From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
HEMATOPOIESIS
The influence of INK4 proteins on growth and self-renewal kinetics
of hematopoietic progenitor cells
John L. Lewis, Wimol Chinswangwatanakul, Bo Zheng, Stephen B. Marley, Dao X. Nguyen, Nicholas C. P. Cross, Lolita Banerji,
Janet Glassford, N. Shaun B. Thomas, John M. Goldman, Eric W.-F. Lam, and Myrtle Y. Gordon
This study investigated the influence of
expression of proteins of the INK4 family,
particularly p16, on the growth and selfrenewal kinetics of hematopoietic cells.
First, retrovirus-mediated gene transfer
(RMGT) was used to restore p16INK4a expression in the p16INK4a-deficient lymphoid and myeloid cell lines BV173 and
K562, and it was confirmed that this inhibited their growth. Second, to sequester
p16INK4a and related INK4 proteins, cyclindependent kinase 4 (CDK4) was retrovirally transduced into normal human
CD34ⴙ bone marrow cells and then cultured in myeloid colony-forming cell (CFC)
assays. The growth of CDK4-transduced
colonies was more rapid; the cell-doubling time was reduced; and, upon replating, the colonies produced greater yields
of secondary colonies than mock-untransduced controls. Third, colony formation
was compared by marrow cells from
p16INK4aⴚ/ⴚ mice and wild-type mice. The
results from p16INK4aⴚ/ⴚ marrow were similar to those from CDK4-transduced human CFCs, in terms of growth rate and
replating ability, and were partially reversed by RMGT of p16INK4a. Lines of
immature granulocytic cells were raised
from 15 individual colonies grown from
the marrow of p16INK4aⴚ/ⴚ mice. These
had a high colony-forming ability (15%)
and replating efficiency (96.7%). The
p16INK4aⴚ/ⴚ cell lines readily became
growth factor–independent upon cytokine deprivation. Taken together, these
results demonstrate that loss of INK4
proteins, in particular p16INK4a, increases
the growth rate of myeloid colonies in
vitro and, more importantly, confers an
increased ability for clonal expansion on
hematopoietic progenitor cells. (Blood.
2001;97:2604-2610)
© 2001 by The American Society of Hematology
Introduction
Deletion of the tumor-suppressor gene p16INK4a has been implicated in tumorigenesis in general1 and in leukemogenesis in
particular.2-5 It has been found in 25% to 60% of cases of acute
leukemia and 20% to 50% of cases of lymphoma.6 Although
deletion of the p16INK4a gene is uncommon in acute myeloid
leukemia, messenger RNA expression is frequently undetectable,
possibly as a result of DNA hypermethylation or mutations in the
p16INK4a promotor region.7 These observations raise the possibility
that p16INK4a expression plays an important role in the regulation of
normal hematopoiesis. There is ample evidence that restoration of
p16INK4a into p16INK4a-deficient leukemic cell lines reduces their
proliferation rate in liquid culture and some evidence that it suppresses
their ability to form colonies in semisolid culture,8,9 but the effects
of p16INK4a expression on primary normal hematopoietic cell
proliferation have not been examined. In particular, it is not known
whether p16INK4a has any effects on the kinetics of progenitor cell
renewal and differentiation. This is important because transformation of leukemic target cells must be associated with an increase in
self-renewal probability above the steady-state value of 0.5 before
the leukemic clone can expand, become established, and eventually
predominate over normal hematopoiesis.10-12
The p16INK4a protein is the prototypic member of the INK4
family (p15INK4b, p16INK4a, p18INK4c, and p19INK4d) of cyclindependent kinase inhibitors (CKIs) and is part of a regulatory
pathway consisting of p16INK4a, cyclin D, cyclin-dependent kinase
(CDK) 4/6, retinoblastoma protein (pRB), and E2F.13 This pathway
(the pRB pathway) regulates the transition from G1 to S phase of
the cell cycle. The formation of complexes between cyclin D and
CDK4 is inhibited by p16INK4a through binding to CDK4/6. The
cyclin D–CDK4/6 complex phosphorylates pRB, resulting in the
release of transcription factors so that the genes necessary for cell
cycle progression can be transcribed.14
The pRB family of pocket proteins consists of pRB itself and
the structurally related proteins p107 and p130. They are negative
regulators of cell cycle progression, and overexpression of individual pocket proteins can cause growth arrest in G1 phase of the
cell cycle. The cyclin D/CDK4 or 6 kinase complexes have been
shown to be able to phosphorylate all 3 pocket proteins and
overcome the cell cycle arrest imposed by the enforced expression
of individual pocket proteins. The ability of the pRB family of
proteins to induce cell cycle arrest is largely related to their
interactions with the transcription factor E2F.14-17 Phosphorylation
plays an important part in controlling the interaction of pRBrelated pocket proteins with E2F as well as their ability to repress
From the LRF Centre for Adult Leukaemia, Department of Haematology,
Imperial College School of Medicine, Hammersmith Campus; the Ludwig
Institute for Cancer Research and Section of Virology and Cell Biology, Imperial
College School of Medicine, St Mary’s Campus; and the Department of
Haematological Medicine, Guy’s, King’s and St Thomas’ School of Medicine
and Dentistry, King’s Denmark Hill Campus, London, United Kingdom.
supported by the China Scholarship Council; and N.S.B.T. is supported by the
Charles Wolfson Charitable Trust.
