The Plant Journal (2007) 51, 551–562
doi: 10.1111/j.1365-313X.2007.03160.x
Mutations in CHLOROPLAST RNA BINDING provide evidence
for the involvement of the chloroplast in the regulation of the
circadian clock in Arabidopsis
Miriam Hassidim, Esther Yakir, David Fradkin, Dror Hilman, Ido Kron, Nir Keren, Yael Harir, Shai Yerushalmi and
Rachel M. Green*
Department of Plant and Environmental Sciences, Institute for Life Sciences, Hebrew University, Givat Ram, Jerusalem 91904,
Israel
Received 19 November 2006; revised 29 March 2007; accepted 5 April 2007.
*
For correspondence (fax +972 2 658 4425, e-mail [email protected]).
Summary
The Arabidopsis circadian system regulates the expression of up to 36% of the nuclear genome, including
many genes that encode photosynthetic proteins. The expression of nuclear-encoded photosynthesis genes is
also regulated by signals from the chloroplasts, a process known as retrograde signaling. We have identified
CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein, and have shown that it is important for
the proper functioning of the chloroplast. crb plants are smaller and paler than wild-type plants, and have
altered chloroplast morphology and photosynthetic performance. Surprisingly, mutations in CRB also affect
the circadian system, altering the expression of both oscillator and output genes. In order to determine
whether the changes in circadian gene expression are specific to mutations in the CRB gene, or are more
generally caused by the malfunctioning of the chloroplast, we also examined the circadian system in mutations
affecting STN7, GUN1, and GUN5, unrelated nuclear-encoded chloroplast proteins known to be involved in
retrograde signaling. Our results provide evidence that the functional state of the chloroplast may be an
important factor that affects the circadian system.
Keywords: circadian, chloroplast, Arabidopsis, signaling, RNA binding, retrograde signaling.
Introduction
Plants, in common with a range of other organisms, have
accurate, robust endogenous rhythms that enable them to
time molecular and physiologic processes to fit their environmental conditions. The most widely studied of such
rhythms are those with approximately 24-h periods that are
controlled by the circadian system. In plants, the circadian
clock system regulates a diverse range of processes, from
gene expression and protein phosphorylation to cellular
calcium oscillations, leaf movements, and photoperiodic
flowering (Barak et al., 2000). It is likely that one of the most
important functions of the circadian clock is to control temporal synchronization of a range of interconnected pathways, both with each other and with the daily changes of
environmental light conditions and temperature. Consistent
with this idea, it has been demonstrated that plants that lack
a functional circadian system show lower rates of growth,
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd
photosynthesis, and survival (Dodd et al., 2005; Green et al.,
2002).
Over the past decade, considerable progress has been
made in understanding the molecular basis of the Arabidopsis circadian system. At the core of the circadian system is
the oscillator that is responsible for generating the daily
rhythms. This oscillator appears to be made up of one or
more positive/negative feedback loops. The first such positive/negative feedback loop to be described consists of the
positive element TIMING OF CAB1, TOC1 (Makino et al.,
2002; Strayer et al., 2000), which is responsible for activating
the expression of two single Myb proteins CIRCADIAN
CLOCK ASSOCIATED 1, CCA1, (Wang and Tobin, 1998),
and LATE ELONGATED HYPOCOTYL, LHY (Schaffer et al.,
1998). These Myb proteins act as negative elements in the
loop repressing the activity of the positive element (Alabadi
551
552 Miriam Hassidim et al.
et al., 2001). The resulting cycle of activation and repression,
probably with several as yet unknown modification steps,
takes around 24 h. Subsequently, additional feedback loops
have been identified suggesting that the oscillator may be
composed of several interlocking feedback loops. Such an
arrangement is likely to be important for conferring stability
to the oscillator, and is part of the mechanism ensuring that
the circadian system is able to function accurately under a
range of environmental conditions (Edwards et al., 2005;
Gould et al., 2006; Locke et al., 2005).
In order to be biologically relevant, the oscillator must be
able to both respond to changes in the plant’s environment
and to be connected to pathways that regulate circadian
processes within the plant. Changes in light and temperature conditions can entrain the oscillator so that it will
function with the correct phase relative to the environment,
so as to ensure that clock-regulated processes occur at the
appropriate time of day. The input pathways by which
signals from the light receptors, phytochrome, and cryptochrome, are transduced to the oscillator are beginning to
be understood (Salome and McClung, 2004). However,
although it has recently been shown that two homologs of
TOC1 may confer temperature sensitivity to the oscillator
(Salome and McClung, 2005), less is known about how
changes in environmental temperature can entrain the
oscillator. Finally, output pathways from the oscillator
regulate the various plant processes that are under circadian
control, including, as several studies have demonstrated,
the expression of up to 36% of the nuclear genome (Edwards
et al., 2006; Harmer et al., 2000; Michael and McClung, 2003;
Schaffer et al., 2001).
An important subset of the circadian-regulated nuclear
genes encodes chloroplast proteins (Harmer et al., 2000).
Chloroplasts have evolved from a prokaryotic cyanobacterium-like ancestor that was taken up by a eukaryotic host cell
(Dyall et al., 2004). During the course of evolution, the
majority of the chloroplast genes, including those encoding
the light-harvesting antenna complex (LHC), were transferred from the chloroplast genome to the nucleus (Martin
et al., 2002). The chloroplast retained around 100–120 genes,
the plastome, and the mechanism to express the plastome
genes. However, most of the approximately 3000 proteins
required for chloroplast function (Richly and Leister, 2004)
are encoded by the nucleus. The circadian system may have
an important role in regulating the expression of nuclearencoded chloroplast genes to ensure that they are produced
at the time of day when they are most needed (Harmer et al.,
2000). For example, LHC transcript levels rise before dawn
and peak in the morning (Harmer et al., 2000).
Clearly, the dual location of the chloroplast genes necessitates coordination between the nucleus and chloroplast in
regulating nuclear gene expression. A number of reports
have shown that there are several mechanisms by which the
chloroplast may influence nuclear gene expression, a
process known as retrograde signaling (Leister, 2005). It
has been demonstrated that signals generated by changes in
photosynthetic electron transport may affect nuclear gene
expression. For example, in some systems, changes in the
redox state of the chloroplast plastoquinone pool can
regulate the activity of nuclear genes (Pfannschmidt et al.,
2001). The chlorophyll biosynthesis pathway has also been
associated with the control of nuclear gene expression.
