Periplasmic glucose-binding protein from
Pseudomonas putida CSV86 – identification of the
glucose-binding pocket by homology-model-guided
site-specific mutagenesis
Arnab Modak, Prasenjit Bhaumik and Prashant S. Phale
Department of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, India
Keywords
homology modeling; molecular docking;
periplasmic binding protein; Pseudomonas;
site-directed mutagenesis
Correspondence
P. S. Phale, Department of Biosciences and
Bioengineering, Indian Institute of
Technology Bombay, Powai, Mumbai
400 076, India
Fax: +91 22 2572 3480
Tel: +91 22 2576 7836
E-mail: [email protected]
(Received 24 June 2013, revised 30
October 2013, accepted 4 November 2013)
doi:10.1111/febs.12607
Glucose transport in Pseudomonas putida CSV86 is mediated via a periplasmic glucose-binding protein (GBP)-dependent putative glucose ABC transporter. Here we describe a homology model and functional
characterization of GBP from CSV86 (ppGBP). A whole-cell [14C]-glucose
uptake study revealed that glucose is transported by the high-affinity intracellular phosphorylative pathway. ppGBP was cloned, over-expressed in
Escherichia coli and purified to apparent homogeneity. The purified
ppGBPs from both E. coli and CSV86 were found to be specific for glucose. A homology model of ppGBP was constructed that resembles the
class II family of periplasmic binding proteins. The model showed highest
structural similarity to GBP of Thermus thermophilus (ttGBP, rmsd
Structural analysis and molecular docking studies predicted W35,
0.64 A).
W36, E41, K92, K339 and H379 of ppGBP as putative glucose-binding
residues. Alanine substitution of these residues resulted in significantly
reduced [14C]-glucose binding activity. Analysis of the operonic arrangement and structural comparative studies suggested that ppGBP and ttGBP
probably originated from a common ancestor. Structural adaptations that
inhibit binding of di- or trisaccharides at the glucose-binding pocket of
ppGBP were also identified.
Introduction
A specific hierarchy exists in all organisms for utilization of carbon sources. For example, Escherichia coli
utilizes simple sugars such as glucose followed by complex sugars such as lactose, leading to a diauxic
growth response [1]. This phenomenon is known as
carbon catabolite repression [2]. Unlike E. coli, Pseudomonas sp. preferentially utilize organic acids such as
succinate, citrate etc. rather than sugars. This phenomenon is known as ‘reverse carbon catabolite repression’
[3]. One of the major reasons for the inefficiency of
pseudomonads in the process of bioremediation,
despite their metabolic versatility, may be due to car-
bon catabolite repression, which is poorly understood
[4].
Pseudomonas putida CSV86 (hereafter referred to as
CSV86), a soil isolate, utilizes naphthalene, methylnaphthalenes, benzyl alcohol, benzoate and phenylacetate as the sole source of carbon and energy [5–8]. The
draft genome sequence of this strain has recently been
determined [9]. The unique property of CSV86 is its
ability to utilize aromatic compounds preferentially to
glucose and co-metabolism of aromatic compounds
and organic acids [10]. Aromatic and organic acidmediated repression of OprB (an outer membrane pro-
Abbreviations
ABC, ATP-binding cassette; GBP, glucose-binding protein; IPTG, isopropyl thio-b-D-galactoside; MBP, maltose-binding protein; PBP,
periplasmic binding protein.
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
365
Structure–function relationship in ppGBP
366
cant movements in domains that stabilize the closed
conformation, with the ligand(s) bound in the cleft
between the two domains [23,24]. This process is
termed as the ‘Venus flytrap’ mechanism [25]. Periplasmic GBP (44 kDa) was purified from Pseudomonas aeruginosa and was found to be specific to glucose
(Kd 0.35 lM) [26]. However, information regarding the
structure of GBP from Pseudomonas sp. is not available.
Here we report, for the first time, the results of biochemical and structure–function studies on ppGBP
from Pseudomonas sp. The periplasmic GBP from
P. putida CSV86 was cloned, purified and biochemically characterized. Further, the 3D structure was
modeled, and putative glucose-binding residues were
identified and validated by site-directed mutagenesis,
followed by functional analysis.
Results
Glucose uptake in Pseudomonas putida CSV86 is
mediated by a high-affinity transporter
[14C]-glucose uptake by whole cells revealed the Km
and
Vmax
values
to
be
0.81 lM
and
6.9 nmolmin 1mg 1 dry weight, respectively, suggesting that glucose uptake in the cells is mediated by a
high-affinity transport system (Fig. 1). Similar values
have been reported for glucose transport in other
Pseudomonas species: P. chlororaphis (Km 0.3 lM; Vmax
8.8 nmolmin 1mg 1), P. fluoroscens (Km 1.4 lM;
Vmax 29.7 nmolmin 1 mg 1) [27], P. aeruginosa (Km
8 lM) [28] and P. putida U (Km 8.3 lM) [29].
8
Rate (nmol min–1 mg–1)
tein that allows the passage of sugar molecules across
the outer membrane) [11], periplasmic glucose-binding
protein (ppGBP) [12] and the glucose-metabolizing
enzyme Zwf [13] was found to be responsible for this
ability. In addition, identification of genes encoding
various components of the glucose uptake system
(which includes OprB, GBP and three subunits of the
ATP binding cassette (ABC) transporter) [9] led us to
hypothesize the presence of a high-affinity GBP-dependent ABC transporter in P. putida CSV86. Both GBP
and OprB were found to be induced by glucose and
suppressed by aromatic compounds and organic acids.
These proteins were also found to be repressed in
CSV86 in the first log phase of diauxic growth in the
presence of aromatic compounds/organic acids and
glucose [11,12]. This allows CSV86 to preferentially
utilize aromatic compounds and organic acids over
glucose. This property is unique and can be used for
efficient bioremediation.