Submitted July 10, 2000; accepted January 5, 2001.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
J.L.L. S.B.M., N.C.P.C., E.W.-F.L., J.G., and M.Y.G. are supported by the
Leukaemia Research Fund of Great Britain; W.C. was the recipient of a PhD
Studentship from the Siriraj Hospital, Government of Thailand; B.Z. was
2604
Reprints: M. Y. Gordon, LRF Centre for Adult Leukaemia, Imperial College
School of Medicine, Hammersmith Campus, DuCane Rd, London W12 0NN,
UK; e-mail: [email protected].
© 2001 by The American Society of Hematology
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
transcription directly. Hypophosphorylated forms of pocket proteins bind to E2F and repress E2F-dependent trancriptional activity,
thus repressing the transcription of genes essential for DNA
synthesis and/or cell cycle progression, including E2F-1, p107,
pRB, cyclin A, and cyclin E.14-17 Therefore, overexpression of
p16INK4a can down-regulate CDK4/6 activity, culminating in hypophosphorylation of pRB-related proteins, repression of E2F activity, and cell cycle arrest.
We have investigated the effect of p16INK4a on cell proliferation
and renewal by transducing p16INK4a into the p16INK4a-deficient
lymphoid and myeloid leukemia cell lines BV173 and K562. We
have also studied the role of p16INK4a in normal hematopoiesis
using CDK4-transduced normal human bone marrow CD34⫹ cells
and bone marrow from p16INK4a knockout mice. The results are
consistent with the action of INK4 proteins as growth suppressors
in normal hematopoiesis since INK4 deletion and abrogation
increase the growth rate of hematopoietic cell colonies and the
multiplication of hematopoietic progenitor cells in vitro, and
facilitate the emergence of cell lines from primary hematopoietic
progenitor cells.
Materials and methods
Cell lines and cell culture
The human lymphoid and myeloid cell lines BV173 and K562 have been
confirmed to have their p16INK4a genes deleted.18-20 These cells were
maintained in RPMI 1640 medium (Gibco BRL, Paisley, United Kingdom)
supplemented with 10% fetal calf serum (FCS) (Mycoplex) (PAA Laboratories, Linz, Austria), 2000 ␮M L-glutamine, 100 U/mL penicillin, and 100
␮g/mL streptomycin. Cells were incubated in flasks at 37°C in humidified
5% CO2 in air and passaged twice a week. The retroviral packaging cell
lines GP⫹E-86 (ecotropic) and GP⫹envAM12 (amphotropic) were maintained in Dulbecco modified Eagle medium (Gibco BRL) supplemented
with 10% FCS, 2000 ␮M L-glutamine, 100 U/mL penicillin, and 100
␮g/mL streptomycin, incubated in flasks at 37°C in humidified 5% CO2 in
air and passaged twice a week. The WEHI-3B cell line was maintained in
RPMI 1640 with 10% FCS.
Primary cell isolation and culture
Normal human bone marrow was obtained from donors of marrow for
transplantation. Informed consent and Hammersmith Hospital Research
Ethics Committee approval were obtained in all cases. Mononuclear cells
were separated from the marrow by density gradient centrifugation by
means of Ficoll Hypaque (Lymphoprep, Nycomed, Oslo, Norway). CD34⫹
cells were then separated from the mononuclear fraction by means of the
Minimacs system (Miltenyi Biotech, Samberley, United Kingdom) according to the manufacturer’s recommendations.
Wild-type mice and mice with homozygously deleted p16INK4a gene
exon 2 were maintained in the Imperial College animal facility.21 At 6
weeks of age, mice were killed by cervical dislocation; the femurs were
dissected out; and the marrow was flushed from the femoral cavity with 5
mL MEM alpha medium (Gibco BRL) into a sterile container.
Retrovirus-mediated gene transfer
Wild-type p16INK4a complementary DNA (cDNA) was cloned into a
retroviral shuttle vector, pBN, and transfected into GP⫹E-86 by calcium
phosphate precipitation. Supernatant from the GP⫹E-86 was used to infect
GP⫹envAM12 with retroviral particles. Wild-type CDK4 cDNA22 was
cloned into pBN and then transfected into GP⫹E-86 by calcium phosphate
precipitation, and the supernatant was used to infect GP⫹envAM12.23
A Transwell system (Costar, High Wycombe, United Kingdom) was
used for retrovirus-mediated transfer into K562 cells and primary cells.23
This system allows target cells to be incubated with producer cells without
cell-to-cell contact and contamination. Amphotropic producer cells were
INFLUENCE OF INK4 ON PROGENITOR KINETICS
2605
plated in 6-well plates (Costar) at 1 day before the target cells were placed
in the Transwell insert. K562 target cells (1 ⫻ 105 cells per Transwell) were
suspended in medium containing a final concentration of 4 ␮g/mL
polybrene, exposed to the producer cells for two 3-day cycles of infection,
and then selected in G418-containing medium for 2 weeks prior to further
study. Human CD34⫹ target cells were placed in the Transwell insert in
medium containing 50 ng/mL interleukin 3 (IL-3), 100 ng/mL stem cell
factor, 10 ng/mL granulocyte-macrophage colony-stimulating factor (GMCSF) (all from First Link, Brierley Hill, United Kingdom), and 4 ␮g/mL
protamine sulfate. The CD34⫹ cells were harvested from the Transwell
inserts after 2-day exposure to the producer cells. The selection of the
CD34⫹ cells is described under “Colony assays and evaluation” below.
Growth rate of BV173 and K562 cells
BV173 and K562 cells were cultured at an initial concentration of 2 ⫻ 104
cells per milliliter. The p16INK4a-transduced and empty vector–transduced
cells, but not the parent cells, were cultured in the presence of G418. Cell
concentrations were measured by hemocytometry at daily intervals.
