 was undetectable on Caco-2
and HCT 116 cells. On the other hand, HT-29 and T84 cells expressed a small amount of cell surface TLR4. SW480 cells expressed a higher level of cell surface TLR4 than did HT-29 and
T84 cells. The highest cell surface expression of TLR4 was observed on the monocyte line THP-1. The transcriptional promoter
activity of the 5⬘ region of the TLR4 gene was, in order, THP-1,
SW480 ⬎ HT-29, T84 ⬎ Caco-2, HCT 116. Intracellular protein
expression of TLR4 in each cell line was further analyzed by immunoprecipitation (Fig. 2C). TLR4 protein was barely detected in
Caco-2 cells but was detected at higher levels in SW480 and
THP-1 cells, while TLR2 was apparently detected in all cell lines.
These results indicate that expression of the TLR4 gene is mainly
regulated at the transcriptional level, although additional posttranscriptional regulation also seems to be present. Collectively, it was
6526
REGULATION OF TLR4 GENE EXPRESSION IN IECs
from Caco-2 cells but not from THP-1 cells was added, indicating
that a NF that was specifically expressed in Caco-2 cells bound to
the nt ⫺452/⫺428 region. Collectively, these results suggest that
a specific NF binds to the nt ⫺489/⫺428 region and represses
TLR4 gene transcription in IECs.
of nt ⫺675/⫹188 but not of nt ⫺427/⫹188 in SW480 cells,
indicating that ZNF160 acts through the nt ⫺675/⫺428 region
(Fig. 4, D and E).
ZNF160 represses TLR4 gene transcription in IECs
TLR4 gene transcription is down-regulated by epigenetic
modification including histone deacetylation and DNA
methylation in IECs
To elucidate the molecules involved in the transcriptional repression of the TLR4 gene in IECs, we screened a human cDNA library, using the PCR-select subtraction method, for molecules that
were expressed more abundantly in the LPS-low responder IEC
line Caco-2 than in the LPS-high-responder IEC line SW480. The
obtained cDNA clones were screened again to identify molecules
that repressed transcription of the TLR4 gene when overexpressed
in SW480 cells by a transient expression assay. Out of the 360
cDNA clones selected by subtraction, 7 clones, including 6 clones
that encoded 3 different molecules and 1 clone that did not encode
the protein in frame, decreased the TLR4 promoter activity to less
than half. One of the three identified molecules that were encoded
by cDNAs in frame and repressed activation of the TLR4 gene
promoter was ZNF160. As shown in Fig. 4A, it was confirmed that
ZNF160 mRNA expression was higher in Caco-2 cells than in
SW480 cells by qRT-PCR analyses. ZNF160 is a Kruppel-related
zinc finger protein characterized by the presence of the Kruppelassociated box (KRAB), a potent repressor of transcription, at the
N terminus (23). Overexpression of ZNF160 decreased the transcriptional promoter activity of the TLR4 gene in SW480 cells
(Fig. 4B), whereas, interestingly, it up-regulated the promoter
activity in the human monocyte line THP-1 (Fig. 4C). Furthermore, ZNF160 repressed the transcriptional enhancing activity
KRAB domains have been reported to recruit KRAB-associated
protein (KAP) 1 when tethered to DNA via their zinc finger motifs
(24, 25). KAP1 directly binds to KRAB and functions as a scaffold
for the formation of a multimolecular complex comprising histone
deacetylases, which induces transcriptional repression through the
formation of heterochromatin (26 –28). In addition to histone
deacetylation, it was recently reported that the KRAB domain can
trigger de novo DNA methylation (29). Histone acetylation and
DNA methylation are known to mediate epigenetic regulation of
gene expression. To investigate if TLR4 gene expression is controlled by these epigenetic mechanisms in IECs, acetylation of
histones interacting with the 5⬘ region of the TLR4 gene was analyzed by ChIP assays using anti-acetyl histone H3 Ab. As shown
in Fig. 5, acetylated histones interacting with the 5⬘ region of the
TLR4 gene were significantly lower in Caco-2 and HCT 116 cells,
both of which barely express TLR4, than in SW480 and THP-1
cells, indicating that the histones interacting with the 5⬘ region of
the TLR4 gene were highly deacetylated in LPS-low responder
IEC lines. DNA methylation of 11 CpG motifs existing in the 5⬘
region of the TLR4 gene (from nt ⫺69 to nt ⫹277) was next
analyzed by the bisulfite conversion reaction. As is shown in Fig.
