BIOLOGY OF REPRODUCTION 55, 1315-1324 (1996)
Meiotic Abnormalities of c-mos Knockout Mouse Oocytes: Activation after First
Meiosis or Entrance into Third Meiotic Metaphase
Kazushi Araki, 3 Kunihiko Naito, 2,3 Seiki Haraguchi, 3 Rika Suzuki, 4 Minesuke Yokoyama, 4 Maki Inoue, 3
Shinichi Aizawa, 5 Yutaka Toyoda, 6 and Eimei Sato 3
Department of Reproductive and Developmental Biology,3 Institute of Medical Science, The University of Tokyo,
Minato-ku, Tokyo 108, Japan
Mitsubishi Kasei Institute of Life Sciences, 4 Machida-shi, Tokyo 194, Japan
Laboratory of Morphogenesis,5 Institute of Molecular Embryology and Genetics, Kumamoto University School of
Medicine, Kumamoto 860, Japan
Research Center for Protozoan Molecular Immunology, 6 Obihiro University of Agriculture and Veterinary Medicine,
Obihiro, Hokkaido 080, Japan
ABSTRACT
In Xenopus oocytes, Mos activates the mitogen-activated protein kinase (MAPK) signal transduction cascade and regulates
meiosis. In mammalian oocytes, however, the functions of Mos
are still unclear. In the present study, we used c-mos knockout
mouse oocytes and examined the roles of Mos in mouse oocyte
maturation and fertilization, including whether Mos controls
MAPK and maturation promoting factor (MPF) activity. The kinetics of germinal vesicle breakdown (GVBD) and the first polar
body emission were similar in wild-type, heterozygous mutant,
and homozygous mutant mice. Activities of MPF were also not
significantly different among the three genotypes until the first
polar body emission. In contrast, MAPK activity in c-mos knockout oocytes did not significantly fluctuate throughout maturation, and the oocytes had abnormal diffused spindles and loosely
condensed chromosomes, although a clear increase in MAPK
activities was observed after GVBD in wild-type and heterozygous mutant oocytes that had normal spindles and chromosomes. After the first polar body emission, 38% of c-mos knockout oocytes formed a pronucleus instead of undergoing second
meiosis, indicating the crucial role of Mos in MPF reactivation
after first meiosis. When oocytes that reached second metaphase were fertilized or stimulated by ethanol, many c-mos
knockout oocytes emitted a second polar body and progressed
into third meiotic metaphase instead of interphase, although all
fertilized or activated oocytes in the heterozygote progressed to
interphase, indicating that Mos deletion leads to compensatory
factors that might not be degraded after fertilization or parthenogenetic activation. These results suggest that Mos is located
upstream of MAPK in mouse oocytes as in Xenopus oocytes but
is independent of MPF activity, and that Mos/MAPK is not necessary for GVBD and first polar body emission. Our results also
suggest that Mos plays a crucial role in normal spindle and chromosome morphology and the reactivation of MPF after first meiosis.
INTRODUCTION
In Xenopus oocytes, the c-mos proto-oncogene product
(Mos) is required for activation of the maturation promoting factor (MPF) in G2 arrested oocytes [1, 2], for reactivation of MPF after metaphase I, for transition to metaAccepted July 31, 1996.
Received May 21, 1996.
'Financial support: Grant-in-aid for scientific research (08660340)
from the Ministry of Education, Science, Sports and Culture of Japan.
2Correspondence: Kunihiko Naito, Department of Reproductive and
Developmental Biology, Institute of Medical Science, The University of
Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan. FAX: (+81)-35449-5455.
phase II without DNA replication [3, 4], and for maintaining high MPF activity in metaphase II oocytes [5]. Mos has
a serine-threonine kinase domain [6]. In Xenopus oocytes,
Mos activates mitogen-activated protein kinase (MAPK) kinase by direct phosphorylation, and subsequently activates
MAPK [7-10]. It has been shown that the above-mentioned
Mos functions in Xenopus oocytes are mediated by MAPK
activity [11, 12].