Western blotting
After 107 cells were pelleted by centrifugation in Eppendorf tubes, the
supernatant was removed, and the cells were lysed in 120 ␮L RIPA buffer
(1% NP40, 0.5% sodium deoxycholate, 0.3M NaCl, and Complete protease
inhibitor cocktail [Boehringer Mannheim, Germany]). The protein concentration of the lysate was determined by means of a MicroProtein Determination kit (Sigma, Poole, United Kingdom). We electrophoresed 80 ␮g protein
in 5%, 10%, and 15% (vol/vol) polyacrylamide gels (29:1 acrylamide to
bisacrylamide) (Bio-Rad Laboratories, Hemel Hempstead, United Kingdom) and then blotted it onto a nitrocellulose membrane (Hybond-N)
(Amersham, Little Chalfont, United Kingdom). The membrane was stained
with antibodies to p16INK4a (Becton Dickinson, United Kingdom), pRB,
E2F-1, p107, p130, p15, and p18 (Santa Cruz Biotechnology, CA), and
the protein signals were visualized by electrochemiluminescence (ECL
kit) (Amersham).
Colony assays and evaluation
Colony assay
Myeloid (granulocyte-macrophage) colony formation by primary cells was
assayed by plating 1 ⫻ 105 mouse bone marrow cells per milliliter, or
1 ⫻ 103 CD34⫹ human cells per milliliter in methylcellulose (Methocult
H423, Metachem Diagnostics, Northampton, United Kingdom). The murine cells were stimulated by 20% (vol/vol) WEHI-3B cell–conditioned
medium, and the human cells were stimulated by recombinant cytokines
(50 ng/mL stem cell factor, 1 ng/mL GM-CSF, 10 ng/mL IL-3, and 100
ng/mL granulocyte CSF, all from First Link). In the case of retrovirally
transduced cells, 1.5 mg/mL G418 was added. This concentration reduces
the survival of cells that do not express neomycin resistance (neor) to
1.55%.23 Triplicate cultures in 35-mm petri dishes were incubated at 37°C
in humidified 5% CO2 in air.
Transgene expression
Following the transduction procedure, the number of colonies that grew in
the presence of G418 was half the number that grew in the absence of G418.
This implies a transduction efficiency of approximately 50%. Nested
polymerase chain reaction (PCR) was used to confirm the presence of neor
in colonies grown for 14 days in the presence of G418. Individual colonies
were plucked, and PCR was performed by means of specifically designed
primers (first-step primers: CAAGCGAAACATCGCA-TCGAGCGA and
GAAGAACTCGTCAAGAAGGCGATA; second-step primers: ATGGAAGCCGGTCTTGTCGAT and GATACCGTAAAGCACGAGGAA). Of
125 colonies analyzed by PCR, 95% expressed neor.
Video recording to measure colony growth rate
Colony-culture dishes were removed from the incubator at intervals of 1 to
2 days and placed on a grid that was designed so that the dish could be
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2606
LEWIS et al
located in precisely the same position and orientation on each occasion.
Whole-culture plates were filmed by moving the cultures past a video
camera mounted on an inverted microscope and attached to a domestic
video recorder. The entire plate was recorded, irrespective of whether a
colony was present. The recordings were reviewed retrospectively, and the
positions of the colonies and the numbers of cells they contained transferred
to a paper replica of the grid.24
Colony replating for secondary colony formation
On the seventh day of culture, 120 colonies of more than 50 cells were
individually plucked and replated into 100 ␮L methylcellulose plus serum
and cytokines in the wells of flat-based 96-well microtiter plates. G418 was
added to secondary cultures of colonies grown from retrovirally transduced
cells that had been exposed to G418 during the primary culture. The
numbers of colonies in each well were scored 7 days after replating, and the
percentage of positive wells and the total number of secondary colonies
were calculated. In addition, the data were plotted as the cumulative
distribution of numbers of secondary colonies per primary colony, and the
area under the curve (AUC) was calculated by means of the trapezium rule.25
The main reason for calculating the AUC is that the distribution of
secondary colonies per primary colony is highly skewed so that median
rather than mean values should be used. However, when fewer than 50% of
the primary colonies form secondary colonies, the median will be zero and
the result will be uninformative. Thus, the AUC is used to provide an
overall measure of amplification of the colony-forming cells regardless of
the replating efficiency of the particular population under investigation.26
Generation of cell lines from p16INK4aⴚ/ⴚ mouse marrow
Fifty individual colonies plucked from the methylcellulose cultures of
p16INK4a⫺/⫺ mouse marrow and 50 from cultures of wild-type mouse
marrow. Each colony was transferred to 100 ␮L of medium plus serum and
WEHI-3B cell–conditioned medium in separate wells of a round-bottomed
96-well microtiter plate. Of the p16INK4a⫺/⫺ colonies, 15 colonies (30%),
but none of the wild-type colonies, expanded in the liquid culture and were
individually transferred to 48-well plates, 24-well plates, and finally to
75-cm2 tissue-culture flasks. We recloned the 15 cell lines by plating them at
104 cells per milliliter in the granulocyte-macrophage colony-forming unit
(CFU-GM) assay and then plucking 10 individual colonies from each for
expansion. At random, 2 expanded colonies were selected from each cell
line and maintained in medium with serum and WEHI-3B cell–conditioned
medium. The remainder were discarded.
Growth-factor independence
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
vector proliferated with the same kinetics as the respective parent cell
lines. Successful transduction of the empty vector into BV173 cells and
K562 cells was confirmed by RT-PCR for the Neor gene, which was
positive in all cases. Neor expression was not detected in untransduced
K562 and BV173 cells. These results show that the transduction
procedure per se had no effect on cell proliferation.