6, the number of methylated CpG motifs was significantly higher
in Caco-2 and HCT 116 cells than in SW480 and THP-1 cells.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 3. Nucleotide ⫺489/⫺428 region contains an IEC-specific repressor element and is recognized by an IEC-specific NF. A, cis-Acting elements
in the 5⬘ region of the TLR4 gene were determined by a reporter gene assay using a series of deletion constructs in Caco-2 and THP-1 cells. Luciferase
activities relative to that of pGL3-TLR4⫺1013/⫹188 are shown. Results are expressed as means ⫾ SD of three independent experiments. PU.1 and ICSBP
binding sites reported by Rehli et al. (31) and enhancer and repressor elements suggested from our study are schematically drawn. B, Caco-2 cells were
transfected with the reporter plasmid pGL3-TLR4⫺1013/⫹188, pGL3-TLR4⫺675/⫹188, pGL3-TLR4⫺427/⫹188, or pGL3-TLR4⫺218/⫹188 for a
transient expression assay in the presence or absence of 1 ␮g/ml Pam3CSK4. Luciferase activities relative to those without Pam3CSK4 treatment are shown
in each graph. Results are expressed as means ⫾ SD of two independent experiments. C, For further mapping of a repressor element in the nt ⫺675/⫺428
region, Caco-2 cells were transfected with a series of deletion constructs for a transient expression assay. Luciferase activities relative to those of
pGL3-TLR4⫺1013/⫹188 are shown. Results are expressed as means ⫾ SD of three independent experiments. D, EMSA was performed using three
double-stranded oligonucleotide probes corresponding to the regions nt ⫺492/⫺468, nt ⫺472/⫺448, and nt ⫺452/⫺428 of the TLR4 gene and nuclear
extracts prepared from Caco-2 and THP-1 cells. Results are representative of three independent experiments.
The Journal of Immunology
6527
FIGURE 4. ZNF160, one of the molecules expressed more abundantly
in the LPS-low responder IEC line Caco-2 than in the LPS-high responder
IEC line SW480, represses transcription of the TLR4 gene. A, ZNF160
mRNA expression in Caco-2 and SW480 cells was determined by qRTPCR. Relative values normalized using GAPDH mRNA levels are given.
Results are expressed as means ⫾ SD of three independent experiments. ⴱ,
p ⬍ 0.05. B and C, SW480 (B), or THP-1 (C) cells were cotransfected with
the reporter plasmid pGL3-TLR4⫺1013/⫹188 and a ZNF160 expression
plasmid (pcDNA3.1-ZNF160 sense or pcDNA3.1-ZNF160 antisense) or an
empty vector control (pcDNA3.1-empty) for a transient expression assay.
Results are represented as means ⫾ SD of five to six independent experiments. D and E, SW480 cells were cotransfected with a reporter plasmid
carrying nt ⫺675/⫹188 (D) or nt ⫺427/⫹188 (E) of the TLR4 gene and
a ZNF-160 expression plasmid or an empty vector control for a transient
expression assay. Results are expressed as means ⫾ SD of three independent experiments. ⴱ, p ⬍ 0.05 and ⴱⴱ, p ⬍ 0.005, significantly different
from control transfected with an empty vector.
that DNA methylation and histone deacetylation are cooperatively
involved in the repression of TLR4 gene transcription (Fig. 7A).
Collectively, these results show that TLR4 gene transcription is
down-regulated by epigenetic modification including histone
deacetylation and DNA methylation in LPS-low responder IEC
lines.