In contrast, the function of Mos in mouse oocytes is
unclear, although Mos has been thought to play important
roles in oocyte maturation because of the exclusive transcription in oocytes [13-15]. When anti-Mos antibody or
antisense oligonucleotide was microinjected into immature
mouse oocytes, various results were reported, such as the
inhibition of germinal vesicle breakdown (GVBD) [16], the
normal induction of GVBD but the inhibition of first polar
body emission [17, 18], and the normal induction of first
polar body emission but entrance into interphase instead of
second meiosis [19,20]. Recently c-mos knockout mice
were generated by homologous recombination in embryonic stem cells [21, 22]. These mutant mice have truncated
Mos that has no kinase activity. Oocytes obtained from the
c-mos knockout mice have been reported to undergo GVBD
and mature normally with a frequent spontaneous parthenogenic activation, indicating that that Mos is not essential
for oocyte maturation in the mouse [21, 22]. Recently, Mos
has been shown to be required for MAPK activation and
to be involved in microtubule organization during meiotic
maturation in the mouse [23].
In the present study, we used c-mos knockout mouse
oocytes and examined the roles of Mos in mouse oocyte
maturation and fertilization in more detail, including whether Mos controls MAPK and MPF activity. Our data indicate
that Mos is located upstream of MAPK in mouse oocytes
as in Xenopus oocytes, but is independent of MPF activity,
and that Mos/MAPK is not necessary for GVBD and first
polar body emission but is required for normal spindle and
chromosome morphology. Our results also suggest that Mos
plays a crucial role in the reactivation of MPF after first
meiosis, and that Mos deletion produces compensatory factors that might not degrade after fertilization and therefore
prevent the oocytes from escaping meiosis.
MATERIALS AND METHODS
Animals
The c-mos-deficient mice were produced by homologous
recombination in TT2 embryonic stem cells [21]. Male and
1315
1316
ARAKI ET AL.
female heterozygous mice were mated; their pups were analyzed for their genotypes by polymerase chain reaction
(PCR) using whole blood without any purification according to the method of Mercier et al. [24], with several modifications. Briefly, 0.5 I of whole blood was added to a
50-R1I final volume of PCR buffer (10 mM Tris-HCI [pH
8.3], 50 mM KCI, 1.5 mM MgCl 2, 0.01% gelatin, 0.2 mM
dNTP) containing the following primers: MOS102
(TCTGTGGCCCCGTTATG-CTTAGGAAAAGCA),
MOS105 (TGGGATTGAAGGCAGCCATCTTCAGCCATG), and MOS107 (TCGTGCTTTACGGTATCGCCGCTCCCGATT); this mixture was then incubated three
times according to the following sequence: for 10 min at
94°C and 3 min at 52°C. After this incubation cycle, 2.5 U
of Taq DNA polymerase (Boehringer Mannheim Biochemica, Mannheim, Germany; 250 U/50 xI) was added.
The PCR was cycled 45 times with a programmable thermal controller (PTC-100, MJ Research Inc.). Each cycle
consisted of 45 sec at 94°C, 45 sec at 52°C, and 150 sec at
72°C. After this incubation, 15 Rxl of the PCR mixture was
electrophoresed in 0.8% agarose gel (Agarose ME, Iwai
Chem. Pharm. Inc., Tokyo, Japan). The gel was stained in
ethidium bromide (0.5 Rpg/ml) for 30 min. Mice with a 1.3kilobase (kb) band, a 0.87-kb band, and both bands were
considered as wild type, homozygous mutant, and heterozygous mutant, respectively.