BV173 cells transduced with p16INK4a failed to grow at all in
any of 4 separate experiments (data not shown). Similarly, in 3 of 4
experiments on K562 cells, p16INK4a-expressing cells failed to
grow. In the fourth experiment, the p16INK4a-transduced cells
exhibited a gradual increase in number but showed a considerably
reduced growth rate compared with the parent cells and empty
vector–transduced controls (Figure 1A). These results confirmed
that p16INK4a expression inhibits or prevents cell growth. This slow
growth provided the opportunity to accumulate sufficient cells for
further investigations. The expression of p16INK4a was confirmed
by Western blotting after 16 passages after selection (Figure 1B).
Previous studies have demonstrated that p16INK4a requires a
functional pRB pathway to induce cell cycle arrest.27-30 Also, it has
been shown that p16INK4a prevents CDK4/6 from forming complexes with cyclin D, thereby suppressing phosphorylation of the
pRB family of proteins.31,32 To demonstrate that the p16INK4a/pRB
pathway is intact in K562 cells and that it responds to expression of
p16, we studied the expression of downstream targets of p16INK4a
by Western blotting. The results (Figure 1B) show that p16INK4a
expression in K562 cells reduced phosphorylation of pRB and
p107 and reduced expression levels of the E2F-regulated genes
E2F-1, p107, and p130. Although there is an unexplained decrease
in expression of E2F-1 by the vector-only controls, there was a
complete disappearance of E2F-1 from the p16-transduced cells.
These findings are consistent with previous results showing that the
growth-suppressive properties of p16INK4a are accomplished by
maintaining the pRB-related pocket proteins in their hypophosphorylated states and repressing the transcription of E2F target genes.
Transduction of CDK4 into human CD34ⴙ cells increases
colony growth rate and replating ability
Figure 2A shows that expression of CDK4 in human CD34⫹ cells
increases the growth rate of colonies in clonogenic assays. Moreover, their ability to form secondary colonies upon replating was
We selected 4 of the cell lines at random and tested them for growth-factor
independence either by immediately transferring them to medium lacking
WEHI-3B cell–conditioned medium or by reducing the concentration
stepwise (20%, 10%, 7.5%, 5%, 2.5%, 0%) at 4-day intervals. Trypan
blue–excluding cells were counted at 2-day intervals with a hemocytometer.
Statistical analysis
Nonparametric statistical analysis (Mann-Whitney U test) was performed
with StatView SE⫹Graphics software for the Macintosh computer (Abacus
Concepts, Berkeley, CA). AUCs were calculated with an Excel5 (Microsoft,
Seattle, WA) spreadsheet on a Macintosh computer.
Results
Restoration of p16INK4a expression inhibits proliferation
by BV173 and K562 cells
The CKI p16INK4a was reintroduced into the p16INK4a-deficient BV173
and K562 cell lines by infection with p16INK4a -expressing retrovirus.
Following the 2-week selection period, transduced cells were maintained in selection medium, and the parent cell lines were cultured
without selection. BV173 and K562 cells transduced with the empty
Figure 1. K562 cells. (A) Growth curves for p16INK4a-transduced (K/p16), empty
vector–transduced (K/pBN), and untransduced K562 cells. The p16INK4a-transduced
and empty vector–transduced cells, but not the parental cells, were cultured in the
presence of G418. The results are from the 1 experiment (out of 4) in which the
p16INK4a-transduced cells showed any significant growth. (B) Western blot analysis of
untransduced K562 cells (lane 1), K562 cells transduced with p16 (lane 2), and cells
transduced with empty vector (lane 3) after 16 passages. The results show
expression of p16INK4a by the p16INK4a-transduced cells. Expression of p16INK4a (lane
2) results in loss of the hyperphosphorylated forms of pRB and p107 and in
reductions in the expression levels of p107, p130, and E2F-1.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
also significantly enhanced (Figure 2B, Table 1) in terms of the
percentage of colonies forming secondary colonies upon replating
(2.4-fold), the total number of secondary colonies (8.2-fold), and
the AUC (5.2-fold).
These results indicate that expression of p16INK4a may exert growthsuppressive effects on normal human myeloid progenitor cell growth.
However, CDK4 sequesters p15INK4b, p18INK4c, and p19INK4d, as well as
p16INK4a, all of which can potentially function as tumor-suppressor
genes. The Western blot analysis of CD34⫹ cell lysates in Figure 3
shows expression of p15INK4b, p18INK4c, and p19INK4d, as well as
p16INK4a. Thus, although the effects of CDK4 transduction can be
attributed to sequestration of INK4-family proteins, they cannot be
specifically attributed to the abrogation of p16INK4a.
Deletion of p16INK4a increases myeloid progenitor cell
proliferation in gene knockout mice
There was an obvious increase in colony growth rate and size in
cultures of p16INK4a knockout marrow compared with cultures of
INFLUENCE OF INK4 ON PROGENITOR KINETICS
2607
Table 1. Results of replating granulocyte-macrophage colony-forming unit
colonies with p16INK4a expression abrogated in human cells
or deleted in murine cells
No.
experiments
Replating
colonies, %
Secondary
colonies*
3
20 ⫾ 4
53 ⫾ 26
3
48 ⫾ 5†
433 ⫾ 260†
Wild-type mouse
3
34 ⫾ 8
112 ⫾ 34
p16INK4a⫺/⫺ mouse
3
54 ⫾ 6†
608 ⫾ 157†
15
97 ⫾ 5†
2 404 ⫾ 402†
AUC
Human cells
Control human marrow
16 ⫾ 4
CDK4-transduced
human marrow
83 ⫾ 25†
Murine cells
p16INK4a⫺/⫺ cell lines
37 ⫾ 6
128 ⫾ 17†
343 ⫾ 149†
Data are presented as mean ⫾ SD.