The epigenetic modification is, at least in part, dependent on
ZNF160
To analyze the involvement of ZNF160 in epigenetic regulation,
ChIP assays of the endogenous TLR4 gene were performed employing SW480 cells transfected with a ZNF160 expression plasmid or an empty vector control. Acetylation of histones that interacted with the 5⬘ region of the TLR4 gene was significantly
reduced by the overexpression of ZNF160, while acetylation of
histones that interacted with the 5⬘ region of the GAPDH gene was
not affected (Fig. 7, B and C). The results indicate that epigenetic
Furthermore, the effects of the DNA methyltransferase inhibitor
5-aza-dC and/or the histone deacetylase inhibitor TSA were analyzed in Caco-2 cells. The expression of TLR4 increased ⬃10-fold
as a result of treatment with both 5-aza-dC and TSA, indicating
FIGURE 5. Histones interacting with the 5⬘ region of the TLR4 gene
are deacetylated in LPS-low responder IEC lines. ChIP assays of endogenous TLR4 genes in IEC lines were performed employing anti-acetyl
histone H3 Ab. Rabbit IgG was used as a control. The 5⬘ regions of the
TLR4 gene, and of the GAPDH gene as a control, were amplified by PCR
from the immunoprecipitated chromatin. The “input” lanes represent the
results of PCR using diluted fractions of nonimmunoprecipitated chromatin
as templates. Results are representative of three independent experiments.
FIGURE 7. Epigenetic modification is involved in repression of TLR4
gene transcription and is, at least in part, dependent on ZNF160. A, Caco-2
cells were treated with 10 ␮M 5-aza-dC (DNA methyltransferase inhibitor)
for 4 days or with 80 nM TSA (histone deacetylase inhibitor) for 24 h.
TLR4 mRNA expression was analyzed by qRT-PCR. Relative values, normalized using GAPDH mRNA levels, are expressed. Results are represented as means ⫾ SD of three independent experiments. B and C, SW480
cells were transfected with a ZNF160 expression plasmid (pcDNA3.1ZNF160 sense) or an empty vector control (pcDNA3.1-empty) and cultured for 8 h. After adding G418 to select the transfected cells, the cells
were cultured for an additional 40 h. ChIP assays were performed using
anti-acetyl histone H3 Ab or control rabbit IgG followed by qPCR for the
5⬘ regions of the TLR4 gene (B) and GAPDH control gene (C). Results are
represented as means ⫾ SD of three independent experiments. ⴱ, p ⬍ 0.05.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 6. The 5⬘ region of the TLR4 gene is highly methylated in
LPS-low responder IEC lines. DNA methylation of 11 CpG motifs existing
in the 5⬘ region of the TLR4 gene (nt ⫺69/⫹277) was analyzed by the
bisulfite conversion reaction. The modified DNA was amplified by PCR,
cloned, and sequenced for 14 –16 independent clones. A, Filled squares
indicate methylated CpG motifs, and open squares indicate unmethylated
CpG motifs. B, Mean numbers of methylated CpG motifs in the nt ⫺69/
⫹277 region and SD in each cell line are shown. ⴱ, p ⬍ 1 ⫻ 10⫺7 and ⴱⴱ,
p ⬍ 5 ⫻ 10⫺9.
6528
modification at the 5⬘ region of the TLR4 gene is, at least in part,
dependent on ZNF160.
Discussion
oligomerization and direct binding to KRAB (24, 25). A reduction
in acetylation of histones that interact with the 5⬘ region of the
TLR4 gene in IECs is thought to be dependent on histone deacetylase, which is recruited by ZNF160 through KAP1. Similarly, an
increase in methylation of the 5⬘ region of the TLR4 gene in IECs
is thought to be dependent on ZNF160. However, the contribution
of ZNF160 to the regulation of TLR4 gene expression seems to be
rather small compared with the large contribution of epigenetic
modifications to the repression of TLR4 gene expression. Actually,
overexpression of ZNF160 only suppressed transcriptional promoter activity of the TLR4 gene to about a half in SW480 cells
(Fig. 4B), while inhibitors of histone deacetylase and DNA methyltransferase together increased TLR4 gene expression by ⬃10fold in Caco-2 cells (Fig. 7A). Additionally, overexpression of
ZNF160 in the monocyte line increased transcriptional promoter
activity, while overexpression in the IEC line suppressed transcription (Fig. 4, B and C). These results suggest that ZNF160 and an
additional cell type-specific regulatory factor cooperatively repress
transcription of the TLR4 gene in IECs. Recently, a single nucleotide polymorphism with strong association to ileal Crohn’s disease was mapped to an intergenic region that is flanked on the
centromeric side by a gene encoding another zinc finger protein,
ZNF365 (32). Although the functions of ZNF365 are little known,
specific members of the C2H2 zinc finger proteins, which constitute the largest class of transcription factors in humans, may play
a role in the maintenance of intestinal homeostasis.