In Vitro Maturation of Oocytes
Three- to eight-week-old mice were used for the experiments. Equine CG (5 IU) was injected i.p. 48 h before the
ovaries were removed. The large antral follicles were
placed in maturation medium consisting of Waymouth's
MB752/1 medium (Gibco Labs., Grand Island, NY) supplemented with 1 IU/ml eCG, 0.23 mM sodium pyruvate,
50 mg/L streptomycin sulfate, 75 mg/L penicillin G (potassium salt), 1 mg/ml undialized fetuin (Deutsch method;
Gibco), and 0.2 mM 3-isobutyl-l-methylxanthine (IBMX,
Sigma Chemical Company, St. Louis, MO) [25] and punctured; the oocytes completely enclosed by cumulus cells
were incubated in IBMX-free maturation medium for 0-16
h at 37°C under 5% CO 2 in air. Homozygous oocytes matured for 16 h were classified as activated oocytes or metaphase oocytes by Hoechst-33342 staining as described below.
In Vitro Fertilization and Parthenogenetic Activation of
Oocytes
Adult cycling mice received injections of 5 IU eCG 48
h before injection of 5 IU hCG. Oocytes matured in vivo
were obtained 16-18 h after administration of hCG. Groups
of 10-30 complexes were then placed in 0.2 ml fertilization
medium/modified Krebs Ringer bicarbonate solution (TYH
medium) [26] containing 4 mg/ml BSA. For some experiments, cumulus cells and the zona pellucida were removed
with 0.1% hyaluronidase (Type IV-S; Sigma, St. Louis,
MO) in PBS and with acidic Tyrode's solution, pH 2.5 [27],
respectively. The first polar body was also removed by gentle pipetting before insemination. Spermatozoa collected
from the caudal epididymides, preincubated for 1.5-3 h at
37°C under 5% CO 2 in air, were used for insemination at
concentrations of 60 cells/pLl. For parthenogenetic activation, oocytes were treated with 8% ethanol in TYH medium
for 6.5 min and cultured in Whitten's medium [28] at 37°C
in 5% CO 2.
Examination of Oocytes
Oocytes were mounted on a glass slide and fixed with
0.5% glutaraldehyde in PBS (pH 7.4) and then with 10%
neutral formalin in PBS overnight. The fixed oocytes were
stained with 0.25% acetolacmoid and examined under a
Nomarski interference microscope (Axiophoto, Zeiss, Basel, Switzerland). Some oocytes were stained with 2.5
mg/ml Hoechst-33342 (Calbiochem-Novabiochem, San Diego, CA) for 10 min at 37°C in a CO 2 incubator. The oocytes were examined under an epifluorescence microscope.
Immunocytochemical Staining for Alpha-Tubulin
Morphology of oocytes matured for 8 h was confirmed
as first metaphase under a fluorescent microscope using
Hoechst-33342, and the zona pellucida was removed. Zonae were fixed for 15 min with 3.7% paraformaldehyde in
PBS and with 2% Triton X-100 (Boehringer Mannheim) in
PBS for 30 min. A rat monoclonal antibody (YL 1/2; BIS
077b, BIOSYS, Compiegne, France), specific for tyrosinated alpha-tubulin [29], and a rhodamine-labeled anti-rat antibody were used for immunostaining. Samples were observed with a Bio-Rad (Richmond, CA) MRC-600 Confocal Laser Scanning Microscope.
Protein Kinase Assays
Histone H1 kinase and myelin basic protein (MBP) kinase activity was assayed according to the method of Pelech et al. [30], with several modifications [31]. Briefly,
oocyte lysates were prepared by freezing oocytes (10 oocytes/tube) in 2 1I kinase assay buffer (15 mM EGTA, 60
mM sodium -glycerophosphate, 30 mM p-nitrophenylphosphate, 25 mM 3-[n-morpholino]propanesulfonic acid
[MOPS], 15 mM MgCl 2, 0.2 mM Na 3VO 4, 2 ug/ml leupeptin, 2 ,ug/ml aprotinin, 1 Rpg/ml pepstatin, 1 mM PMSF,
50 pIM para-aminobenzoic acid [PABA], and 0.5 RM protein kinase A [PKA] inhibitor [TTYADFIASGRTGRRNAIHD; Sigma]. Lysates were stored at -70°C until use.