The periplasmic binding protein (PBP)-dependent
ABC transporters comprise an important class of
active transport systems for uptake of ions and nutrients by prokaryotes. PBPs confer specificity to these
importers by binding to the substrate and delivering it
to the cognate membrane transport assembly located
in the inner membrane. PBPs themselves form a protein superfamily that includes members that are integral part of other functional complexes such as
prokaryotic two-component regulatory systems [14],
prokaryotic tripartite ATP-independent periplasmic
transporters [15,16], and ligand-gated ion channels
[17]. The PBPs are monomeric (molecular mass range
25–70 kDa). Although there is little sequence similarity
among PBPs, their spatial structural fold is highly conserved, suggesting that they have originated from a
common ancestor [18]. The core of all PBPs consists
of two structurally conserved globular domains
(mainly a/b type), with a central b-sheet of five bstrands flanked by a-helices, connected by two or three
segments of polypeptide (a hinge region), usually in
extended conformation [19]. PBPs were classified based
on the topology of the b-sheets core in the domains.
The sheet topology in type I is b2b1b3b4b5, whereas
that in type II is b2b1b3bnb4, where bn represents the
strand after the first cross-over from the N-terminal
domain to the C-terminal domain and vice versa [18].
However, based on structural alignment of available
crystal structures, PBPs were re-classified into six clusters: A–F [20]. In the absence of ligand, PBPs exist largely in the open conformation, with both domains
separated, with possibly a small fraction in a closed
un-liganded state [21,22]. Interaction with the ligand
(s), as reported for most of the PBPs, leads to signifi-
A. Modak et al.
6
4
2
0
0
5
10
15
20
25
30
[14C]-Glucose (µM)
Fig. 1. Glucose uptake rate for Pseudomonas putida CSV86. [14C]glucose saturation profile for glucose-grown CSV86 cells. Curve
fitting was performed using a Michaelis–Menten model.
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
A. Modak et al.
Structure–function relationship in ppGBP
mini did not affect the glucose-binding activity of the
protein, indicating no alteration in the structures of
these proteins.
ppGBP was purified to apparent homogeneity from
E. coli (Fig. 2B, yield 1.09 mgg 1 cells, wet weight)
and partially purified from CSV86 (Fig. 2C, yield
0.05 mgg 1 cells, wet weight). ppGBP from E. coli
was treated with thrombin to remove the N-terminal
His6 tag, resulting in a molecular mass of ~ 43 kDa on
SDS/PAGE (Fig. 2B). Gel-filtration chromatography
of the thrombin-treated protein showed a single peak
(Fig. 2D, native molecular mass ~ 47 kDa), which
coincided with the [14C]-glucose binding activity peak.
In the text below, ppGBP purified from P. putida
CSV86 and the recombinant protein purified from
E. coli are referred as ppGBP (CSV86) and ppGBP
(E. coli), respectively.
Cloning, expression and purification of ppGBP
B
P
S
1
M
M
kDa
2
CS
97
66
97
66
43
43
43
29
29
29
20
14
20
20
D 0.5
O.D. at 280 nm
kDa
kDa
97
66
M
14
100
80
0.4
60
0.3
40
0.2
20
0.1
0
pmoles bound/mL
S
GB
G
P
BP
BP
G
P
C
I
UI
A
V8
6
The low yield and purity of ppGBP obtained from
CSV86 prompted to clone the gene encoding periplasmic ppGBP into pET28a for over-expression in E. coli
BL21(DE3). The constructs were sequenced at Xcelris
Labs, Ahmedabad, India, and the gene sequence was
deposited in GenBank (accession number JQ585252.1).
Upon induction with isopropyl thio-b-D-galactoside
(IPTG), the majority of the protein was found to be
present in the pellet (Fig. 2A). However, the soluble
fraction of this construct showed higher [14C]-glucosebinding activity (20 pmol bound per mg protein, 6–7fold higher) compared to the soluble fraction of IPTGinduced E. coli BL21(DE3) (3 pmol bound per mg
protein) as well as E. coli transformed with empty
pET28a vector (2.3 pmol bound mg per protein). The
presence of a His or Pro tag at the N-, C- or both ter-
0.0
30
35
40
45
50
Fraction no.
Fig. 2. Expression and purification of ppGBP. (A) SDS/PAGE analysis of ppGBP in Escherichia coli BL21 (DE3) cells when un-induced (UI) or
induced (I) with IPTG. ppGBP in the pellet (P, inclusion bodies) and soluble protein fraction (S) is indicated by an arrowhead. M indicates
standard protein molecular mass markers. (B) SDS/PAGE analysis of immobilized metal affinity-purified ppGBP from E. coli before (lane 1)
and after (lane 2) thrombin cleavage. (C) SDS/PAGE analysis of partially purified ppGBP from Pseudomonas putida CSV86 cells. (D) Gel
filtration protein elution profile for thrombin-treated ppGBP (E. coli, open circles) and corresponding [14C]-glucose binding activities (open
triangles). Inset: plot of log Mr (molecular mass) versus Velution/Vvoid (Ve/V0) for ppGBP (filled circles, thrombin-treated) purified using
Sephacryl S-200 HR gel-filtration chromatography. The column was pre-equilibrated with binding buffer and calibrated with standard
molecular mass marker proteins (open circles): alcohol dehydrogenase [150], bovine serum albumin [66] and carbonic anhydrase [29].
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
367
Structure–function relationship in ppGBP
Substrate specificity of ppGBP (Escherichia coli)
A 100-fold molar excess concentration of unlabeled
glucose displaced [14C]-glucose binding to ppGBP
(E. coli) by ~ 95%. However, other unlabeled sugars
(fructose, xylose, mannose, galactose, arabinose and
ribose), sugar alcohols (mannitol and glycerol), organic
acids (gluconate, succinate and pyruvate), or aromatic
compounds (salicylate, benzyl alcohol and naphthalene) did not show any significant displacement of
[14C]-glucose binding to ppGBP (E. coli, Fig. 3). This
indicates that the ppGBP is specific for glucose.