Experiments carried out with several of the genome
uncoupled (gun) mutants suggest that the tetrapyrrole
intermediate in the chlorophyll biosynthesis pathway,
Mg-protoporphyrin IX, may be a signaling molecule
between the chloroplasts and the nucleus (Strand et al.,
2003). Furthermore, in young seedlings, plastid proteins may
also be involved in the signaling pathway from the chloroplasts (Gray et al., 2003). Finally, sugar status (Rolland et al.,
2002) and reactive oxygen species (ROS) caused by high
levels of light stress may also regulate nuclear gene expression (Karpinski et al., 1999; Vandenabeele et al., 2004).
Systematic analyses of mRNA expression have shown
that the nuclear-encoded genes that are regulated by the
chloroplast fall into several groups. The largest group
appears to be regulated coordinately by a ‘master switch’,
whereas a smaller group, which mostly encode proteins of
the photosystems and proteins necessary for plastome gene
expression, are coordinated by an alternative mechanism
(Biehl et al., 2005; Richly et al., 2003). These results indicate
that there are different levels of transcriptional control for
nuclear-encoded chloroplast genes. However, little is known
about how nuclear gene transcription is regulated by
chloroplast signals.
In a functional screen to identify putative RNA-binding
proteins involved in regulating the circadian system, we
have isolated a gene we have called CHLOROPLAST RNA
BINDING (CRB). Mutations in CRB have profound effects on
the chloroplast morphology and photosynthetic performance, as well as on the functioning of the circadian system
in Arabidopsis. In order to determine whether the effect of
the CRB mutations on the circadian system is specific or,
alternatively, is representative of a more general phenomenon in which signals from the chloroplasts can affect the
circadian oscillator, we also examined the effect of mutations in genes encoding STN7, GUN5, and GUN1, unrelated chloroplast proteins involved in retrograde signaling
(Bellafiore et al., 2005; Bonardi et al., 2005; Strand et al.,
2003; Susek et al., 1993). Our results show that the
circadian system in plants is regulated not only by extracellular signals from the environment but also may be
controlled by intracellular signals from the chloroplasts.
We suggest that because the circadian system regulates
the expression of many chloroplast genes, entrainment of
the circadian oscillator by chloroplast signals may be an
important factor in chloroplast regulation of nuclear gene
expression.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
Circadian regulation and the chloroplast 553
Table 1 List of putative RNA-interacting proteins identified as
being under circadian control in the microarray database http://
www.arabidopsis.org/servlets/TairObject?type=expression_set&id=
100582353
Gene name
Gene identity
At4g18470
At4g31180
At5g11200
At3g47160
At4g13850
At1g09340
RNA helicase-like protein
Aspartate tRNA ligase-like protein
DEAD BOX RNA helicase RH15
RNA-binding protein-like protein
Glycine-rich RNA binding protein
Putative RNA-binding protein
Results
Identification of CRB
In order to identify RNA-binding proteins that have a role in
regulating the circadian system, we carried out a functional
screen. The rationale behind the screen is based on the
observation that most of the genes that are important for
regulating the circadian system, in both plants and other
organisms, are themselves under circadian control. We
therefore used publicly available microarray data to find
circadian-regulated genes that encode RNA-binding proteins (http://www.arabidopsis.org/servlets/TairObject?type=
expression_set&id=1005823573). We identified six genes in
the microarray database that encode putative RNA-binding
factors or other proteins that interact with RNA (Table 1).
T-DNA insertion mutants (Alonso et al., 2003) were
obtained for these putative RNA-binding proteins and
examined (as described in the Experiments below) to see
which of them showed altered physiologic and circadian
phenotypes.
One of the genes identified encodes a putative RNAbinding protein with homology to the spinach chloroplast
endoribonuclease, CSP41 (Bollenbach et al., 2003). Based on
its sequence homology to a nuclear-encoded chloroplast
RNA binding protein, we called the gene CHLOROPLAST
RNA BINDING (CRB). Figure 1 confirms that CRB is under
circadian control with a peak in expression in the evening.
In order to determine the function of CRB, we examined
two T-DNA insertion lines, crb-1 and crb-2. The T-DNA
insertion in crb-1 is in the seventh exon (Figure 2a) and
results in a truncated CRB transcript (Figure 2b). In crb-2 the
T-DNA insertion is at the beginning of the first exon
(Figure 2a) of CRB, and there is no detectable CRB mRNA
(Figure 2b).
CRB mutants have a distinctive phenotype
Both crb-1 and crb-2 plants have a characteristic phenotype.
Figure 3a shows that both mutants, but especially crb-1, are
smaller and paler than wild-type plants. Total fresh weight
Figure 1. Circadian oscillations of CRB transcript accumulation.
Wild-type plants were transferred to constant light after entrainment over
long days. The levels of CRB mRNA were determined by Northern analysis
(shown above the graph) and plotted on a graph relative to the maximum
levels of expression. Aliquots of 1.5 lg of each RNA sample were also run on
an agarose gel to check for quality and verify quantitation (shown below the
graph). The yellow and grey-hatched bars represent subjective light and dark
periods in constant light, respectively.
accumulation in both the crb mutants is correspondingly
lower than in wild type (Figure 3b). We examined the chlorophyll levels in the crb plants compared with wild-type
plants and found that there is a reduction in both chlorophyll a and chlorophyll b (Figure 3c). However, the reduction in chlorophyll a levels is more severe resulting in an
average chlorophyll a/b ratio of 2.86 in wild type (SD 0.08),
2.01 (SD 0.07) in crb-1, and 2.2 (SD 0.11) in crb-2 plants. crb-1
mutants also show higher levels of protochlorophyllide, the
precursor of chlorophyll (Figure 3d).
Photosynthesis is also impaired in the crb mutants and the
fluorescence parameters are profoundly altered. The maximum quantum yield of photosystem II (Fv/Fm, Variable
Fluorescence/Maximum Fluorescence) is significantly reduced in crb plants compared with wild type (Figure 3e).
This is a result of a high proportion of the light energy
absorbed by chlorophyll molecules in crb plants being
re-emitted as fluorescence. Thus, it is likely that during
photosynthesis less light is funneled toward photochemical
processes in crb plants compared with wild type. Moreover,
the light that reaches the photosystem-II (PSII) reaction
centers is not utilized optimally as the proportion of open
PSII centers (qP) is lower in crb plants than in wild type
(Figure 3f). Furthermore, the blue shift in the position of the
PSII and PSI fluorescence bands indicates a larger proportion
of antenna to reaction centers in mutant plants (Figure 3g).
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
554 Miriam Hassidim et al.
Figure 2. Structure of the CRB gene and accumulation of CRB transcripts in wild-type and mutant plants.