LPS responsiveness of IECs depends on TLR4 expression levels
as shown in Fig. 1E. Additionally, expression of MD-2 is thought
to be another important factor that determines the LPS responsiveness because optimal LPS recognition by TLR4 requires MD-2 as
a coreceptor. It has been reported that MD-2 expression in healthy,
normal intestinal mucosa is minimal, while it is increased in active
inflammatory bowel disease colitis (33, 34). Moreover, inhibition
of CpG methylation and histone deacetylation was shown to result
in increased mRNA expression of MD-2 gene in IECs just recently
(35). TLR4 and MD-2 expression may be down-regulated in part
by common or related mechanisms in IECs. On the other hand,
expression of TLR4 and TLR2 is thought to be regulated at different stages. TLR4 expression has been found to be regulated
mainly at the transcriptional level because its cell surface expression correlates relatively well with mRNA expression levels in
each cell line. However, regulation at the posttranslational level is
also thought to be present, as a difference in the cell surface TLR4
expression was seen between SW480 and THP1 cells despite these
cells having almost the same mRNA expression levels (Figs. 1 and
2). Since IL-8 production in response to LPS stimulation was
rather higher in SW480 cells than in THP-1 cells, a certain extent
of cell surface TLR4 expression seems to be sufficient to respond
to LPS. On the other hand, expression of TLR2 seemed to be
regulated mainly at the posttranslational level because its mRNA
and intracellular protein expression was not apparently different
between the IEC lines and the monocyte line, but its cell surface
expression was much lower in the IEC lines than in the monocyte
line (Fig. 2C and our unpublished data). Intracellular transport of
TLR2 protein to the cell surface is thought to be inhibited by a
specific mechanism in IECs.
Further study should allow elucidation of the entire regulatory
mechanism underlying transcription of symbiosis-associated
genes, including TLR4 in IECs and its contribution to regulation of
mucosal inflammation triggered by IECs, and, as a result, to maintenance of the intestinal commensal system.
Disclosures
The authors have no financial conflicts of interest.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
In this report, we show that TLR4 gene transcription is epigenetically suppressed in IECs to prevent excessive inflammatory responses. This means that epigenetic regulation of TLR4 gene expression in IECs can act as one mechanism for maintaining
intestinal homeostasis by suppressing excessive responses to the
commensals and regulating mucosal inflammation in the gut. Epigenetic information is encoded by differential methylation of DNA
on cytosines and by proteins associating with DNA such as histones, which may be modified covalently by acetylation, methylation, phosphorylation, and/or ubiquitination. Since this epigenetic
information is heritable beyond cell division, the importance of
epigenetic regulation is established especially in the fields of developmental and cancer biology. This is the first report to describe
the involvement of epigenetic regulation of transcription in the
maintenance of the intestinal commensal system. Although the intestinal epithelium is known to be continuously renewed by rapid
turnover of IECs, there are many reports supporting that the characteristics of IECs including their tolerated responses to the commensals are inherited by renewed cells, raising the possibility that
epigenetic regulation as seen in our study is involved in such inheritance. These basic mechanisms may work commonly in other
commensal systems in specific tissues in our body such as the skin
epidermis or the mucosa of the oral cavity, in addition to the intestine, all of which are continuously exposed to nonpathogenic
microbes. Zampetaki et al. recently reported that murine TLR4
gene expression is epigenetically repressed in embryonic stem
cells but not in embryonic stem cell-derived differentiated smooth
muscle cells (30). Epigenetic repression may be released in differentiated cells except specific types of cells including IECs.