Molecular modeling and identification of putative
residues involved in glucose binding
The structure of GBP from Pseudomonas species is not
available. To understand the nature of interaction
between the residues at the binding pocket and glucose, the structure of ppGBP was modeled using the ITASSER server (Fig. 4A). The best-fit model yielded a
C score of 0.81 and a TM score of 0.61 0.14. The
overall structure of ppGBP was found to comprise
two globular domains (a/b) of similar tertiary structures/topology. Each domain contains a central b-sheet
of five b-strands flanked by a-helices. The two
domains are connected by a three-stranded hinge
100
% inhibition
80
60
40
20
0
Glucose
Fructose
Xylose
Arabinose
Mannitol
Ribose
Gluconate
Mannose
Galactose
Glycerol
Succinate
Pyruvate
Salicylate
Benzyl alcohol
Naphthalene
–20
Fig. 3. Substrate specificity of ppGBP (Escherichia coli). Inhibition
of [14C]-glucose binding (%) to ppGBP (E. coli) in the presence of
100-fold molar excess of various unlabeled compounds was
measured by a membrane filtration assay. The binding activity of
GBP to [14C]-glucose in the absence of unlabeled compounds was
considered as 100%.
368
A. Modak et al.
region. The glucose-binding site was buried in the cleft
between the two domains.
Among the available PBP structures from other
organisms, the ppGBP model showed highest structural similarity to the glucose/galactose-binding protein
of Thermus thermophilus (ttGBP), which belongs to
(Table 1).
class II, with a calculated rmsd of 0.64 A
Both these proteins shared 27% identity at the amino
acid sequence level. Intriguingly, the ppGBP model
showed little or no similarity to class I proteins
such as the glucose/galactose-binding protein from
E. coli (ecGBP), Salmonella typhimurium (stGBP) and
Thermotoga maritima (tmGBP) (Fig. 4B). Interestingly, ppGBP was found to be more similar to the
maltose-binding protein from Thermococcus litoralis
(tlMBP) and E. coli (ecMBP, Fig. 4C).
Superimposition of the ppGBP model onto the crystal
structure of ttGBP suggested involvement of W35, W36,
E41, K92, K339 and H379 from ppGBP in the putative
glucose-binding pocket (Fig. 4D). This pocket was
found to be highly similar to that of ttGBP in terms of
the amino acid residues (W8, W9, E13, A42, H66,
D278, K312 and H348) that interact with the glucose
molecule. In ppGBP, E41 and K339 interact with the
hydroxyl groups present on the C4 and C6 carbon,
respectively; W36 interacts with the C3 hydroxyl group
and K92 and H379 interact with the hydroxyl groups
present on the C1 and C2 carbon of glucose, respectively, via hydrogen bond interactions. The sugar molecule is further stabilized by stacking interaction by W35
and W36 (Fig. 4D). These residues form an annulus-like
structure similar to that reported for ttGBP, wherein the
hydroxyl groups of glucose molecule were placed equatorially, forming hydrogen bonds with these polar
amino acids [23].
Further, in silico docking of D-glucose to the ppGBP
model was performed using AutoDock. The best fit of
the interaction between the ligand and the receptor is
conventionally chosen on the basis of the top-ranked
cluster according to binding affinity or the cluster with
the maximum number of poses. Docking studies of
D-glucose onto ppGBP resulted in 250 binding poses.
Analysis revealed that the top-ranked cluster with the
highest binding affinity also has the maximum number
of bound poses. These poses are clustered at the interface of the two globular domains (a/b), involving
W35, W36, E41, K92, K339 and H379 (data not
shown). This observation is in accordance with the
results obtained from superimposition analysis.
At the glucose-binding pocket of ttGBP, two loops
(loop 1, amino acids 40–44; loop 2, amino acids 344–
351) and an a-helix (amino acids 166–181) were found
to occlude the wide groove that accommodates a
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
A. Modak et al.
Structure–function relationship in ppGBP
A
Fig. 4. Homology model of ppGBP and its
structural comparison. (A) Cartoon
representation of the homology model of
ppGBP. The helices and b-strands are
shown in cyan and pink, respectively.
Glucose at the binding pocket is
represented by a ball-and-stick model
(yellow). The b-strands of the N-terminal
domain are numbered to represent the
structural fold similar to that observed in
class II PBPs. (B) Superimposition of the
Ca backbone of ppGBP (cyan) onto class I
PBPs such as ecGBP (green) and tmGBP
(red) to show overall structural divergence.
(C) Superimposition of the Ca backbone of
ppGBP (cyan) onto class II PBPs such as
ttGBP (green), ecMBP (magenta) and
tlMBP (yellow) to show the overall
structural similarity. (D) Superimposition of
the glucose-binding pocket of ttGBP
(green) on that of ppGBP (yellow). Amino
acid residues important for glucose
binding are labeled in the corresponding
color, and the bond distance (
A) is
indicated by broken lines (magenta). The
oxygen atoms in the glucose molecule are
labeled as O1–O6 (red). (E) Comparison
between the substrate-binding pockets of
ppGBP and ecMBP to show the structural
differences between mono- and
disaccharide binding sites. Loop 2 (red,
amino acids 375–382) and the a-helix
(cyan, amino acids 190–206) of ppGBP
that obstruct maltose binding (green) but
favor glucose binding (magenta) are
shown. The loop (blue arrow, amino acids
11–16) of ecMBP that is very close to the
glucose (magenta) binding site was found
to be wide enough for binding in ppGBP
(red arrow, amino acids 35–41).