AUC indicates area under the curve; CDK4 indicates cyclin-dependent kinase 4.
*There were 120 primary colonies.
†P ⬍ .05 compared with controls (Mann-Whitney test).
wild-type marrow. The data in Figure 4A show that the numbers of
cells per colony increase more rapidly in cultures of p16INK4a
knockout marrow compared with wild-type cultures and indicate a
reduction in cell-doubling time from 15 hours to 12 hours (P ⫽ .003).
Cytospin preparations of 50 p16INK4a knockout marrow colonies and
50 wild-type marrow colonies were examined to evaluate cell
morphology. All colonies consisted of cells of the myeloid and/or
monocyte lineage. There were no major differences in the lineage
representation or stage of cell differentiation in colonies grown
from p16INK4a knockout marrow compared with wild-type colonies.
The results of replating the colonies into secondary cultures
showed that the enhanced colony growth rate was associated with
increased multiplication of clonogenic cells within the developing
colonies (Table 1, Figure 4B). Deletion of p16INK4a resulted in significant
increases in the percentage of colonies that formed secondary colonies
upon replating (1.6-fold), in the total number of secondary colonies
(5.4-fold), and in the magnitude of the AUC (3.5-fold). Retrovirusmediated gene transfer (RMGT)–mediated resoration of p16INK4a
into bone marrow cells of 2 of p16INK4a⫺/⫺ mice resulted in 45%
and 46% reductions in the magnitude of the AUC. This shows that
p16INK4a gene deletion played a significant part in the increased
AUC exhibited by p16INK4a⫺/⫺ bone marrow cells.
P16INK4a gene deletion facilitates cell line propagation in vitro
None of the wild-type colonies expanded sufficiently to produce
cell lines, and all cells were dead within 2 weeks of plucking the
colonies. After recloning, the 15 p16INK4a⫺/⫺ cell lines showed a
higher colony-forming efficiency than the p16INK4a⫺/⫺ primary
bone marrow cells. Almost all of the colonies (96.7%) produced
secondary colonies upon replating, and there was also an increase
in the level of the AUC (Table 1).
Figure 2. Growth and replication of CFU-GM. (A) Growth rates of CFU-GM
colonies grown from normal human bone marrow CD34⫹ cells transduced with
wild-type CDK4 (WT-CDK4) or empty vector (pBN). n ⫽ number of colonies analyzed
in each group. (B) Replicative capacity of CFU-GM, as reflected by the AUC, grown
from WT-CDK4–transduced or control-transduced CD34⫹ normal human marrow
cells. Samples from 3 donors were analyzed.
Figure 3. Western blot analysis of cell lysates. Western blot analysis of INK4
proteins in CD34⫹ cell lysates using antibodies against p15, p16, p18, and p19.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2608
LEWIS et al
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
grown from p16INK4a knockout mouse bone marrow and from
CDK4-transduced normal human CD34⫹ cells. These observations
are in line with the reduced growth rate of K562 cells in which
p16INK4a expression had been restored. The assays of colonies for
their content of progenitor cells, by replating them into secondary
cultures, revealed that colonies of normal cells from which p16INK4a/
INK4 proteins had been deleted or abrogated contained increased
Figure 4. Growth and replication of CFU-GM. (A) Growth rates of CFU-GM
colonies grown from marrow of p16INK4a knockout (⫺/⫺) and intact (⫹/⫹) mice.
n ⫽ number of colonies analyzed in each group. (B) Replicative capacity of CFU-GM,
as reflected by the AUC, grown from marrow of p16INK4a knockout (⫺/⫺) and intact
(⫹/⫹) mice. n ⫽ 3 for each group.
Figure 5A-B shows the results of immediate and stepwise
growth-factor deprivation. When growth factor was immediately
withdrawn from 4 cell lines, 2 of them died out rapidly, but the
other 2 survived for 2 weeks and then grew at the same rate as the
controls in WEHI-3B cell–conditioned medium (Figure 5A). When
growth factor was withdrawn from the same cell lines over a period
of 2 weeks, all of the cell lines survived and were able to grow
without WEHI-3B cell–conditioned medium at the same rate as the
controls (Figure 5B).
Discussion
We have used 3 in vitro model systems to investigate the influence
of p16INK4a on hematopoietic progenitor cell proliferation. There
were consistent increases in the growth rates and sizes of colonies
Figure 5. Growth factor independence. (A) Effects of immediate total WEHI-3B CM
withdrawal from 4 cell lines derived from p16INK4a⫺/⫺ mouse bone marrow. (B) Effects
of stepwise WEHI-3B CM withdrawal from 4 cell lines derived from p16INK4a⫺/⫺ mouse
bone marrow.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
numbers of clonogenic cells and that this increase was counteracted
by RMGT of p16INK4a into p16INK4a⫺/⫺ mouse bone marrow cells.
We found that, in most cases, restoration of p16INK4a expression
in p16INK4-deleted lymphoid (BV173) and myeloid (K562) cell
lines completely repress cell proliferation, indicating that p16INK4a
has a role in controlling proliferation in these hematopoietic cells.