Rehli et al. reported that transcription factors of PU.1 and IFN
consensus sequence-binding protein (ICSBP) regulate human
TLR4 gene expression in myeloid cells through elements just upstream of the transcription start site (31). As shown in Fig. 3A,
additional enhancer elements seem to be present further upstream
of the PU.1 and ICSBP binding sites identified by Rehli et al.
Moreover, the presence of an IEC-specific repressor element in the
5⬘ region of TLR4 gene and an IEC-specific NF binding to the
element has been suggested. We tried to identify the transcription
factor forming the Caco-2-specific band shown in Fig. 3D but were
unsuccessful. Since it was found that ZNF160 acts through the nt
⫺675/⫺428 region (Fig. 4, D and E), it was thought that ZNF160
binds to this region. However, in vitro translation products of
ZNF160 did not bind to the double-stranded DNA probe containing this region in EMSA (data not shown). Some modification of
the ZNF-160 protein may be required for DNA binding, or, alternatively, ZNF-160 may indirectly bind to this region through another DNA binding factor. Stimulation with Pam3CSK4 repressed
the transcriptional enhancing activity of the 5⬘ region of the TLR4
gene through the nt ⫺675/⫺428 region (Fig. 3B). It is unclear at
present whether specific microbial components modify transcription of the TLR4 gene, although LPS may not affect transcriptional
activation because expression of TLR4 recognizing LPS was undetectable on Caco-2 cells (Fig. 2A).
The epigenetic regulation of TLR4 gene expression has been
found to be partly dependent on ZNF160, a repressive transcription
factor possessing the KRAB domain, which has been reported to
recruit histone deacetylase through the scaffold protein KAP1.
KAP1 is characterized by the presence of a RING finger, B boxes,
a coiled-coil region, a PHD finger, and a bromodomain; the first
three of these motifs are both necessary and sufficient for homo-
REGULATION OF TLR4 GENE EXPRESSION IN IECs
The Journal of Immunology
References
19. Abreu, M. T., P. Vora, E. Faure, L. S. Thomas, E. T. Arnold, and M. Arditi. 2001.
Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal
epithelial cell protection against dysregulated proinflammatory gene expression
in response to bacterial lipopolysaccharide. J. Immunol. 167: 1609 –1616.
20. Cario, E., and D. K. Podolsky. 2000. Differential alteration in intestinal epithelial
cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel
disease. Infect. Immun. 68: 7010 –7017.
21. Takahashi, K., N. Hayashi, S. Shimokawa, N. Umehara, S. Kaminogawa, and
C. Ra. 2008. Cooperative regulation of Fc receptor ␥-chain gene expression by
multiple transcription factors, including Sp1, GABP, and Elf-1. J. Biol. Chem.
283: 15134 –15141.
22. Takahashi, K., N. Hayashi, S. Kaminogawa, and C. Ra. 2006. Molecular mechanisms for transcriptional regulation of human high affinity IgE receptor ␤-chain
gene induced by GM-CSF. J. Immunol. 177: 4605– 4611.
23. Halford, S., M. G. Mattei, S. Daw, and P. J. Scambler. 1995. A novel C2H2
zinc-finger protein gene (ZNF160) maps to human chromosome 19q13.3– q13.4.
Genomics 25: 322–323.
24. Kim, S. S., Y. M. Chen, E. O’Leary, R. Witzgall, M. Vidal, and J. V. Bonventre.
1996. A novel member of the RING finger family, KRIP-1, associates with the
KRAB-A transcriptional repressor domain of zinc finger proteins. Proc. Natl.
Acad. Sci. USA 93: 15299 –15304.
25. Friedman, J. R., W. J. Fredericks, D. E. Jensen, D. W. Speicher, X. P. Huang,
E. G. Neilson, and F. J. Rauscher, 3rd. 1996. KAP-1, a novel corepressor for the
highly conserved KRAB repression domain. Genes Dev. 10: 2067–2078.
26. Jakobsson, J., M. I. Cordero, R. Bisaz, A. C. Groner, V. Busskamp,
J. C. Bensadoun, F. Cammas, R. Losson, I. M. Mansuy, C. Sandi, and D. Trono.
2008. KAP1-mediated epigenetic repression in the forebrain modulates behavioral vulnerability to stress. Neuron 60: 818 – 831.