B
C
D
E
W36/W9
K92/H66
O2
2.6
2.7
O4
O1
2.4
K339/K312
O3
2.9
O5
O6
2.6
4.2
E41/E13
H379/H348
disaccharide in tlMBP (see Fig. 7C of [23]). Compared
to ttGBP, in the ppGBP model, loop 2 (amino acids
375–382) and the a-helix (amino acids 200–206) were
found to be intact and located at a similar position,
while loop 1 was distorted. Superimposition of ppGBP
model onto the structure of ecMBP suggested that the
loop of ecMBP (amino acids 11–16) that hampers glucose binding was wide enough in ppGBP (amino acids
35–41) to accommodate a glucose molecule (Fig. 4E).
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
3.4
W35/W8
2.9
Site-directed mutagenesis of ppGBP
Based on molecular docking and structural comparison studies, six single (W35A, W36A, E41A, K92A,
K339A and H379A) and one double (E41A/K92A)
alanine-substituted mutants of ppGBP were generated,
sequence-confirmed, over-expressed and purified.
These mutants were analyzed for their [14C]-glucose
binding activity. All single mutants except H379A
369
Structure–function relationship in ppGBP
A. Modak et al.
Table 1. Structural comparison of ppGBP (421 amino acids) with other reported PBP structures.
PDB ID
Protein
Class
Number of
amino acids
RMSD
(Ca backbone, A)
Sequence
identity (%)
2B3B
1EU8A
3MBP
3GBP
2HPH
2H3H
Glu/Gal-binding protein of T. thermophilus
Trehalose MBP of T. litoralis
MBP of E. coli K-12
Glu/Gal receptor of S. typhimurium
Glu/Gal-binding protein of E. coli
Glucose-binding protein of T. maritima
II
II
II
I
I
I
392
407
370
307
316
313
0.64
2.27
2.38
3.77
3.95
4.43
27.4
17.3
17.9
6.0
6.4
6.1
Table 2. [14C]-glucose binding activity of purified ppGBP
(Escherichia coli) and its mutants. Binding activity was measured
using 0.25 lM [14C]-glucose.
Mutant
Specific activity
(pmol bound per
mg protein)
Relative
activity (%)
Wild-type
W35A
W36A
E41A
K92A
K339A
H379A
E41A/K92A
378.8
0
7.22
23
12.62
0
83.43
23.44
100
0
2.1
6.8
3.78
0
24.6
6.9
θ [kdeg cm2dmol–1]
2
GBP
W35A
W36A
E41A
K92A
K339A
H379A
1
0
–1
–2
–3
200
210
220
230
240
Wavelength (nm)
Fig. 5. CD spectroscopic analysis of ppGBP (Escherichia coli) and
its mutants. The far-UV CD spectra of ppGBP (E. coli, solid line)
and its mutants (W35A, W36A, E41A, K92A, K339A and H379A)
are shown.
showed ~ 95% loss of glucose binding ability
(Table 2). The double mutant (E41A/K92A) did not
show any further loss of binding activity compared to
either E41A or K92A. Further, the far-UV CD spectra
of purified ppGBP (E. coli) and its mutants were
370
found to be similar except for H379A (Fig. 5), suggesting no major differences in the secondary structural elements. Thus the decrease in activity may be
attributed to involvement of these residues in binding
of the ligand.
Discussion
PBPs play a crucial role in the high-affinity ABC
transport systems. In addition to transferring solute
molecules to its cognate transporter, PBPs also stimulate the ATPase activity of the nucleotide-binding
subunits of ABC transporters through trans-membrane
signaling [30]. This activation is mediated via conformational changes in the trans-membrane subunits that
lead to an alternate access mechanism for the ABC
transporter [31]. The major hindrance for study of the
GBP from P. putida CSV86 was its partial purification
and low yield. Therefore, periplasmic GBP from
CSV86 was cloned into E. coli, over-expressed, purified and characterized. Further, the 3D structure was
modeled and validated by site-directed mutagenesis
and functional analysis.
The reported apparent affinities of PBP-dependent
ABC transport systems (in vivo) towards their ligands
are generally close (within an order of magnitude) to
those of the cognate periplasmic binding proteins. This
suggests that the binding protein is primarily responsible for the affinity of the transport system towards its
substrate(s), and correlates with the fact that the binding specificity of PBP confers substrate specificity to
the transport system [32]. The affinity constant of the
whole cell of CSV86 was found to be in the micromolar range (0.81 lM), and is in accordance with previous
reports for other PBP-dependent ABC transport systems in Gram-negative bacteria [32]. ppGBP was
found to be one of the largest proteins among various
reported sugar-binding proteins, and, like other members of PBP superfamily, is a functional monomeric
protein. The presence of a His or Pro tag at the N-,
C- or both termini did not affect the glucose binding
activity of the protein. ppGBP (E. coli) shows high
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
A. Modak et al.
specificity towards glucose in the presence of 100-fold
molar excesses of other sugars, organic acids and aromatic compounds. Together, these observations suggest that the topology of the ppGBP is unaffected by
expression in E. coli.
Periplasmic binding proteins are ideal candidates for
investigation of the evolutionary plasticity of proteins,
as they share common features of spatial organization
and patterns of ligand binding despite large sequence
length variations and low sequence identity. Although
the sequence identity among PBPs is not sufficient
enough to draw any conclusion about their origin and
history, the gene arrangement of PBP-dependent ABC
uptake systems provides strong evidence for their common origin. In Pseudomonas, genes encoding various
components of PBP-dependent ABC transporters are
organized together in an operonic arrangement in the
order: PBP–permease(s)–ATP-binding protein, which
suggests that they evolved by duplication of an ancestral operon [18]. The organization of genes involved in
glucose uptake in P. aeruginosa was reported to be
similar to that in T. thermophilus, except that the
ATP-binding subunit is absent in the latter [23]. The
constructed model of ppGBP showed highest structural similarity to the crystal structure of ttGBP, as
well as to ecMBP and tlMBP. Intriguingly, the ppGBP
model showed very little structural similarity to ecGBP
and stGBP. This observation suggests that ppGBP and
ttGBP may have originated from a common ancestor
with minimum evolutionary divergence.