Each assay tube contained 10 oocytes, 1% Nonidet P40, 20
mM [y-3 2P]ATP (Amersham International plc; Amersham,
Bucks., UK), 1 mg/ml histone H1 (type III-S, Sigma) or
0.4 mg/ml MBP (Sigma) in a final volume of 12.5 ,ul. Assay tubes were incubated for 20 min at 300 C. Assays were
terminated by the addition of 0.4 ml 20% trichloroacetic
acid solution (TCA) and 0.1 ml 1% BSA as a carrier protein
for precipitation. The assay suspensions were centrifuged
at 15 000 x g for 5 min. The precipitates were washed once
with 0.4 ml 20% TCA and dissolved in 0.2 ml 1 N NaOH.
The radioactivity was counted, after the addition of 0.5 ml
scintillation fluid (ACS II; Amersham), in a liquid scintillation counter (LSC-1000; Aloka, Tokyo, Japan). The value
of blank tubes containing all materials except the cytosol
preparation was subtracted from each value. Histone H1
kinase activity and MBP kinase activity were assayed at
least three times.
Immunoblotting for MAPK
MAPK was detected by immunoblotting with the antiMAPK antibody (Zymed Laboratory Inc., South San Francisco, CA). Immunoblotting was performed as described
previously [32]. Oocytes were collected at the germinal
vesicle (GV) stage (0 h after in vitro culture)and at metaphase I (8 h after in vitro culture). Seventy-five oocytes
collected in 5 ul1 medium were transferred into 15 p.1 of
extraction buffer, and immediately 20 R.1 of double-strength
MEIOTIC ABNORMALITY OF c-mos KNOCKOUT MOUSE OOCYTES
(B)
(A)
1317
RESULTS
Progression of Oocyte Maturation
100'
80'
Almost all oocytes from homozygous (86.1%), heterozygous (91.4%), and wild-type (87.4%) females underwent
GVBD within 4 h after the initiation of in vitro maturation
(Fig. 1A). No conspicuous differences were found in the
first polar body emission kinetics among the three genotypes, and the rates reached more than 80% at 14 h after
the initiation of maturation in all genotypes (Fig. B).
0
40'
20'
m
0*
Clonr
0
2
4
6
culture period (hours)
8
8
10
cuu8
l0
12
14
1erod214
16
16
culture period(hours)
FIG. 1. Time course of GVBD (A) and first polar body emission (B)of
cultured homozygote (circles), heterozygote (triangles), and wild-type
mouse (squares) oocytes. Oocytes were isolalted in a medium containing
0.2 mM IBMX and transferred to IBMX-free
medium. Results were obtained from at least three independent experi
Laemmli sample buffer was added. After SDS-PAGE, proteins were transferred to a nitrocel lulose membrane and
probed with the antibody by means of a blotting detection
kit in which the streptavidin-alkaline phosphatase conjugate
was used as the signal-generating sy'stem (Amersham).
ennlnenatlnn
anA
arrantrempnt
nf
rhrnmncenme
nn
the equatorial plane at the first and the second metaphase
were observed in the wild-type (Fig. 2) and heterozygous
(data not shown) oocytes. In homozygous mutant oocytes,
the morphology at the GV stage was identical to that in
heterozygous mutant and wild-type oocytes (Fig. 3, A and
D), but many oocytes had abnormal metaphase chromosomes such as loose condensation and disorder on the equatorial plane (Fig. 3, C, F, H, and K), although a few had
relatively normal ones (Fig. 3, B and E). Moreover, homozygous oocytes had a large first polar body that contained metaphase-like chromosomes (Fig. 3, G and J) or a
nucleus-like structure. Morphologically, the alpha-tubulin
in homozygous mutant oocytes showed signs of diffuseness
and weakness of detection strength (Fig. 4B) in comparison
with that of wild-type oocytes (Fig. 4A).