Interestingly, we found in one experiment that expression of
p16INK4a in K562 cells did not completely suppress cell growth in
spite of the fact that most if not all of the cells stained with anti–p16
fluorescein isothiocyanate (data not shown). This result indicates
that the effects of p16INK4a may vary, possibly according to the
levels of p16INK4a protein in the cells.
It has been reported that p16INK4a can induce cell cycle arrest
only in cells with an intact and functional pRB pathway.27-30
Consequently, it was important to confirm that changes in the
expression of p16INK4a can induce hypophosphorylation of pRBrelated pocket proteins and repression of E2F activity. The
p16INK4a-transduced K562 cells had increased levels of the hypophosphorylated forms of pRB and p107 compared with untransduced cells and cells transduced with empty expression vector. This
observation is consistent with previous reports showing that
p16INK4a represses the activity of cyclin D–dependent kinases,
which are responsible for the phosphorylation of all 3 of these
pocket proteins.33-36 We also found that restoration of p16INK4a was
associated with down-regulation of pRB, p107, and a component of
the E2F transcription factor family (E2F-1). This is attributable to
the fact that pRB, p107, and E2F-1 are E2F-regulated genes33-35 and
are repressed by the accumulation of dephosphorylated forms of
the pocket proteins. Overall, these results imply that the pRB
pathway in K562 cells is intact and that it responds to overexpression of p16INK4a. However, these cell line models cannot be used to
evaluate changes in progenitor cell renewal and differentiation and
do not provide information about the function of p16INK4a in
untransformed primary cells. To characterize further the functional
role of p16INK4a or related INK4 family proteins, we investigated
the effects of sequestering p16INK4a/INK4-family proteins in primary human CD34⫹ cells.
In the primary human CFU-GM model, we used CDK4 to
sequester p16INK4a and mimic the inactivation of p16INK4a.30 This
interaction between CDK4 and p16INK4a occurs pathologically in
glioma.22 CDK4 amplification has been shown to be an alternative
to p16INK4a homozygous gene deletion in glioma cell lines and may
be experimentally mimicked in vitro by retrovirus-mediated transduction of CDK4.30 However, overexpression of CDK4 eliminates
all INK4 family members, and p15INK4b, p18INK4c, and p16INK4d can
potentially function as tumor-suppressor genes. As confirmation in
other studies,37-39 we found that normal human CD34⫹ cells
express p15INK4b, p18INK4c, and p19INK4d, in addition to p16INK4a.
Thus, on this evidence alone, we cannot attribute the effects found
in primary hematopoietic progenitor cells specifically to abrogation
of p16INK4a. To investigate the role of p16INK4a itself, we also set up
CFU-GM assays from the bone marrow of p16INK4a⫺/⫺ mice.
Consistent with the data from human CD34⫹ cells, we found that
CFU-GM from p16INK4a⫺/⫺ mice have a greatly increased growth
rate and replating ability. These results from the knockout-mouse
model cannot be explained by deletion of p15INK4b, p18INK4c, or
p19INK4d since these genes remain intact in the animals. Consequently, it is likely that p16INK4a has a similar role in human and
murine hematopoietic progenitor cells.
The INK4a locus encodes 2 potential tumor suppressors with
different reading frames. P16INK4a is encoded by exons 1␣, 2, and 3, and
the alternative reading frame (ARF) consists of exons 1␤, 2, and 3 and
INFLUENCE OF INK4 ON PROGENITOR KINETICS
2609
encodes p19ARF in mice and p14ARF in humans.40-43 It is therefore
noteworthy that the p16INK4a⫺/⫺ mice used in our studies have p16INK4a
inactivated through deletion of p16INK4a exon 2,21 and it is thus possible
that this deletion could also inactivate p19ARF. However, recent mutation
studies have shown that only exon 1␤ is necessary for the activity of
p19ARF, and it is conceivable that the cells from the p16INK4aexon2⫺/⫺ mice
produce a truncated protein that is still active. Indeed, cells from these
mice have been shown to up-regulate p53 expression in response to
oncogenic Ras, suggesting that the ARF activity is functional.44 Deletion
of p16INK4a will cause pRB to be hyperphosphorylated and thereby
increase E2F-1 activity. Moreover, expression of CDK4 in normal
human CFU-GM will cause pRB hyperphosphorylation, induction of
E2F-1 activity, and an increase in transcription of the ARF gene because
the ARF gene has been shown to be positively regulated by E2F-1. In
this case, overexpression of ARF should have a negative effect on
proliferation by inducing cell cycle arrest and apoptosis. However,
transduction of human CFU-GM with CDK4 increased the growth rate
and replating efficiency, consistent with a role for p16INK4a in progenitor
cell proliferation. It is also relevant that the ARF proteins target p53 by
binding to MDM2, rather than CDK4, and do not exert their effects
through the Rb pathway,45,46 so that the results obtained in the human
CFU-GM model cannot be explained by an action on ARF. Finally, the
results of restoring p16INK4 expression to K562 cells, in which the
human p14ARF is also deleted, and to p16INK4a⫺/⫺ mouse bone marrow
cells show that p16INK4a can have important effects irrespective of the
presence or absence of p14/19ARF.