(a) The CRB gene with introns (black lines), exons (black boxes), and 3¢- and 5¢-untranslated regions (grey lines). The positions of the two T-DNA insertions (crb-2,
SALK_107566, and crb-1, SALK_021748) are shown above the gene. The positions of the two RNA probes (CRB probe 1 and CRB probe 2) specific to CRB are shown
as black lines under the gene.
(b) The two CRB-specific probes were used in Northern analyses to measure CRB mRNA accumulation in wild-type, crb-1, and crb-2 plants. Aliquots of 1.5 lg of each
RNA sample were also run on an agarose gel to check for quality and verify quantitation. The black arrow indicates the position of the full-length CRB transcript; the
white arrow shows the truncated transcript in crb-1.
Our results suggest that CRB may be important for
chloroplast structure and function. crb mutants show a
distinctive pale phenotype, a blue shift in the position of PSI
and PSII fluorescence bands, deficiency in chlorophyll and
impaired photosynthesis. There is also evidence, from two
independent proteomic studies on the Arabidopsis chloroplast, that CRB may be targeted to the chloroplast
(Kleffmann et al., 2004; Ytterberg et al., 2006). Consistent
with these findings, electron microscopy studies show that
the chloroplasts of the crb-1 mutant tend to be aberrantly
shaped (Figure 4b,d) compared with wild-type plants
(Figure 4a,c). Moreover, thylakoid organization is usually
altered in the crb-1 mutant. Whilst a few crb-1 plastids are
almost normal (Figure 4d, open arrow) compared with wild
type (Figure 4c), most crb-1 plastids contain a much higher
number of membranes in each granal stack and fewer
interconnecting stromal lamellae (Figure 4f) than in wild
type (Figure 4e). In addition, in many cases the crb-1
photosynthetic membranes are not aligned parallel to the
plastid axis, and there are large areas of the chloroplasts
in the mutants that appear to be devoid of thylakoids
(Figure 4d, closed arrow).
Mutations in CRB affect circadian rhythms
We investigated whether CRB has a role in regulating circadian rhythms by examining the expression pattern of key
components of the Arabidopsis circadian oscillator, CCA1
and LHY, in crb plants. Northern and quantitative real-time
PCR analyses show that in crb-1 plants that have been
transferred to continuous light after growing under longday conditions (14-h light:10-h dark), CCA1 and LHY
transcript accumulation is rhythmic and appears to oscillate with the same period as in the wild-type control
(Figure 5a–c). However, the pattern of CCA1 and LHY
mRNA accumulation was altered in crb-1 plants, with a
greater amplitude and with a delay in the timing of
increases and decreases in transcript accumulation. CCA1
and LHY transcript accumulation is affected in a similar
way in crb-2 plants (Figure S1a,b).
In order to determine whether circadian output pathways are also affected by the changes in the oscillator, we
examined the expression of two output genes, LHCB (also
known as CAB) and ATGRP7 (also known as CCR2;
Heintzen et al., 1997). Figure 5d shows that in constant
light LHCB transcript levels are elevated in crb-1 plants.
Furthermore, the timing of the increases and decreases in
LHCB mRNA levels are delayed compared with wild-type
plants. Similar results were obtained for the crb-2 plants
(Figure S1c). In crb-1 plants ATGRP7 transcript levels also
show an altered phase of accumulation but are lower than
in wild type (Figure 5e). Examining gene expression under
conditions of constant light and temperature shows the
effect of the mutations on the circadian clock, but plants
usually grow in conditions of daily changes of light and
dark. Under dark:light conditions, both the circadian system and light signals play a role in regulating gene
expression. We therefore examined the expression of
CCA1 in wild-type and crb-1 plants growing over long
days (14-h light:10-h dark). Figure 6a shows that over long
days there is a large increase in the amplitude of CCA1
mRNA accumulation in crb-1 plants compared with wildtype plants. However, there appeared to be little difference
in the timing of the increases and decreases in expression
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
Circadian regulation and the chloroplast 555
Figure 3. The phenotype of the crb mutants.
(a) Three-week-old wild-type and crb plants
grown over long days on 1% sucrose.
(b) The average fresh weight of wild-type and crb
plants grown over long days for 5 weeks on 1%
sucrose is shown together with the standard
error.
(c) The amount of chlorophyll mg)1 fresh weight
in WT and crb plants grown over long days for
5 weeks on 1% sucrose is shown together with
the standard error.
(d) Fluorescence emission spectra at 77 K of
acetone extracts from wild-type (dashed line)
and mutant (black line) plants. Spectra were
normalized to the intensity at 670 nm. The arrow
indicates the position of the protochlorophyllide.
(e) Fv/Fm, Variable Fluorescence/Maximum Fluorescence (the efficiency of photosystem II, PS II).
(f) qP (photochemical quenching) were measured in wild-type and crb plants grown over long
days for 3 weeks on 1% sucrose. The experiment
was repeated twice. The results are shown
together with the standard error.
(g) Chlorophyll fluorescence emission spectra at
77 K of crude membrane extracts from wild-type
(dashed line) and mutant (black line) plants.
Spectra were normalized to the intensity at
730 nm. The fluorescence bands for PSII and
PSI complexes in the wild-type spectrum peak at
683 and 730 nm, respectively. In the mutant
spectrum the PSII peak is blue shifted by
3.5 nm, and the PSI peak is blue-shifted by
4.5 nm. All the experiments were repeated at
least three times.
of CCA1 in crb-1 plants. The timing of flowering is one of
the most important physiologic processes under the
control of the clock. Figure 6b shows that in long-day
conditions, crb-1 plants flower earlier than their wild-type
counterparts.
Hypocotyl growth is not affected in the CRB mutant plants
The part of phytochrome, the red-light receptor, that
recognizes light is a tetrapyrrolic chromophore called phytochromobilin (PB), which is synthesized in the chloroplasts.
Given the abnormal phenotype of the chloroplasts in the crb
plants, it is possible that there is substantially less PB being
synthesized in these mutants. As phytochrome is one of the
main photoreceptors for the circadian system, it is thus
possible that the effects of the mutations in CRB on the
circadian system are a result of changes in the levels of
spectroscopically active phytochrome.