Statistical Analysis
Chi-square analysis and Student' s t-test were used for
statistical evaluation of the results. IDifferences at a probability of p < 0.05 were considered to be statistically significant.
Entrance into Interphase from First Metaphase Caused by
Loss of Mos
The maturation stages of oocytes cultured for 14-16 h in
vitro are shown in Table 1. In heterozygous mutant and wild-
FIG. 2. Morphology of oocyte during in vitro maturation in wild-type mice. A-C) Oocytes were mounted on glass slides and stained with 0.25%
acetolacmoid after fixation. D-F) Oocytes were stained with Hoechst 33342 (2.5 g/ml) for 10 min without fixation. A, D) germinal vesicle stage; B,
E)metaphase I stage; C,F) metaphase II stage. gv, germinal vesicle; ch, chromosomes at metaphase stage; pb, first polar body. x400.
1318
ARAKI ET AL.
FIG. 3. Morphology of oocytes during in vitro maturation in homozygous mutants. A-C, G-) Oocytes were mounted on glass slides and stained with
0.25% acetolacmoid after fixation. D-F, -L) Oocytes were stained with Hoechst 33342 (2.5 Ilg/ml) for 10 min without fixation. A, D) germinal vesicle
stage; (B,C, E,F) metaphase I stage; (GC,
H, , K) metaphase IIstage; (I, L)activated oocyte (type I).gv, germinal vesicle; ch, chromosomes at metaphase
stage; pb, first polar body; pn, pronucleus. x400.
type oocytes, 96% and 99% of oocytes, respectively, were at
the second metaphase. In homozygous mutant oocytes, however, only 54% of oocytes were at the second metaphase, and
38% of oocytes formed a pronucleus with a polar body or 2
pronuclei without a polar body, indicating that the oocyte had
been activated directly from the first metaphase (type I activated oocyte). These oocytes were clearly distinguishable
from the oocytes activated from the second metaphase, which
had 2 polar bodies and a pronucleus or 1 polar body and 2
pronuclei (type II activated oocyte).
MEIOTIC ABNORMALITY OF c-mos KNOCKOUT MOUSE OOCYTES
1319
TABLE 1. Maturation stages of oocytes cultured for 14-16 h in vitro.
Number of oocytes (%)a
Genotype
Total
oocytes Anaphase I
examined Telophase I
-/+/+/+
517
129
86
13 (2)
5 (4)
1 (1)
Type I
activated
oocytesb
202 (39)
0 (0)
0 (0)
Type II
activated
Metaphase 11 oocytes c
289 (56)
124 (96)
85 (99)
13 (2)
0 (0)
0 (0)
in parentheses indicate percentage of oocytes examined.
oocytes from metaphase I.
cActivated oocytes from metaphase II.
a Numbers
b Activated
FIG. 4. Microtubules of the oocyte stained with the anti-a-tubulin antibody (YL1/2) at metaphase I viewed by confocal microscopy. A) Wildtype mouse, (B)c-mos knockout mouse. Bars = 35 Rm. Oocytes at metaphase I were harvested at 8-9 h after initiation of in vitro maturation
culture and fixed by paraformaldehyde in PBS. Arrowheads indicate the
liberated structure of microtubules.