Superimposition of the ppGBP model onto the crystal structure of ttGBP revealed that the overall structural fold and the glucose-binding pocket in these two
proteins are well conserved. The glucose-binding
pocket in ppGBP comprises W35, W36, E41, K92,
K339 and H379. Involvement of these residues in
forming the glucose-binding pocket was also supported
by a molecular docking study. Compared to the wildtype GBP, alanine substitution mutants showed a significant loss (~ 95%) in [14C]-glucose binding activity.
The double mutant (E41A/K92A) did not show any
additional loss of glucose binding activity. E41 and
K92 are the key residues that anchor the glucose molecule at the pocket by series of hydrogen bond interactions, while W35, W36, K339 and H379 stabilize the
anchored glucose molecule by stacking and hydrogen
bond interactions. Mutational studies indicate that alanine substitution of these residues resulted in a
decrease in the affinity of GBP, but not complete loss
of binding ability to glucose.
The structure of ttGBP showed striking similarity
with class II PBPs such as tlMBP [23], which typically
bind to larger ligands such as di- and tri-saccharides
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
Structure–function relationship in ppGBP
or peptides (except class II PBPs that bind ions) [18].
The class I PBPs ecGBP and stGBP have a comparatively small binding pocket that limits the interaction
with monosaccharides [33] and amino acids [34]. Structural comparison of ttGBP with tlMBP revealed the
adaptations that inter-convert mono- and disaccharide
binding sites [23]. Comparison of the structure of ecMBP with the putative model of ppGBP suggests the
probable structural adaptations that accommodate glucose in ppGBP obstruct maltose binding in the class II
fold [23]. Similar strategies appear to have been
adopted for inter-conversion between class II ion- and
sugar-binding proteins [35]. In addition, a loop in ecMBP was identified as very close to the superimposed
glucose molecule in its substrate-binding pocket. However, the corresponding loop in ppGBP, as predicted
in the model, is wide enough to accommodate the glucose molecule at the binding pocket.
In summary, the structure of ppGBP was predicted
by homology modeling, and putative key residues in
the glucose-binding pocket were confirmed by sitedirected mutagenesis followed by functional analysis.
X-ray crystal structure elucidation of ppGBP will provide detailed information on structural features to help
establish its evolutionary relationship.
Experimental procedures
Micro-organisms and culture conditions
The bacterial cultures used in this study were P. putida
CSV86 [5] and E. coli strains DH5a and BL21(DE3)
(Novagen, Madison, WI, USA). Strain CSV86 was grown
on 150 mL minimal salt medium [6] in 500 mL capacity
baffled Erlenmeyer flasks at 30 °C on a rotary shaker
(200 rpm) supplemented aseptically with glucose (0.25%).
E. coli strain DH5a and BL21 (DE3) were grown in Luria–
Bertani (LB) medium (10 g peptone, 5 g yeast extract and
10 g NaCl per liter of distilled water) at 37 °C [36]. Agar
(1.5%) was used to prepare solid medium.
Whole-cell [14C]-glucose uptake assay
Uptake of [14C]-glucose (universally labeled, specific activity
140 mCimmol; BRIT, Mumbai, India) by CSV86 cells was
studied using a modified membrane filtration assay [27].
Briefly, late-log phase cells, grown on glucose (0.25%),
were harvested by centrifugation (7800 g for 10 min at
4 °C), washed twice with 25 mL of ice-cold sterile minimal
salt medium for 10 min, and re-suspended in minimal salt
medium (attenuance at 540 nm of 0.2). Pre-warmed cell
suspension (1.0 mL, 30 °C for 10 min) was incubated with
varying concentrations of [14C]-glucose at 30 °C for 30 s in
a water bath, and rapidly filtered through a pre-moistened
371
Structure–function relationship in ppGBP
mixed cellulose esters filter (0.45 lm; Millipore Co., Bedford, MA, USA). The filters were washed twice with sterile
minimal salt medium (1 mL), air-dried and mixed vigorously in scintillation cocktail (0.4% PPO [2,5-diphenyloxazole] and 0.025% POPOP [1,4-bis(5-phenyloxazolyl)
benzene] in toluene) (SRL, Mumbai, India). The radioactivity was measured using a liquid scintillation counter Rackbeta LKB1209 (Pharmacia, Turku, Finland). The
radioactivity of the scintillation cocktail alone as well as of
the reaction mixture without cells was measured and subtracted. To obtain the dry weight, the cell suspension
(1 mL, attenuance at 540 nm of 0.2) was centrifuged
(20 000 g for 20 min), dried at 37 °C for 5 h, and its
weight recorded. The binding is expressed as nmol glucose
min 1mg 1 dry cell weight. Affinity constants were determined by fitting the experimental data to theoretical
Michaelis–Menten model using the SIGMAPLOT 11.0 software
package (Systat Software Inc., Chicago, IL, USA).
Cloning of the gene encoding periplasmic GBP
The gene encoding GBP of CSV86 was amplified by PCR
using primers GBPF (5′-CCGGAATTCCATATGAATG
CGATCACCCGTCTCG-3′; NdeI and EcoRI sites underlined) and GBPR (5′-CCGGAATTCCTACCTGGCCG
CCTTGATCGC-3′; EcoRI site underlined) and CSV86
genomic DNA as the template. The PCR-amplified fragment
(~ 1.2 kb) was first cloned at the EcoRI site of pBSKS(+)
vector (Novagen), yielding pBSKS-GBP, followed by subcloning at the NdeI/EcoRI site of the pET28a expression vector (Novagen), yielding pET28-GBP. The gene without a
stop codon was also cloned at NdeI/EcoRI sites (pET28GBP*) to obtain GBP variants with as His tag at the Nterminus and a Pro tag at the C- terminus. Clones were confirmed by DNA sequencing at Xcelris Labs, Ahmedabad,
India as well as by SciGenom, Cochin, India.