Inhibition of hypocotyl growth is frequently used to
demonstrate defects in light receptors, including phytochrome. We therefore examined whether hypocotyl growth
is affected in the crb plants. Figure 6c shows that, as
expected, there is a substantial increase in hypocotyl length
of the phytochrome B mutants (phyB) in white and red light,
but not in the dark. However, crb-1 hypocotyl length is not
significantly different from wild type under any of the light
conditions used, suggesting that phytochrome levels are
normal in crb plants.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
556 Miriam Hassidim et al.
Figure 4. Chloroplasts in wild-type and crb-1 plants. Wild-type and crb-1
plants were grown over long days on 1% sucrose for 3 weeks. Chloroplasts
were visualized by electron microscopy. Scale bars: a and b, 10 000 nm; c and
d, 1000 nm; e and f, 200 nm.
Mutations in other nuclear genes encoding chloroplast
proteins also affect circadian oscillations of CCA1
In order to determine whether the effect of crb-1 and crb-2 on
the circadian system was specific to CRB, or might be a more
general result of damage to the chloroplast, we examined
the effect of mutations in several nuclear genes known to
encode chloroplast proteins that are involved in retrograde
signaling.
One of the mutants we examined was in STN7, a Ser:Thr
kinase that has been shown to phosphorylate the major light
harvesting complex, LHCII (Bellafiore et al., 2005). The
phosphorylation of LHCII controls its partitioning between
PSI and PSII and is regulated by the redox state of the
plastoquinone pool. STN7 has also been shown to be
involved in retrograde signaling in Arabidopsis (Bonardi
et al., 2005). The expression of STN7 itself is under circadian
control with a peak of transcript accumulation around dawn
(Figure 7a). Figure 7b shows that mutating STN7 affects the
circadian pattern of CCA1 expression in continuous light,
with a greater amplitude of CCA1 expression in stn7 than in
wild type and a delay in returning to trough levels. However,
the effect of the mutation in STN7 on the expression of CCA1
is not as pronounced as in the crb-1 mutant (Figure 5a,b).
Figure 5. Circadian gene expression in wild-type and crb-1 plants. Wild-type
and crb-1 plants were transferred to constant light after entrainment over long
days.
(a) The levels of CCA1 mRNA were determined by Northern analysis (shown
above the graph) and plotted on a graph relative to the maximum levels of
expression. Aliquots of 1.5 lg of each RNA sample were also run on an
agarose gel to check for quality and verify quantitation (shown below the
graph). The accumulation of (b) CCA1, (c) LHY, (d) LHCB, and (e) ATGRP7
mRNA was determined by quantitative real-time PCR compared with a tubulin
(TUB) control. The yellow and grey-hatched bars represent subjective light
and dark periods respectively.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
Circadian regulation and the chloroplast 557
role biosynthesis by inserting Mg2+ into the protoporphyrin
ring to generate Mg-protoporphyrinIX. Mutations in GUN5
have been used to demonstrate that Mg-protoporphyrin is
involved in retrograde signaling from the plastid (Mochizuki
et al., 2001). Figure 7d shows that, under the conditions we
used, there appears to be no significant difference in CCA1
oscillations in the GUN5 mutant, suggesting that the circadian system may not be affected in GUN5 as it is in CRB and
STN7 mutants.
We also examined the effect on CCA1 rhythmicity of a
mutation in the GUN1 gene. Although the molecular identity
of GUN1 has not yet been reported, it has been suggested
that GUN1 has a role in both the Mg-protoporphyrin
pathway and a plastid protein synthesis signaling pathway
(Gray et al., 2003; Richly et al., 2003). In gun1 plants the
amplitude of CCA1 transcript accumulation is significantly
increased (Figure 7e). Thus, at least one of the retrograde
signaling pathways mediated by GUN1 appears to be
involved in regulating the circadian system.
Discussion
CHLOROPLAST RNA BINDING
Figure 6. Regulation of diurnal CCA1 gene expression, flowering time, and
inhibition of hypocotyl growth in wild-type and crb-1 plants.
(a) Wild-type and crb-1 plants were grown in long-day conditions. The levels
of CCA1 mRNA were determined by Northern analysis (shown above the
graph) and plotted on a graph relative to the maximum levels of expression.
Aliquots of 1.5 lg from each RNA sample were also run on an agarose gel to
check for quality and verify quantitation (shown below the graph). The black
bars and yellow bars represent dark and light photoperiods.
(b) Flowering time in wild-type and crb-1 plants. Seeds of wild-type and crb-1
plants were sown onto soil. Plants were grown in long (14-h light:10-h dark)
photoperiods. The numbers of rosette leaves at bolting were counted. The
average flowering time for each line is shown together with the standard
error. **Significant difference in comparison with wild type (unpaired
Student’s t-test, P < 0.01). Sample sizes are given within bars.
(c) Hypocotyl growth in wild-type, crb-1, and phyB. Seedlings were grown in
the dark or in red or white light. After 8 days, hypocotyl length was measured
for each seedling and the average was plotted on a graph along with the
standard error.
Figure 7c shows that flowering is also earlier in stn7
compared with wild type.
Another nuclear-encoded chloroplast protein, GUN5, was
originally isolated in a screen to find regulators of plastid
signaling to the nucleus. GUN5 encodes the H-subunit of
Mg-chelatase (Mochizuki et al., 2001). Mg-chelatase catalyses the first reaction in the chlorophyll branch of tetrapyr-
In a screen for genes encoding RNA-binding proteins that
have a role in regulating the circadian system, we identified
a gene we called CRB. CRB has an approximately 84% amino
acid similarity to the Chlamydomonas reinhardtii protein,
RAP38 (Yamaguchi et al., 2003). In Chlamydomonas, RAP38
has been found to co-purify with the 70S chloroplast ribosome (Yamaguchi et al., 2003), and is probably part of a
complex that includes the homologous protein, RAP41. In
spinach the RAP41 ortholog, CSP41a, is an RNA-binding
protein that functions as an endoribonuclease mediating the
degradation of several chloroplast-encoded transcripts
(Bollenbach et al., 2003; Yang and Stern, 1997; Yang et al.,
1996). Although a function has not yet been demonstrated
for either CRB or its spinach ortholog, CSP41b, two independent proteomic studies have suggested that CRB protein
is located in the chloroplast (Kleffmann et al., 2004;
Ytterberg et al., 2006). Thus, it is possible that CRB has a role
in transcript regulation in the chloroplast.
The role of CRB in the chloroplast
CRB T-DNA insertion mutants show marked defects in several aspects of chloroplast structure and function. In crb
plants, chlorophyll accumulation is impaired and chloroplast structure is altered (Figures 3c and 4). The maximum
quantum yield of PSII (Fv/Fm) is significantly reduced in both
crb-1 and crb-2 plants (Figure 3e). The lower Fv/Fm ratios, the
shift in the peak position of photosystems in 77-K emission
spectra, and the extensive stacking of thylakoid membranes
all suggest a higher light-harvesting antenna to reaction
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
558 Miriam Hassidim et al.
Figure 7. Circadian rhythms and flowering time in wild-type, stn7, gun5, and gun1 plants.