MAPK Activity during Oocyte Maturation
The fluctuations in MAPK activity in the three genotype
oocytes is shown in Figure 5A. MAPK activities in immature oocytes were at the basal level in all genotypes. The
activity of wild-type and heterozygous mutant oocytes was
significantly increased at 4 h of culture, when almost all
oocytes underwent GVBD. During 4-16 h of culture, the
activity of wild-type oocytes was maintained at about 5 to
7 times the initial activity and was highest among the three
genotypes. In heterozygous mutant oocytes, the activity was
maintained at about 4 times the initial activity after GVBD
and in the middle range between that of wild-type and ho-
FIG. 5. A) Activities of MBP kinase in the oocytes of c-mos-deficient
(circles), heterozygous (open triangles), and wild-type (squares) mice. Oocytes were isolated in medium containing 0.2 mM IBMX and transferred
to IBMX-free medium. Solid inverted triangles represent the activity of
activated oocytes of homozygous mice. Kinase activity is expressed as the
fold increase over the initial level detected in oocytes before in vitro
maturation culture. Experiments were repeated at least three times. *Significantly lower than wild-type values; a, significantly higher than the
initial value. B)Detection of 42- and 44-kDa MAPKs by immunoblotting.
Oocytes were collected at 0 and 8 h after in vitro maturation culture from
wild-type (+/+), heterozygous (+/-), and homozygous (-/-) mutant
mice.
1320
ARAKI ET AL.
19 _
IL -
-
100j
a 88-
.
6-
ar
2u
I
I
I
0
4
8
I
12
16
culture period (hour)
FIG. 6. Activities of histone H1 kinase in c-mos-deficient (circles), heterozygote (open triangles), and wild-type (squares) mouse oocytes during
meiotic maturation in vitro. Oocytes were isolated in medium containing
0.2 mM IBMX and transferred to IBMX-free medium. A solid inverted
triangle indicates the activity of activated oocytes of homozygous mice.
Kinase activity is expressed as the fold increase over the initial level detected in oocytes before in vitro maturation culture. Experiments were
repeated at least three times. *Significantly lower than the second metaphase values. All values except for that indicated by a closed inverted
triangle were significantly higher than the initial value.
mozygous mutant oocytes. In contrast, MAPK activity in
homozygous mutant oocytes did not show significant fluctuation throughout maturation and was significantly lower
than that of wild-type oocytes after 4 h of culture.
Immunoblotting detected two bands at 42 and 44 kDa in
all genotypes at both 0 and 8 h of culture (Fig. 5B). Both
bands in wild-type and heterozygous mutant oocytes shifted
upwards at 8 h of culture, when almost all oocytes were at
the first metaphase and had high MAPK activity. In c-mos
knockout mouse oocytes, however, no band shift was detected at 8 h of culture (Fig. 5B).
Histone H1 Kinase Activity during Oocyte Maturation
The fluctuation in histone H1 kinase activity in the three
genotype oocytes is shown in Figure 6. The activity in GV
oocytes was low in all three genotypes and significantly
increased after GVBD at 4 h after the start of culture. The
activity further increased in all groups at 8 h of culture to
about 8 to 10 times the initial activity. Then the activity
decreased transiently at the first polar body emission. There
were no significant differences in histone H1 kinase activity
among the three genotype oocytes until this time. At 16 h,
the activity of the wild-type and heterozygous mutant oocytes, and of the homozygous mutant oocytes that arrested
at the second metaphase, increased again. On the other
hand, the activity of type I activated oocytes in c-mos
knockout mice further decreased to the basal level and became significantly lower than that of the second metaphase
oocytes.
Third Metaphase Oocytes Observed in c-mos Knockout
Mice
The typical morphology of fertilized oocytes in heterozygous and homozygous mice at 6-7 h after insemination
is shown in Figure 7. The fertilized oocytes in heterozygous
mice had two pronuclei and a penetrated sperm tail (Fig.