Over-expression and purification of ppGBP
A single colony of pET28-GBP-transformed E. coli BL21
(DE3) was grown overnight in LB medium (10 mL) supplemented with kanamycin (30 lgmL 1) at 37 °C. The culture
(1% v/v) was re-inoculated into LB medium (800 mL) containing kanamycin (30 lgmL 1), grown at 37 °C to an
attenuance at 600 nm of 1.0, and induced by addition of
IPTG (100 lM) for 4 h. Cells were harvested (8000 g for
10 min), and re-suspended in binding buffer (10 mM Tris/
HCl pH 7.5, 1 mM MgCl2). Cell-free lysate was prepared
by sonication (three cycles per gram of cells, 1 s pulse, 1 s
interval, cycle duration 30 s, output 15 W), followed by
centrifugation (20 000 g for 20 min). Expression of the
protein was assessed by SDS/PAGE (12%) as described
previously [37].
N-terminally His-tagged ppGBP was purified using
immobilized metal affinity chromatography. Cell-free lysate
372
A. Modak et al.
(10 mgmL 1 of matrix) was loaded onto a pre-equilibrated
Ni-NTA column (10 mL), followed by washing with five
column volumes of binding buffer. The protein was eluted
with a linear gradient of imidazole (0–200 mM, flow rate
30 mLh 1, fraction size 1 mL) in binding buffer. GBP was
eluted in the range 100–120 mM imidazole. The specific
activity is expressed as pmol [14C]-glucose bound per mg
protein. Fractions with higher specific activity were pooled
and dialyzed against binding buffer for 4 h at 4 °C.
The N-terminal His tag was removed by treating the
purified protein with thrombin agarose matrix according to
the manufacturer’s instructions (thrombin CleanCleaveTM
kit; Sigma Aldrich, St Louis, MO, USA) followed by purification of the GBP using Ni-NTA column chromatography.
The native molecular mass of the purified ppGBP was
determined by gel-filtration chromatography on a Sephacryl
S-200 HR column (Sigma Aldrich, St Louis, MO, USA)
calibrated with standard protein molecular mass markers.
The molecular mass of GBP was determined from a plot of
log Mr (molecular mass) versus Velution/Vvoid (Ve/V0).
Extraction and purification of ppGBP (CSV86)
Periplasmic proteins from CSV86 were isolated using the
cold shock method as described previously [12,38]. ppGBP
(CSV86) was partially purified from total periplasmic
protein fraction by gel-filtration chromatography using a
Sephacryl S-200 HR column (Sigma Aldrich) as described
previously [12]. Protein was estimated by the Bradford
method [39], using bovine serum albumin as the standard.
[14C]-glucose binding assay and substrate
specificity of ppGBP
[14C]-glucose binding activity was measured as described
previously [12]. In brief, ppGBP (2.5 lg, from CSV86 or
E. coli) was incubated with [14C]-glucose (0.5 lM) for 5 min
at 30 °C. After incubation, the mixture was rapidly filtered
through pre-moistened poly(vinylidene difluoride) membranes (0.45 lm; Pall Life Sciences Corp., New York, NY,
USA). The radioactivity of the [14C]-glucose bound to GBP
retained on the filter paper was measured using a liquid
scintillation counter (Rackbeta LKB1209). A binding reaction mixture without ppGBP was used as the control, subtracted from the experimental values and expressed as pmol
[14C]-glucose bound per mg protein.
The substrate specificity of ppGBP (E. coli) was assayed
as described previously [12]. Briefly, a 100-fold excess
(50 lM) of unlabeled sugars, organic acids or aromatic
compounds was added individually to assay mixture
(1 mL) containing purified ppGBP (E. coli, 2.5 lg) and
[14C]-glucose (500 nM). Stock solutions of substrates were
prepared by dissolving them in binding buffer, except aromatic compounds (dissolved in dimethyl sulfoxide). Control
reaction mixtures contained [14C]-glucose, GBP in binding
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
A. Modak et al.
Structure–function relationship in ppGBP
buffer, and the appropriate amount of dimethyl sulfoxide.
The reaction mixture was incubated for 5 min at 30 °C and
rapidly filtered through pre-moistened poly(vinylidene difluoride) membranes. Radioactivity was measured and
expressed as percentage inhibition of [14C]-glucose binding.
Molecular modeling of ppGBP
The structure predictions for ppGBP were performed using
the I-TASSER server, an online platform for automated
protein structure prediction [40] without additional constraints or templates. The structural similarity between the
ligand-binding sites of the generated model and the topranked template protein was assessed using the secondary
structure matching algorithm [41] in Coot [42]. The
D-glucose molecule was modeled in the glucose-binding
pocket of ppGBP by superimposition of the glucose molecule from the glucose/galactose-binding protein of T. thermophilus (ttGBP, PDB ID 2B3B). All figures describing the
structural features were drawn using the PyMOL (The
PyMOL Molecular Graphics System, Version 1.5.0.4
Schr€odinger, LLC)).
Site-directed mutagenesis
PCR-based site-directed mutagenesis was performed to generate W35A, W36A, E41A, K92A, K339A, H379A and
E41A/K92A mutants using pET28-GBP as the template
and the primers listed in Table 3. Mutants were confirmed
by DNA sequencing (Xcelris Labs and SciGenom, India).
The mutant proteins were over-expressed in E. coli BL21
(DE3), purified using Ni-NTA matrix and assayed for
[14C]-glucose binding activity as described above.
Circular dichroism spectroscopy
Far-UV CD spectra of ppGBP (E. coli) and its mutants in
the binding buffer were determined using a JASCO J-810
Peltier spectropolarimeter (Jasco, Gross-Umstadt, Germany)
between 198 and 260 nm at 25 °C in a 0.1 cm path length
quartz cuvette (volume 200 lL; Hellma GmBH & Co., KG,
M€ullheim, Germany) with the following parameters:
response, 2 s; sensitivity, 100 millidegrees; speed, 100 nmmin 1;
average of three scans. Raw data were processed by
smoothing and subtraction of spectra obtained using binding buffer alone. Ellipticity values (millidegrees) were
recorded as a function of wavelength.