27. Sripathy, S. P., J. Stevens, and D. C. Schultz. 2006. The KAP1 corepressor
functions to coordinate the assembly of de novo HP1-demarcated microenvironments of heterochromatin required for KRAB zinc finger protein-mediated transcriptional repression. Mol. Cell. Biol. 26: 8623– 8638.
28. Ayyanathan, K., M. S. Lechner, P. Bell, G. G. Maul, D. C. Schultz, Y. Yamada,
K. Tanaka, K. Torigoe, and F. J. Rauscher, 3rd. 2003. Regulated recruitment of
HP1 to a euchromatic gene induces mitotically heritable, epigenetic gene silencing: a mammalian cell culture model of gene variegation. Genes Dev. 17:
1855–1869.
29. Wiznerowicz, M., J. Jakobsson, J. Szulc, S. Liao, A. Quazzola, F. Beermann,
P. Aebischer, and D. Trono. 2007. The Kruppel-associated box repressor domain
can trigger de novo promoter methylation during mouse early embryogenesis.
J. Biol. Chem. 282: 34535–34541.
30. Zampetaki, A., Q. Xiao, L. Zeng, Y. Hu, and Q. Xu. 2006. TLR4 expression in
mouse embryonic stem cells and in stem cell-derived vascular cells is regulated
by epigenetic modifications. Biochem. Biophys. Res. Commun. 347: 89 –99.
31. Rehli, M., A. Poltorak, L. Schwarzfischer, S. W. Krause, R. Andreesen, and
B. Beutler. 2000. PU.1 and interferon consensus sequence-binding protein regulate the myeloid expression of the human Toll-like receptor 4 gene. J. Biol.
Chem. 275: 9773–9781.
32. Rioux, J. D., R. J. Xavier, K. D. Taylor, M. S. Silverberg, P. Goyette, A. Huett,
T. Green, P. Kuballa, M. M. Barmada, L. W. Datta, et al. 2007. Genome-wide
association study identifies new susceptibility loci for Crohn disease and implicates autophagy in disease pathogenesis. Nat. Genet. 39: 596 – 604.
33. Abreu, M. T., E. T. Arnold, L. S. Thomas, R. Gonsky, Y. Zhou, B. Hu, and
M. Arditi. 2002. TLR4 and MD-2 expression is regulated by immune-mediated
signals in human intestinal epithelial cells. J. Biol. Chem. 277: 20431–20437.
34. Cario, E., D. T. Golenbock, A. Visintin, M. Rünzi, G. Gerken, and
D. K. Podolsky. 2006. Trypsin-sensitive modulation of intestinal epithelial MD-2
as mechanism of lipopolysaccharide tolerance. J. Immunol. 176: 4258 – 4266.
35. Vamadevan, A. S., M. Fukata, E. T. Arnold, L. S. Thomas, D. Hsu, and
M. T. Abreu. 2009. Regulation of Toll-like receptor 4-associated MD-2 in intestinal epithelial cells: a comprehensive analysis. Innate Immun. [Epub ahead of
print on Aug. 26, 2009].
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
1. Sudo, N., S. Sawamura, K. Tanaka, Y. Aiba, C. Kubo, and Y. Koga. 1997. The
requirement of intestinal bacterial flora for the development of an IgE production
system fully susceptible to oral tolerance induction. J. Immunol. 159: 1739 –1745.
2. Cebra, J. J., S. B. Periwal, G. Lee, F. Lee, and K. E. Shroff. 1998. Development
and maintenance of the gut-associated lymphoid tissue (GALT): the roles of
enteric bacteria and viruses. Dev. Immunol. 6: 13–18.
3. Umesaki, Y., H. Setoyama, S. Matsumoto, A. Imaoka, and K. Itoh. 1999. Differential roles of segmented filamentous bacteria and clostridia in development of
the intestinal immune system. Infect. Immun. 67: 3504 –3511.
4. Talham, G. L., H. Q. Jiang, N. A. Bos, and J. J. Cebra. 1999. Segmented filamentous bacteria are potent stimuli of a physiologically normal state of the murine gut mucosal immune system. Infect. Immun. 67: 1992–2000.