Hematopoietic progenitor cells from p16INK4a⫺/⫺ mice were
able to survive in the absence of stromal cell support for at least 6
months, suggesting that lack of p16INK4a function considerably
increases the longevity of hematopoietic cell clones and may even
render them immortal. The increased clonogenic activity and
replating activity are consistent with the kinetic requirements of
increased self-renewal for clonal expansion.10,11 The growth factor–
deprivation experiments indicate that the majority of the cell lines
initially were growth factor–dependent but that they readily
became growth factor–independent upon withdrawal of WEHI-3B
cell–conditioned medium. This result is consistent with the idea
that cyclin D/CDK4–dependent kinase has a critical role in
integrating mitogenic signals from growth factors with the cell
cycle machinery.31,32 Furthermore, our finding is supported by a
recent report that both p16INK4a and p19ARF have roles in cellular
immortalization and that they act in overlapping pathways.47 At this
stage, we cannot rule out a role for secondary genetic abnormalities, possibly as a result of the increased cell proliferation and/or
increased genetic instability in cells lacking the p16INK4a protein, in
transformation to growth-factor independence. We also do not
exclude the possibility that the tumor-suppressor gene ARF may
have a role in immortalization of these cells.
Overall, our results strongly implicate p16INK4a in the regulation
of hematopoietic-progenitor cell kinetics although yet-to-bedefined roles for other members of the INK4 family cannot be ruled
out entirely. They suggest a role for the INK4/CDK4/pRB pathway
in regulating the kinetics of progenitor cell renewal and differentiation, and highlight their importance for clonal survival.
Acknowledgments
We thank Dr M. Serrano (Centro Nacional de Biotecnologia,
Madrid, Spain) for the generous donation of the p16INK4a cDNA and
the INK4a knockout mice, and Dr J. V. Melo for designing the
PCR primers.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2610
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
LEWIS et al
References
1. Hall M, Peters G. Genetic alterations of cyclins,
cyclin-dependent kinases, and Cdk inhibitors in
human cancer. Adv Cancer Res. 1996;68:67-108.
18. Pegoraro L, Matera L, Ritz J. Establishment of a
Ph1-positive cell line, BV173. J Natl Cancer Inst.
1983;70:447-452.
2. Nakamura K, Koda T, Kakinuma M, et al. Cell
cycle dependent gene expressions and activities
of protein phosphatases PP1 and PP2A in mouse
NIH3T3 fibroblasts. Biochem Biophys Res
Comm. 1992;187:507-514.
19. Klein E, Ben-Bassat H, Neumann H, et al. Properties of the K562 cell line, derived from a patient
with chronic myeloid leukemia. Int J Cancer.
1976;18:421-431.
3. Otsuki T, Clark HM, Wellmann A, Jaffe ES,
Raffeld M. Involvement of CDKN2 (p16INK4A/
MTS1) and p15INK4b in human leukemias and
lymphomas. Cancer Res. 1995;55:1436-1440.
20. Chinswangwatanakul W. Role of p16 in chronic
myeloid leukaemia and normal haemopoiesis
[dissertation]. University of London, United Kingdom; 1999.
4. Quesnel B., Preudhomme C, Philippe N, et al.
p16 gene homozygous deletions in acute lymphoblastic leukemia. Blood. 1995;85:657-663.
21. Serrano M, Lee H, Chin L, Cordon-Cardo C,
Beach D, DePinho RA. Role of the INK4a locus in
tumor suppression and cell mortality. Cell. 1996;
85:27-37.
5. Sill H, Aguiar CT, Schmidt H, Hochhaus A, Goldman JM, Cross NCP. Mutational analysis of the
p15 and p16 genes in acute leukaemias. Br J
Haematol. 1996;92:681-683.
22. He J, Allen JR, Collins VP, et al. CDK4 amplification is an alternative mechanism to p16 gene homozygous deletion in glioma cell lines. Cancer
Res. 1994;54:5804-5807.
6. Hirama T, Koeffler HP. Role of the cyclin-dependent kinase inhibitors in the development of cancer. Blood. 1995;86:841-854.
23. Chinswangwatanakul W, Lewis JL, Manning M,
Roberts IAG, Gordon MY. Use of G418 resistance
to select cells retrovirally transduced with the
NeoR gene. Exp Hematol. 1998;26:185-187.
7. Nakamaki T, Kawamata N, Schwaller J, et al.
Structural integrity of the cyclin-dependent kinase
inhibitor genes p15, p16 and p18 in myeloid leukaemias. Br J Haematol. 1995;91:139-149.
8. Quesnel B, Preudhomme C, Lepelley P, et al.
Transfer of p16inka/CDKN2 gene in leukaemic cell
lines inhibits cell proliferation. Br J Haematol.
1996;95:291-298.
9. Urashima M, DeCaprio JA, Chauhan D, et al.
p16INK4A promotes differentiation and inhibits
apoptosis of JKB acute lymphoblastic leukemia
cells. Blood. 1997;90:4106-4115.
10. Gordon MY, Blackett NM. Some factors determining the minimum number of cells required for successful clinical engraftment. Bone Marrow Transplant. 1995;15:659-662.
11. Gordon MY, Blackett NM. Reconstruction of the
hematopoietic system after stem cell transplantation. Cell Transplant. 1998;7:339-344.
12. Gordon MY, Goldman JM. Cellular and molecular
mechanisms in chronic myeloid leukaemia: biology and treatment. Br J Haematol. 1996;95:1020.
13. Sherr CJ. Cancer cell cycles. Science. 1996;274:
1672-1677.
14. Weinberg RA. The retinoblastoma protein and
cell cycle control. Cell. 1995;81:323-330.
15. Lam EW-F, La Thangue NB. DP and E2F proteins: coordinating transcription with cell cycle
progression. Curr Opin Cell Biol. 1994;6:859-866.
16. Sardet, LeCam LE, Fabbrizio E, Vidal M. Oncogenes as transcriptional regulators. In: Ghysdael
J, Yaniv M, eds. Oncogenes as Transcriptional
Regulators, Vol 2. Berlin, Germany: Birkhauser
Verlag; 1997:1-63.