(a) Wild-type plants were transferred to constant light after entrainment over long days. The levels of STN7 RNA were determined by quantitative real-time PCR and
were plotted on a graph relative to the maximum levels of expression.
(b) Wild-type and stn7 plants were transferred to constant light after entrainment over long days. The levels of CCA1 mRNA were determined by Northern analysis
(shown above the graph) and plotted on a graph relative to the maximum levels of expression. Aliquots of 1.5 lg of each RNA sample were also run on an agarose
gel to check for quality and to verify quantitation (shown below the graph).
(c) Flowering time in wild-type and stn7 plants was measured as described in Figure 6b. The average flowering time for each line is shown together with the standard
error. **Significant difference in comparison with wild type (unpaired Student’s t-test, P < 0.01). Sample sizes are given within bars. (d and e) Wild-type, gun5, and
gun1 plants were transferred to constant light after entrainment over long days. The levels of CCA1 mRNA were determined by quantitative real-time PCR and
compared with a tubulin (TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively.
center ratio in the crb plants. Consistent with the observed
effects of mutations in CRB on the chloroplasts and photosynthesis, crb plants are significantly smaller and paler than
wild-type plants (Figure 3a,b).
The effect of CRB mutations on the circadian system
We have shown here that, in addition to regulating
chloroplast function, mutations in CRB affect the circadian
system. Under constant light conditions, the amplitude of
expression of CCA1 and LHY is increased in the crb-1 and
crb-2 plants (Figures 5a–c and S1a,b). Furthermore, the
timing of the increases and decreases in CCA1 and LHY
mRNA accumulation is altered. However, period length
appears to be unchanged in the mutant plants. Not surprisingly, given the changes in oscillator gene expression,
the regulation of the two output genes examined, LHCB
and ATGRP7, is also affected in crb plants. Interestingly,
levels of LHCB are higher in the crb-1 plants compared with
wild-type plants, whereas levels of ATGRP7 are partially
repressed. These observations are consistent with previous
findings that high levels of CCA1 cause a damping of
ATGRP7 expression and an increase in LHCB expression
(Wang and Tobin, 1998).
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
Circadian regulation and the chloroplast 559
One of the most important physiological processes under
the control of the circadian oscillator, the regulation of
flowering time via the photoperiodic pathway (Salome and
McClung, 2004), is also slightly but significantly altered in
CRB mutant plants (Figure 6b). However, we did not find
significant differences in the circadian rhythms of expression of the main photoperiodic flowering induction gene
CONSTANS (CO; Suarez-Lopez et al., 2001) that could
explain the earlier flower time phenotype observed (Figure S2). Our failure to detect significant changes in CO may
result from the fact that crb plants only show a small
difference in flowering time (approximately 2.5 leaves earlier
than wild type over long days). Alternatively, flowering in
the crb plants might be affected by one of the nonphotoperiodic pathways that regulate reproductive development (Putterill et al., 2004).
Interactions between the chloroplast and the circadian
system
The mechanisms by which the state of the chloroplast in the
CRB mutants can affect the circadian system are unclear.
One possible explanation might be that levels of the phytochrome chromophore, PB, which is synthesized in the
chloroplast, may be altered. As phytochrome is a major light
receptor for the circadian system in plants, a lack of phytochrome can modulate circadian rhythms (Somers et al.,
1998). Furthermore, it has been shown that mutations in the
nuclear-encoded chloroplast genes, GUN2/HY1 and GUN3/
HY2, which regulate PB biosynthesis, not only disrupt the
coordination of nuclear and chloroplast gene expression
(Susek et al., 1993), but can also affect circadian rhythms in
red light (Millar et al., 1995). However, we found that our
mutations in CRB do not affect hypocotyl elongation in either
white or red light (Figure 6c). By contrast, HY mutations
show increased hypocotyl elongation in white and red light.
Thus, our results suggest that the levels of spectroscopically
active phytochrome in crb plants are probably not significantly different from wild type. Therefore, it seems likely that
the state of the chloroplasts in crb plants is affecting the
circadian system via pathways that do not involve altered PB
biosynthesis.
Previous work by many other groups has shown that there
are a number of other ways by which the functional state of
the chloroplast may influence nuclear gene expression.
These include signals generated by changes in intermediates of the chlorophyll biosynthesis (Strand et al., 2003),
plastid proteins (reviewed in Nott et al., 2006), sugar status
(reviewed in Rolland et al., 2002), and ROS (Vandenabeele
et al., 2004), and changes in the redox state of the components of the photosynthetic transport system (Pfannschmidt
et al., 2001). Our results show that the mutations in the CRB
gene have pleiotropic effects on the chloroplast, including
lowering qP, changing the quantum yield of PSII, and in
altering the accumulation of chlorophyll and its precursor,
protochlorophyllide. Thus, although the circadian oscillator
is clearly affected in crb plants, determining the pathway(s)
by which CRB affects the circadian oscillator will require
further work.
In order to start to define the pathway(s) by which the
chloroplast may affect the circadian oscillator, we examined
the result of mutations in several nuclear genes encoding
chloroplast proteins known to be involved in retrograde
signaling. As our results show, both stn7 and gun1 plants,
like crb plants, have altered circadian rhythms. The retrograde signaling pathways regulated by STN7 and GUN1
include the redox, Mg-protoporphyrin pathway and plastid
protein synthesis-dependent pathways, suggesting that
these might be involved in chloroplast regulation of the
circadian system.
The finding that the circadian system is sensitive to the
state of the chloroplast is consistent with the important role
of the circadian oscillator in controlling the expression of
chloroplast genes. Microarrays have shown that a number of
nuclear-encoded chloroplast genes are under the control
of the circadian oscillator (Edwards et al., 2006; Harmer
et al., 2000; Schaffer et al., 2001). As optimizing the conditions for photosynthesis is of major importance for plants, it
is to the plant’s advantage to make sure that the oscillator is
entrained so that it activates the expression of nuclearencoded chloroplast genes at the most appropriate time of
day. Our results show that the state of the chloroplast affects
the circadian system, and suggest that this may be a further
means by which the plant ensures the correct temporal
expression of genes that encode proteins that are directed to
the chloroplast.