7A). There were no differences between heterozygous mice
and wild-type mice in the morphology of fertilized oocytes
(data not shown). In the homozygous mice, 69% of fertil-
FIG. 7. Morphological profile of fertilized eggs. Fertilized eggs at 6-7 h
after insemination were fixed by 2.5% glutaraldehyde in PBS. A) Fertilized
egg of the heterozygote with a second polar body, two pronuclei, and
penetrated sperm tail. B, C) Fertilized egg of the homozygote. B) Egg with
polar bodies, two pronuclei, and penetrated sperm tail. C) Egg with two
polar bodies, chromosome at metaphase, and penetrated sperm tail. Arrowheads indicate penetrated sperm tails. pb, polar body; ch, chromosome; pn, pronucleus. x400.
ized oocytes had a pronucleus or pronuclei and a penetrated
sperm tail (Fig. 7B), and 31% of fertilized oocytes had a
metaphase-like chromosome structure in spite of having a
penetrated sperm tail (Fig. 7C, Table 2). To determine
whether these metaphase-like chromosomes were in the
second metaphase or not, we removed the zona pellucida
and first polar body, and then inseminated the oocytes and
observed the emission of the second polar body as in Ku-
MEIOTIC ABNORMALITY OF c-mos KNOCKOUT MOUSE OOCYTES
1321
TABLE 2. Morphology of fertilized oocytes at 6-7 h after insemination.
Genotype
Total oocytes
examined
77
109
-/+/-
Number of oocytes (%)d
PN + STb
CH + STc
53 (69)
109 (100)
a Numbers in parentheses indicate percentage
b Pronucleus and fertilized sperm tail.
24 (31)
0 (0)
of total oocytes examined.
cChromosome and fertilized sperm tail.
biak [33]. As shown in Table 3, in homozygous mice, only
47% of fertilized oocytes formed a pronucleus or pronuclei,
and 53% of fertilized oocytes had a second polar body and
metaphase-like chromosomes with a penetrated sperm tail,
indicating the so-called metaphase III (Fig. 8), although
100% of fertilized heterozygous oocytes formed pronuclei.
In metaphase III oocytes, sperm nuclei did not form pronuclei, but were transformed into clumps of highly condensed chromatin (Fig. 8).
To verify that chromosome structures in the metaphase
III oocytes did not originate from sperm nuclei, experiments on parthenogenetic activation by means of ethanol
stimulation were conducted. As shown in Table 4, in homozygous mice, 60% of the oocytes examined were activated, and 25% of them formed one polar body and metaphase III chromosomes (Fig. 9, A and B), although not all
activated heterozygous oocytes forming a pronucleus and
metaphase III oocytes were observed.
DISCUSSION
In the present study, it was clear that Mos is not essential
for GVBD and first polar body emission in murine oocytes,
since the loss of Mos did not affect rates and time course
of these processes. The present data indicate that the mechanism initiating oocyte maturation in the mouse differs
from that in Xenopus, where Mos synthesis is essential for
undergoing GVBD [1, 2]. The high rate of first polar body
emission in homozygous oocytes contradicted previous reports, which demonstrated that in mouse oocytes injected
with c-mos antisense oligonucleotides [17] or anti c-mos
antibody [18], first polar body emission was prevented. Although the reason for this is unknown, the antibodies and
oligonucleotides used, or the microinjection process, might
have had some deleterious effects on the oocytes.
In sharp contrast to the lack of effect of Mos on the
progression of first meiosis in the mouse, the abnormalities
of chromosomes and alpha-tubulin morphologies in the
metaphases of homozygous mutant oocytes indicate that
Mos participates in chromosome condensation and microtubule reorganization. Zhao et al. [16, 18] have reported
that about 90% of oocytes that received an antibody to Mos
did not assemble a meiotic spindle. Mos has been implicated in the reorganization of the microtubules, which leads
FIG. 8. Fertilized egg at 6 h after insemination obtained from c-mos
knockout mouse. The zona pellucida and first polar body were removed
before insemination. Photographs show the second polar body (A) and
the cytoplasm (B). Note chromosome at metaphase III stage (arrow)
stained with Hoechst 33342 (C). x500.
TABLE 4. Morphology of ethanol-activated oocytes without a zona pellucida and a first polar body.