5. Gaboriau-Routhiau, V., and M. C. Moreau. 1996. Gut flora allows recovery of
oral tolerance to ovalbumin in mice after transient breakdown mediated by cholera toxin or Escherichia coli heat-labile enterotoxin. Pediatr. Res. 39: 625– 629.
6. Penders, J., C. Thijs, P. A. van den Brandt, I. Kummeling, B. Snijders, F. Stelma,
H. Adams, R. van Ree, and E. E. Stobberingh. 2007. Gut microbiota composition
and development of atopic manifestations in infancy: the KOALA Birth Cohort
Study. Gut 56: 661– 667.
7. Mah, K. W., B. Björkstén, B. W. Lee, H. P. van Bever, L. P. Shek, T. N. Tan,
Y. K. Lee, and K. Y. Chua. 2006. Distinct pattern of commensal gut microbiota
in toddlers with eczema. Int. Arch. Alelrgy Immunol. 140: 157–163.
8. Sepp, E., K. Julge, M. Mikelsaar, and B. Björkstén. 2005. Intestinal microbiota
and immunoglobulin E responses in 5-year-old Estonian children. Clin. Exp.
Allergy 35: 1141–1146.
9. Watanabe, S., Y. Narisawa, S. Arase, H. Okamatsu, T. Ikenaga, Y. Tajiri, and
M. Kumemura. 2003. Differences in fecal microflora between patients with atopic
dermatitis and healthy control subjects. J. Allergy Clin. Immunol. 111: 587–591.
10. Kalliomäki, M., P. Kirjavainen, E. Eerola, P. Kero, S. Salminen, and E. Isolauri.
2001. Distinct patterns of neonatal gut microflora in infants in whom atopy was
and was not developing. J. Allergy Clin. Immunol. 107: 129 –134.
11. Björkstén, B., E. Sepp, K. Julge, T. Voor, and M. Mikelsaar. 2001. Allergy
development and the intestinal microflora during the first year of life.
J. Allergy Clin. Immunol. 108: 516 –520.
12. Jaensson, E., H. Uronen-Hansson, O. Pabst, B. Eksteen, J. Tian, J. L. Coombes,
P. L. Berg, T. Davidsson, F. Powrie, B. Johansson-Lindbom, and W. W. Agace.
2008. Small intestinal CD103⫹ dendritic cells display unique functional properties that are conserved between mice and humans. J. Exp. Med. 205: 2139 –2149.
13. Coombes, J. L., K. R. Siddiqui, C. V. Arancibia-Cárcamo, J. Hall, C. M. Sun,
Y. Belkaid, and F. Powrie. 2007. A functionally specialized population of mucosal CD103⫹ DCs induces Foxp3⫹ regulatory T cells via a TGF-␤ and retinoic
acid-dependent mechanism. J. Exp. Med. 204: 1757–1764.
14. Ménard, O., M. J. Butel, V. Gaboriau-Routhiau, and A. J. Waligora-Dupriet.
2008. Gnotobiotic mouse immune response induced by Bifidobacterium sp.
strains isolated from infants. Appl. Environ. Microbiol. 74: 660 – 666.
15. Ivanov, I. I., L. Frutos Rde, N. Manel, K. Yoshinaga, D. B. Rifkin, R. B. Sartor,
B. B. Finlay, and D. R. Littman. 2008. Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell
Host Microbe 4: 337–349.
16. Macpherson, A. J., K. D. McKoy, F. E. Johansen, and P. Brandtzaeg. 2008. The
immune geography of IgA induction and function. Mucosal Immunol. 1: 11–22.
17. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, and R Medzhitov. 2004. Recognition of commensal microflora by Toll-like receptors is required for intestinal homeostasis. Cell 118: 229 –241.
18. Melmed, G., L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen,
Y. Zhou, B. Hu, M. Arditi, and M. T. Abreu. 2003. Human intestinal epithelial
cells are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands:
implications for host-microbial interactions in the gut. J. Immunol. 170:
1406 –1415.
6529