Conclusion
In conclusion, we have shown that mutations in genes that
regulate chloroplast functions result in altered circadian
rhythms. Our results are consistent with the idea that the
chloroplasts and the circadian system interact to ensure the
fine-tuning and close regulation of nuclear-encoded
chloroplast genes. In the future it will be interesting to
examine how mutations in other nuclear-encoded chloroplast genes with different functions affect the circadian
oscillator, and thus to determine not only how specific the
effects of mutations in CRB, GUN1, and STN7 are in regulating the circadian system, but also the mechanism(s) by
which chloroplasts can affect the circadian system.
Experimental procedures
Plant materials and growth
Arabidopsis thaliana (L.) ecotype Columbia (Col-0) was used for all
experiments. We obtained T-DNA insertion lines in the Columbia
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
560 Miriam Hassidim et al.
background for CRB (At1g09340; SALK_107566 and SALK_021748)
and STN7 (At1 g68830; SALK_072531) from the SALK institute
(Alonso et al., 2003). gun5 and gun1-1 seeds were provided by Prof.
J. Chory, Salk Institute, San Diego, CA. All seeds were imbibed and
cold-treated at 4C for 4 days before germination. Plants were either
grown in Petri dishes on Murashige and Skoog medium from
Duchefa Biochemie (http://www.duchefa.com) supplemented with
1% sucrose (w/v) or grown on soil. Plants for constant light
experiments were grown under 14-h light (125 lE m)2 s)1):10-h
dark cycles for 18 days before being transferred to constant light
(125 lE m)2 s)1) at 23C. Plants for experiments in light:dark photoperiods were grown under 14-h light (125 lE m)2 s)1):10-h dark
cycles. Philips fluorescent lights (TLD18 W/29 and TLD18 W/33CW)
provided lighting for plant growth. Hypocotyl measurements were
made on 7-day-old seedlings grown in constant light conditions
(white light, 125 lE m)2 s)1, or red light, 5 lE m)2 s)1, and in the
dark). At least 10 seedlings were measured for each sample.
Flowering time measurements
Arabidopsis plants were grown on soil in 105 · 155 · 55-mm
pots. The time of flowering was determined as the day when the
plant had a bolt of 10 mm, and the number of rosette leaves was
counted.
RNA analysis
RNA extraction and Northern analysis were carried out as previously
described (Green and Tobin, 1999). The results were confirmed by
repeating the experiments at least once and with verification by
quantitative real-time PCR (Rotagene (http://www.corbettlife
science.com), performed according to the manufacturer’s instructions using tubulin as a control). The primers used to make RNA
probes for the Northern analyses were as follows: CCA1 forward,
GTTGCAGCTGCTAGTGCTTG; CCA1 reverse, TGTAATACGACTCACTATAGGGAAGATCGAGCCTTTGATGC; CRB probe 1 forward,
GAGGATGCAGTTGATCCGAAG; CRB probe 1 reverse, TGTAATAC
GACTCACTATAGGGCAGAGTTTGGAACCGGGATT; CRB probe 2
forward, ATTTCTTTGCATCGGTGGAG; CRB probe 2 reverse,
TGTAATACGACTCACTATAGGGTTCTTGCTCAGAATCATGTCG.
The primers for quantitative real-time PCR were as follows: CCA1
forward, TCCAGATAAGAAGTCACGCTCA; CCA1 reverse, TCTAGCGCTTGACCCATAGC; CRB forward, CGGTTCCAAACTCTGGGATA; CRB reverse, TCGTTACCAAGCACGTTGAG; STN7 forward,
GCACGAGGCTCCACTAGTTT; STN7 reverse, CATTGGCCTCATCTTCCTTC; TUB forward, GGTTGAGCCTTACAACGCTACTCT; TUB
reverse, GTGGTTCAAATCACCAAAGCTGGG; ATGRP7 forward,
TGGTGGTGGAGGATGGTAAT; ATGRP7 reverse, CAAAATAGAGAACACACAAAACCAAG; LHCB forward, AACCTTCAACGGCTCCCATCAA; LHCB reverse, AGAGGCAGTTTGGTTCAAGGCT; LHY
forward, GCTAAGGCAAGAAAGCCATA; LHY reverse, TGCCAAGCTCTTCCATAAAG; CO forward, ATATGGCTCCTCAGGGACTCACTA;
CO reverse, ACTCCGGCACAACACCAGTTT.
Electron microscopy
A slightly modified method of Asakura et al. (2004) was used.
Briefly, leaves were cut in 5% glutaraldehyde in 0.1 M cacodylate
buffer, pH 5.5, vacuum-treated for 15 min and fixed overnight at
4C. After three washes in 0.1 M cacodylate buffer the tissue was
post-fixed with 2% osmium tetroxide in the presence of 1.5%
potassium ferricyanide for 2 h. The fixed samples were dehydra-
ted in ethanol and embedded in Epon resin. Ultra-thin sections cut
by an LKB Bromma 8800 ultrotome were stained with uranyl
acetate and lead citrate. Micrographs were taken with Tecnai 12
electron microscope (Phillips, http://www.philips.com) equipped
with a Megaview II CCD camera and an ANALYSIS 3.0 (Soft Imaging System, http://www.soft-imaging.net).
Chlorophyll extraction and quantification
Plants were weighed and 15–20 mg of the mature leaves were
ground with a mortar and pestle in 80% (v/v) acetone and sand. After
a brief centrifugation the chlorophyll was re-extracted from the
pellet. Absorbances of the combined supernatants at 645 and
663 nm were measured and the chlorophyll content was calculated
using the following formulas: lg chlorophyll a ml)1 = 12.7 · A663 –
2.7 · A645; lg chlorophyll b ml)1 = 22.9 · A645 – 4.7 · A663. Measurements were made on six plants for each of the wild-type and
mutant lines. The experiment was repeated three times with
essentially similar results.
Fluorescence measurements
Fluorescence induction kinetics at room temperature (25C) were
measured using a pulse amplitude modulation fluorimeter PAM101
(Walz, http://www.walz.com). qP (photochemical quenching) was
calculated according to the method of Maxwell and Johnson
(Maxwell and Johnson, 2000). Fluorescence emission spectra at
77 K were measured using a Fluomax-3 spectrofluorometer (Jobin
Ivon, Longjumaeu, France). The excitation wavelength was set at
430 nm. Measurements were performed on homogenized plant
material or on acetone-extracted tissue.