Molecular docking studies
The model obtained for ppGBP was further analyzed for
its ability to bind glucose by performing molecular docking
using AutoDock version 4.0 [43]. The 3D co-ordinates of
the D-glucose were obtained from the structure of glucosebound ttGBP (PDB ID 2B3B). Clusters were generated
using the Lamarckian genetic algowith an rmsd of 2 A
rithm. Genetic algorithm (GA) runs (250) were performed
for each docking, with 1 500 000 energy evaluations per
run. Docked poses were drawn using PyMOL (The
PyMOL Molecular Graphics System, Version 1.5.0.4
Schr€odinger, LLC).
Table 3. Primers used to generate site-directed mutants of ppGBP
from Pseudomonas putida CSV86. ‘f’ and ‘r’ indicate forward and
reverse primers, respectively. Underlined letters indicate the bases
substituted.
Substitution
Primer name
Sequence (5′?3′)
W35A
W35A f
W35A r
W36A f
W36A r
E41A f
E41A r
K92A f
K92A r
K339A f
K339A r
H379A f
H379A r
CGTTCTCCACGCGTGGACCTCC
GGAGGTCCACGCGTGGAGAACG
GACGTTCTCCACTGGGCGACCTCC
GGAGGTCGCCCAGTGGAGAACGTC
GACCTCCGGCGGCGCAGCCAAGG
CCTTGGCTGCGCCGCCGGAGGTC
GCAGATCGCGGGCCCGGATATCC
GGATATCCGGGCCCGCGATCTGC
GTTCAACCAGAACGCGGGCTCGC
GCGAGCCCGCGTTCTGGTTGAAC
CCGAGCATGGCGGCCAACATGG
CCATGTTCGCCGCCATGCTCGG
W36A
E41A
K92A
K339A
H379A
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
Acknowledgements
We thank Rimi Chakrabarti (Department of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, India) for her help with the
molecular docking study. P.B. thanks the Department
of Biotechnology, Government of India, for a Ramalingaswami fellowship. P.S.P. thanks the Department
of Science and Technology, Government of India, for
providing a research grant. A.M. acknowledges a
senior research fellowship from Council of Scientific
and Industrial Research, Government of India.
References
1 Monod J (1942) Recherches sur la Croissance des Cultures
Bact
eriennes. PhD Thesis, Hermann et Cie, Paris.
2 Stulke J & Hillen W (1999) Carbon catabolite
repression in bacteria. Curr Opin Microbiol 2, 195–201.
3 Wolff JA, MacGregor CH, Eisenberg RC & Phibbs PV
Jr (1991) Isolation and characterization of catabolite
repression control mutants of Pseudomonas aeruginosa
PAO. J Bacteriol 173, 4700–4706.
4 Rojo F (2010) Carbon catabolite repression in
Pseudomonas: optimizing metabolic versatility and
interactions with the environment. FEMS Microbiol Rev
34, 658–684.
5 Mahajan MC, Phale PS & Vaidyanathan CS (1994)
Evidence for the involvement of multiple pathways in
373
Structure–function relationship in ppGBP
6
7
8
9
10
11
12
13
14
15
16
the biodegradation of 1- and 2-methylnaphthalene by
Pseudomonas putida CSV86. Arch Microbiol 161,
425–433.
Basu A, Dixit SS & Phale PS (2003) Metabolism
of benzyl alcohol via catechol ortho-pathway
in methylnaphthalene-degrading Pseudomonas
putida CSV86. Appl Microbiol Biotechnol 62,
579–585.
Shrivastava R, Basu A & Phale PS (2011) Purification
and characterization of benzyl alcohol- and
benzaldehyde-dehydrogenase from Pseudomonas putida
CSV86. Arch Microbiol 193, 553–563.
Shrivastava R, Purohit H & Phale PS (2011)
Metabolism and preferential utilization of phenylacetic
acid and 4-hydroxyphenylacetic acid in
Pseudomonas putida CSV86. J Bioremed Biodeg 2, 120.
Phale PS, Paliwal V, Raju SC, Modak A & Purohit HJ
(2013) Genome sequence of naphthalene degrading soil
bacterium Pseudomonas putida CSV86. Genome
Announc 1, e00234-12.
Basu A, Apte SK & Phale PS (2006) Preferential
utilization of aromatic compounds over glucose by
Pseudomonas putida CSV86. Appl Environ Microbiol 72,
2226–2230.
Shrivastava R, Basu B, Godbole A, Mathew MK, Apte
SK & Phale PS (2011) Repression of the glucoseinducible outer-membrane protein OprB during
utilization of aromatic compounds and organic acids
in Pseudomonas putida CSV86. Microbiology 157,
1531–1540.
Basu A, Shrivastava R, Basu B, Apte SK & Phale PS
(2007) Modulation of glucose transport causes
preferential utilization of aromatic compounds in
Pseudomonas putida CSV86. J Bacteriol 189, 7556–7562.
Basu A & Phale PS (2006) Inducible uptake and
metabolism of glucose by the phosphorylative pathway
in Pseudomonas putida CSV86. FEMS Microbiol Lett
259, 311–316.
Neiditch MB, Federle MJ, Pompeani AJ, Kelly RC,
Swem DL, Jeffrey PD, Bassler BL & Hughson FM
(2006) Ligand-induced asymmetry in histidine sensor
kinase complex regulates quorum sensing. Cell 126,
1095–1108.
Gonin S, Arnoux P, Pierru B, Lavergne J, Alonso B,
Sabaty M & Pignol D (2007) Crystal structures of an
extracytoplasmic solute receptor from a TRAP
transporter in its open and closed forms reveal a helixswapped dimer requiring a cation for a-keto acid
binding. BMC Struct Biol 7, 11.