17. Dyson N. The regulation of E2F by pRB-family
proteins. Genes Dev. 1998;12:2245-2262.
24. Lewis JL, Blackett NM, Gordon MY. The kinetics
of colony formation by CFU-GM in vitro. Br J
Haematol. 1994;88:440-442.
25. Altman D. Practical statistics for medical research. Oxford, UK, Blackwell Scientific Publications; 1990:433.
26. Gordon MY, Marley SB, Lewis JL, et al. Treatment with interferon-␣ preferentially reduces the
capacity for amplification of granulocyte-macrophage progenitors (CFU-GM) from patients with
chronic myeloid leukemia but spares normal
CFU-GM. J Clin Invest. 1998;102:710-715.
location, and characterization of mouse E2F1.
Mol Cell Biol. 1994;14:1861-1869.
34. Johnson DG. Regulation of E2F-1 gene expression by p130 (Rb2) and D-type cyclin kinase activity. Oncogene. 1995;11:1685-1692.
35. Hu L, Xie E, Chang LS. Different roles of two tandem E2F sites in repression of the human p107
promoter by retinoblastoma and p107 proteins.
Mol Cell Biol. 1995;15:3552-3562.
36. Dong F, Cress WD Jr, Agrawal D, Pledger WJ.
The role of cyclin D3-dependent kinase in the
phosphorylation of p130 in mouse BALB/c 3T3
fibroblasts. J Biol Chem. 1998;273:6190-6195.
37. Tschan M, Peters U, Cajot JF, Betticher DC, Fey
MF, Tobler A. The cyclin-dependent kinase inhibitors p18ink4c and p19ink4d are highly expressed
in CD34⫹ progenitor and acute myeloid leukaemic cells but not in normal differentiated myeloid
cells. Br J Haematol. 1999;106:644-651.
38. Della Ragione F, Borriello A, Mastropietro S, et al.
Expression of G1-phase cell cycle genes during
hematopoietic lineage. Biochem Biophys Res
Comm. 1997;231:73-76.
39. Teofili L, Rutella S, Chiusolo P, et al. Expression
of p15INK4b in normal human hematopoiesis. Exp
Hematol. 1998;26:1133-1139.
40. Quelle D, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable
of inducing cell cycle arrest. Cell. 1995;83:9931000.
41. Duro D, Bernard O, Della Valle V, Berger R,
Larsen CJ. A new type of p16ink4a/MTS1 gene
transcript expressed in B-cell malignancies. Oncogene. 1995;11:21-29.
27. Koh J, Enders GH, Dynlacht BD, Harlow E. Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature. 1995;375:
506-510.
42. Stone S, Jiang P, Dayananth P, et al. Complex
structure and regulation of the p16ink4a locus.
Cancer Res. 1995;55:2988-2994.
28. Lukas J, Parry D, Aagaard L, et al. Retinoblastoma-protein-dependent cell cycle inhibition by
the tumor suppressor p16. Nature. 1995;375:503506.
43. Stott FJ, Bates S, James MC, et al. The alternative product from the human CDKN2A locus,
p14(ARF), participates in a regulatory feedback
loop with p53 and MDM2. EMBO J. 1998;17:
5001-5014.
29. Medena RH, Herrera RE, Lam F, Weinberg RA.
Growth suppression by p16 requires functional
retinoblastoma protein. Proc Natl Acad Sci U S A.
1995;92:6289-6293.
30. Serrano M, Gomez-Lahoz E, DePinho RA, Beach
D, Bar-Sagi D. Inhibition of ras-induced proliferation and cellular transformation by p16INK4. Science. 1995;267:249-252.
31. Sherr CJ, Roberts JM. Inhibitors of mammalian
G1 cyclin-dependent kinases. Genes Dev. 1995;
9:1149-1163.
32. Sherr CJ, Roberts JM. CDK inhibitors: positive
and negative regulators of G1-phase progression. Genes Dev. 1999;13:1501-1512.
33. Li Y, Slansky JE, Myers DJ, Drinkwater NR,
Kaelin WG, Farnham PJ. Cloning, chromosomal
44. Serrano M. The tumor suppresor gene p16INK4a.
Exp Cell Res. 1997;237:7-13.
45. Zhang Y, Xiong Y, Yarbrough WG. ARF promotes
MDM2 degradation and stabilizes p53: ARFINK4a locus delection impairs both the Rb and
p53 tumor suppression pathways. Cell. 1998;92:
725-734.
46. Pomerantz J, Schreiber-Agus N, Ligeois N, et al.
The INK4a tumor suppressor gene product p19Arf
interacts with MDM2 and neutralizes MDM2’s inhibition of p53. Cell. 1998;92:713-723.
47. Carnero A, Hudson JD, Price CM, Beach DH.
P16INK4a and p19Arf act in overlapping pathways in cellular immortalization. Nat Cell Biol.
2000;2:148-155.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
2001 97: 2604-2610
doi:10.1182/blood.V97.9.2604
The influence of INK4 proteins on growth and self-renewal kinetics of
hematopoietic progenitor cells
John L. Lewis, Wimol Chinswangwatanakul, Bo Zheng, Stephen B. Marley, Dao X. Nguyen, Nicholas C. P.
Cross, Lolita Banerji, Janet Glassford, N. Shaun B. Thomas, John M. Goldman, Eric W.-F. Lam and Myrtle Y.
Gordon
Updated information and services can be found at:
http://www.bloodjournal.org/content/97/9/2604.full.html
Articles on similar topics can be found in the following Blood collections
Cell Cycle (231 articles)
Hematopoiesis and Stem Cells (3432 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.