Acknowledgements
This work was supported by ISF grants (0397232 and 0397386) and
an Enrico Berman Fund grant (0347865). We would like to thank
Prof. J. Chory and Dr A. Nott for their generous gift of the gun
mutant seeds, Prof. Y. Ohad for allowing us the use of his equipment for making the fluorescence measurements, Prof. N. Reinhold
for her insight and comments on the project and Maria Belitcky for
her excellent technical assistance.
Supplementary material
The following supplementary material is available for this article
online:
Figure S1. Circadian gene expression in wild-type and crb-2 plants.
Wild-type and crb-2 plants were transferred to constant light after
entrainment over long days. The accumulation of (a) CCA1, (b) LHY,
and (c) Lhcb mRNA was determined by quantitative real-time
PCR compared with a tubulin (TUB) control. The yellow and
grey-hatched bars represent subjective light and dark periods
respectively.
Figure S2. CO transcript accumulation in wild-type and crb-1 plants.
Wild-type and crb-1 plants were transferred to constant light after
entrainment over long days. The accumulation of CO mRNA was
determined by quantitative real-time PCR compared with a tubulin
(TUB) control. The yellow and grey-hatched bars represent subjective light and dark periods respectively.
This material is available as part of the online article from http://
www.blackwell-synergy.com.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
Circadian regulation and the chloroplast 561
References
Alabadi, D., Oyama, T., Yanovsky, M.J., Harmon, F.G., Mas, P. and
Kay, S.A. (2001) Reciprocal regulation between TOC1 and LHY/
CCA1 within the Arabidopsis circadian clock. Science, 293, 880–
883.
Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genomewide insertional mutagenesis of Arabidopsis thaliana. Science,
301, 653–657.
Asakura, Y., Hirohashi, T., Kikuchi, S., Belcher, S., Osborne, E.,
Yano, S., Terashima, I., Barkan, A. and Nakai, M. (2004) Maize
mutants lacking chloroplast FtsY exhibit pleiotropic defects in the
biogenesis of thylakoid membranes. Plant Cell, 16, 201–214.
Barak, S., Tobin, E.M., Andronis, C., Sugano, S. and Green, R.M.
(2000) All in good time: the Arabidopsis circadian clock. Trends
Plant Sci. 5, 517–522.
Bellafiore, S., Barneche, F., Peltier, G. and Rochaix, J.D. (2005) State
transitions and light adaptation require chloroplast thylakoid
protein kinase STN7. Nature, 433, 892–895.
Biehl, A., Richly, E., Noutsos, C., Salamini, F. and Leister, D. (2005)
Analysis of 101 nuclear transcriptomes reveals 23 distinct regulons and their relationship to metabolism, chromosomal gene
distribution and co-ordination of nuclear and plastid gene
expression. Gene, 344, 33–41.
Bollenbach, T.J., Tatman, D.A. and Stern, D.B. (2003) CSP41a, a
multifunctional RNA-binding protein, initiates mRNA turnover in
tobacco chloroplasts. Plant J. 36, 842–852.
Bonardi, V., Pesaresi, P., Becker, T., Schleiff, E., Wagner, R.,
Pfannschmidt, T., Jahns, P. and Leister, D. (2005) Photosystem II
core phosphorylation and photosynthetic acclimation require two
different protein kinases. Nature, 437, 1179–1182.
Dodd, A.N., Salathia, N., Hall, A., Kevei, E., Toth, R., Nagy, F.,
Hibberd, J.M., Millar, A.J. and Webb, A.A. (2005) Plant circadian
clocks increase photosynthesis, growth, survival, and competitive advantage. Science, 309, 630–633.
Dyall, S.D., Brown, M.T. and Johnson, P.J. (2004) Ancient invasions:
from endosymbionts to organelles. Science, 304, 253–257.
Edwards, K.D., Lynn, J.R., Gyula, P., Nagy, F. and Millar, A.J. (2005)
Natural allelic variation in the temperature-compensation mechanisms of the Arabidopsis thaliana circadian clock. Genetics, 170,
387–400.
Edwards, K.D., Anderson, P.E., Hall, A., Salathia, N.S., Locke, J.C.,
Lynn, J.R., Straume, M., Smith, J.Q. and Millar, A.J. (2006)
FLOWERING LOCUS C mediates natural variation in the hightemperature response of the Arabidopsis circadian clock. Plant
Cell, 18, 639–650.
Gould, P.D., Locke, J.C., Larue, C. et al. (2006) The molecular basis
of temperature compensation in the Arabidopsis circadian clock.
Plant Cell, 18, 1177–1187.
Gray, J.C., Sullivan, J.A., Wang, J.H., Jerome, C.A. and MacLean, D.
(2003) Coordination of plastid and nuclear gene expression. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, 135–144; discussion 144135.
Green, R.M. and Tobin, E.M. (1999) Loss of the circadian
clock-associated protein 1 in Arabidopsis results in altered clockregulated gene expression. Proc. Natl Acad. Sci. U S A 96, 4176–
4179.
Green, R.M., Tingay, S., Wang, Z.Y. and Tobin, E.M. (2002) Circadian
rhythms confer a higher level of fitness to Arabidopsis plants.
Plant Physiol. 129, 576–584.
Harmer, S.L., Hogenesch, J.B., Straume, M., Chang, H.S., Han, B.,
Zhu, T., Wang, X., Kreps, J.A. and Kay, S.A. (2000) Orchestrated
transcription of key pathways in Arabidopsis by the circadian
clock. Science, 290, 2110–2113.
Heintzen, C., Nater, M., Apel, K. and Staiger, D. (1997) AtGRP7, a
nuclear RNA-binding protein as a component of a circadianregulated negative feedback loop in Arabidopsis thaliana. Proc.
Natl Acad. Sci. U S A 94, 8515–8520.
Karpinski, S., Reynolds, H., Karpinska, B., Wingsle, G., Creissen, G.
and Mullineaux, P. (1999) Systemic signaling and acclimation in
response to excess excitation energy in Arabidopsis. Science,
284, 654–657.
Kleffmann, T., Russenberger, D., von Zychlinski, A., Christopher,
W., Sjolander, K., Gruissem, W. and Baginsky, S. (2004) The
Arabidopsis thaliana chloroplast proteome reveals pathway
abundance and novel protein functions. Curr. Biol. 14, 354–362.
Koussevitzky, S., Nott, A., Mockler, T.C., Hong, F., SachettoMartins, G., Surpin, M., Lim, J., Mittler, R. and Chory, J. (2007)
Signals from chloroplasts converge to regulate nuclear gene
expression. Science, 316, 715–719.
Leister, D. (2005) Genomics-based dissection of the cross-talk of
chloroplasts with the nucleus and mitochondria in Arabidopsis.