Mulligan C, Geertsma ER, Severi E, Kelly DJ,
Poolman B & Thomas GH (2009) The substratebinding protein imposes directionality on an
electrochemical sodium gradient-driven TRAP
transporter. Proc Natl Acad Sci USA 106,
1778–1783.
374
A. Modak et al.
17 Armstrong N & Gouaux E (2000) Mechanisms for
activation and antagonism of an AMPA-sensitive
glutamate receptor: crystal structures of the GluR2
ligand binding core. Neuron 28, 165–181.
18 Fukami-Kobayashi K, Tateno Y & Nishikawa K (1999)
Domain dislocation: a change of core structure in
periplasmic binding proteins in their evolutionary
history. J Mol Biol 286, 279–290.
19 Quiocho FA & Ledvina PS (1996) Atomic structure
and specificity of bacterial periplasmic receptors for
active transport and chemotaxis: variation of common
themes. Mol Microbiol 20, 17–25.
20 Berntsson RP, Smits SH, Schmitt L, Slotboom DJ &
Poolman B (2010) A structural classification of
substrate-binding proteins. FEBS Lett 584, 2606–2617.
X-ray
21 Flocco MM & Mowbray SL (1994) The 1.9 A
structure of a closed unliganded form of the
periplasmic glucose/galactose receptor from
Salmonella typhimurium. J Biol Chem 269, 8931–8936.
22 Quiocho FA (1991) Atomic structures and function of
periplasmic receptors for active transport and
chemotaxis. Curr Opin Struct Biol 1, 922–933.
23 Cuneo MJ, Changela A, Warren JJ, Beese LS &
Hellinga HW (2006) The crystal structure of a
thermophilic glucose binding protein reveals
adaptations that interconvert mono and di-saccharide
binding sites. J Mol Biol 362, 259–270.
24 Mattle D, Zeltina A, Woo JS, Goetz BA & Locher KP
(2010) Two stacked heme molecules in the binding
pocket of the periplasmic heme-binding protein HmuT
from Yersinia pestis. J Mol Biol 404, 220–231.
25 Mao B, Pear MR, McCammon JA & Quiocho FA (1982)
Hinge-bending in L-arabinose-binding protein. The
‘Venus’s-flytrap’ model. J Biol Chem 257, 1131–1133.
26 Stinson MW, Cohen MA & Merrick JM (1977)
Purification and properties of the periplasmic glucosebinding protein of Pseudomonas aeruginosa. J Bacteriol
131, 672–681.
27 Adewoye LO, Tschetter L, O’Neil J & Worobec EA
(1998) Channel specificity and secondary structure of
the glucose-inducible porins of Pseudomonas spp.
J Bioenerg Biomembr 30, 257–267.
28 Whiting PH, Midgley M & Dawes EA (1976) The
regulation of transport of glucose, gluconate and 2oxogluconate and of glucose catabolism in
Pseudomonas aeruginosa. Biochem J 154, 659–668.
29 Schleissner C, Reglero A & Luengo JM (1997)
Catabolism of D-glucose by Pseudomonas putida U
occurs via extracellular transformation into D-gluconic
acid and induction of a specific gluconate transport
system. Microbiology 143, 1595–1603.
30 Davidson AL, Shuman HA & Nikaido H (1992)
Mechanism of maltose transport in Escherichia coli:
transmembrane signaling by periplasmic binding
proteins. Proc Natl Acad Sci USA 89, 2360–2364.
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
A. Modak et al.
31 Khare D, Oldham ML, Orelle C, Davidson AL & Chen
J (2009) Alternating access in maltose transporter
mediated by rigid-body rotations. Mol Cell 33, 528–536.
32 Tam R & Saier MH Jr (1993) Structural, functional,
and evolutionary relationships among extracellular
solute-binding receptors of bacteria. Microbiol Rev 57,
320–346.
33 Vyas MN, Vyas NK & Quiocho FA (1994)
Crystallographic analysis of the epimeric and anomeric
specificity of the periplasmic transport/chemosensory
protein receptor for D-glucose and D-galactose.
Biochemistry 33, 4762–4768.
34 Sack JS, Saper MA & Quiocho FA (1989) Periplasmic
binding protein structure and function. Refined X-ray
structures of the leucine/isoleucine/valine-binding
protein and its complex with leucine. J Mol Biol 206,
171–191.
35 Heddle J, Scott DJ, Unzai S, Park SY & Tame JR
(2003) Crystal structures of the liganded and
unliganded nickel-binding protein NikA from
Escherichia coli. J Biol Chem 278, 50322–50329.
36 Sambrook J & Russell DW (1989) Molecular Cloning:
A Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
FEBS Journal 281 (2014) 365–375 ª 2013 FEBS
Structure–function relationship in ppGBP
37 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
38 Hoshino T & Kageyama M (1980) Purification and
properties of a binding protein for branched-chain
amino acids in Pseudomonas aeruginosa. J Bacteriol
141, 1055–1063.
39 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein–dye binding. Anal
Biochem 72, 248–254.
40 Roy A, Kucukural A & Zhang Y (2010) I-TASSER: a
unified platform for automated protein structure and
function prediction. Nat Protoc 5, 725–738.
41 Krissinel E & Henrick K (2004) Secondary-structure
matching (SSM), a new tool for fast protein structure
alignment in three dimensions. Acta Crystallogr D Biol
Crystallogr 60, 2256–2268.
42 Emsley P & Cowtan K (2004) Coot: model-building
tools for molecular graphics. Acta Crystallogr D Biol
Crystallogr 60, 2126–2132.
43 Morris GM, Huey R & Olson AJ (2008) Using
AutoDock for ligand–receptor docking. Curr Protoc
Bioinformatics 24, 8.14.1–8.14.40.
375