Gene, 354, 110–116.
Locke, J.C., Millar, A.J. and Turner, M.S. (2005) Modelling genetic networks with noisy and varied experimental data: the
circadian clock in Arabidopsis thaliana. J. Theor. Biol. 234, 383–
393.
Makino, S., Matsushika, A., Kojima, M., Yamashino, T. and Mizuno,
T. (2002) The APRR1/TOC1 quintet implicated in circadian
rhythms of Arabidopsis thaliana: I. Characterization with APRR1overexpressing plants. Plant Cell Physiol. 43, 58–69.
Martin, W., Rujan, T., Richly, E., Hansen, A., Cornelsen, S., Lins, T.,
Leister, D., Stoebe, B., Hasegawa, M. and Penny, D. (2002) Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast
genomes reveals plastid phylogeny and thousands of cyanobacterial genes in the nucleus. Proc. Natl Acad. Sci. U S A 99,
12246–12251.
Maxwell, K. and Johnson, G.N. (2000) Chlorophyll fluorescence – a
practical guide. J. Exp. Bot. 51, 659–668.
Michael, T.P. and McClung, C.R. (2003) Enhancer trapping reveals
widespread circadian clock transcriptional control in Arabidopsis.
Plant Physiol. 132, 629–639.
Millar, A.J., Straume, M., Chory, J., Chua, N.H. and Kay, S.A. (1995)
The regulation of circadian period by phototransduction pathways in Arabidopsis. Science, 267, 1163–1166.
Mochizuki, N., Brusslan, J.A., Larkin, R., Nagatani, A. and Chory, J.
(2001) Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals
the involvement of Mg-chelatase H subunit in plastid-to-nucleus
signal transduction. Proc. Natl Acad. Sci. U S A 98, 2053–2058.
Nott, A., Jung, H.S., Koussevitzky, S. and Chory, J. (2006) Plastidto-nucleus retrograde signaling. Annu. Rev. Plant Biol. 57, 739–
759.
Pfannschmidt, T., Schutze, K., Brost, M. and Oelmuller, R. (2001) A
novel mechanism of nuclear photosynthesis gene regulation by
redox signals from the chloroplast during photosystem stoichiometry adjustment. J. Biol. Chem. 276, 36125–36130.
Putterill, J., Laurie, R. and Macknight, R. (2004) It’s time to
flower: the genetic control of flowering time. Bioessays, 26,
363–373.
Richly, E. and Leister, D. (2004) An improved prediction of chloroplast proteins reveals diversities and commonalities in the
chloroplast proteomes of Arabidopsis and rice. Gene, 329, 11–16.
Richly, E., Dietzmann, A., Biehl, A., Kurth, J., Laloi, C., Apel, K.,
Salamini, F. and Leister, D. (2003) Covariations in the nuclear
chloroplast transcriptome reveal a regulatory master-switch.
EMBO Rep. 4, 491–498.
Rolland, F., Moore, B. and Sheen, J. (2002) Sugar sensing and signalling in plants. Plant Cell, 14, S185–S205.
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562
562 Miriam Hassidim et al.
Salome, P.A. and McClung, C.R. (2004) The Arabidopsis thaliana
clock. J. Biol. Rhythms 19, 425–435.
Salome, P.A. and McClung, C.R. (2005) PSEUDO-RESPONSE
REGULATOR 7 and 9 are partially redundant genes essential for
the temperature responsiveness of the Arabidopsis circadian
clock. Plant Cell, 17, 791–803.
Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J., Carre,
I.A. and Coupland, G. (1998) The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell, 93, 1219–1229.
Schaffer, R., Landgraf, J., Accerbi, M., Simon, V., Larson, M.
and Wisman, E. (2001) Microarray analysis of diurnal and
circadian-regulated genes in Arabidopsis. Plant Cell, 13, 113–
123.
Somers, D.E., Devlin, P.F. and Kay, S.A. (1998) Phytochromes and
cryptochromes in the entrainment of the Arabidopsis circadian
clock. Science, 282, 1488–1490.
Strand, A., Asami, T., Alonso, J., Ecker, J.R. and Chory, J. (2003)
Chloroplast to nucleus communication triggered by accumulation of Mg-protoporphyrinIX. Nature, 421, 79–83.
Strayer, C., Oyama, T., Schultz, T.F., Raman, R., Somers, D.E., Mas,
P., Panda, S., Kreps, J.A. and Kay, S.A. (2000) Cloning of the
Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science, 289, 768–771.
Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F.
and Coupland, G. (2001) CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature,
410, 1116–1120.
Susek, R.E., Ausubel, F.M. and Chory, J. (1993) Signal transduction
mutants of Arabidopsis uncouple nuclear CAB and RBCS gene
expression from chloroplast development. Cell, 74, 787–799.
Vandenabeele, S., Vanderauwera, S., Vuylsteke, M., Rombauts, S.,
Langebartels, C., Seidlitz, H., Zabeau, M., van Montagu, M.,
Inze, D. and Van Breusegem, F. (2004) Catalase deficiency
drastically affects gene expression induced by high light in
Arabidopsis thaliana. Plant J. 31, 45–58.
Wang, Z.Y. and Tobin, E.M. (1998) Constitutive expression of the
CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell, 93, 1207–
1217.
Yamaguchi, K., Beligni, M.V., Prieto, S., Haynes, P.A., McDonald,
W.H., Yates, J.R. 3rd and Mayfield, S.P. (2003) Proteomic characterization of the Chlamydomonas reinhardtii chloroplast ribosome. Identification of proteins unique to the 70 S ribosome.
J. Biol. Chem. 278, 33774–33785.
Yang, J. and Stern, D.B. (1997) The spinach chloroplast endoribonuclease CSP41 cleaves the 3¢-untranslated region of petD mRNA
primarily within its terminal stem-loop structure. J. Biol. Chem.
272, 12874–12880.
Yang, J., Schuster, G. and Stern, D.B. (1996) CSP41, a sequencespecific chloroplast mRNA binding protein, is an endoribonuclease. Plant Cell, 8, 1409–1420.
Ytterberg, A.J., Peltier, J.B. and van Wijk, K.J. (2006) Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes.
Plant Physiol. 140, 984–997.
Note added in proof
GUN1 has recently been reported to be a chloroplast-localized
pentatricopeptide-repeat protein (Koussevitzky et al., 2007).
ª 2007 The Authors
Journal compilation ª 2007 Blackwell Publishing Ltd, The Plant Journal, (2007), 51, 551–562