Number of oocytes
TABLE 3. Morphology of fertilized oocytes without a zona pellucida and
a first polar body.
Genotype
-/+/-
Total oocytes
examined
PN + STb
Metaphase IIIc
19
35
9 (47)
35 (100)
10 (53)
0 (0)
Number of oocytes (%)
in parentheses indicate percentage of oocytes examined.
b Pronucleus and fertilized sperm tail.
cChromosomes with a second polar body and sperm tail.
aNumbers
Total oocytes
Genotype
-/+/-
Metaphase III
examined
Activated (%)a
40
195
24 (60)
164 (84)
PN stage
(%)b
18 (75)
164 (100)
(%)c
6 (25)
0 (0)
Number in parentheses indicates percentage of oocytes examined.
Pronucleus stage; number in parentheses indicates percentage of activated oocytes.
cChromosomes with a second polar body; number in parentheses indicates percentage of activated oocytes.
a
b
1322
ARAKI ET AL.
FIG. 9. Metaphase III oocyte obtained from c-mos knockout mouse.
Zona pellucida and first polar body were removed, and then the oocytes
were treated with ethanol (8%, 6.5 min). Three hours after treatment with
ethanol, the oocytes were stained with Hoechst 33342 and photographs
were taken under a Nomarski differential interference microscope (A)and
fluorescent microscope (B). x400.
to formation of the spindle and the spindle pole [34, 35].
Mos overexpression in somatic cells induced meiotic-like
alterations in the mitotic spindle [36]. Abnormalities in the
organization of the microtubules and chromatin were recently reported in c-mos knockout mouse oocytes [23]. The
morphological abnormalities induced by the loss of Mos in
the present study are consistent with these previous reports
and confirm that Mos plays an important role in the reorganization of microtubules and chromosome condensation.
In Xenopus oocytes, Mos activates the MAPK cascade
through the specific activation of MAPK kinase [7-10]. In
the present study, MAPK activity was assayed throughout
mouse oocyte maturation in the three genotypes. In heterozygous mutant and wild-type oocytes, the fluctuation patterns were in close agreement with those in previous reports
[37, 38]. On the other hand, MAPK activity of homozygous
mutant oocytes did not significantly fluctuate throughout
maturation and was clearly lower than that of wild-type
oocytes. It has been shown by SDS-PAGE that mouse
MAPK was present as 42- and 44-kDa bands, and the migration rate was decreased when MAPK was activated by
phosphorylation [23, 37, 39]. The two bands at 42 and 44
kDa were detected in all three genotypes in the present
study, and a band shift was also observed at 8 h of maturation when MAPK activity was high in heterozygous mutant and wild-type oocytes. In homozygous mutant oocytes,
however, no decrease in the migration rate was detected at
8 h of culture when the oocytes were at the first metaphase.
Recently, the same result has been reported in a different
strain of c-mos knockout mouse oocytes [23]. These results
indicate that Mos physiologically stimulates MAPK during
maturation of murine oocytes as in Xenopus oocytes.
MAPK activation is a prerequisite for GVBD in Xenopus
oocytes [12]. The present results suggest, however, that in
murine oocytes, MAPK activation is not essential for
GVBD and first polar body emission. In mouse oocytes,
MAPK is localized in microtubule-organizing centers [37,
38]. Verlhac et al. [38] reported that microtubule and chromatin behavior was controlled by MAPK activity during
meiosis in mouse oocytes. We therefore considered that the
morphological abnormalities in homozygous mutant oocytes referred to above contributed to this low MAPK activity caused by the loss of Mos.
In the present study, MPF activity was low in the G2
arresting oocytes and high in the first and the second metaphase oocytes, with a transient decrease at first polar body
emission. This pattern closely agrees with previous reports
[32, 40]. There was almost no difference among the three
genotype oocytes until first polar body emission, indicating
that Mos does not stimulate MPF activity directly and that
MPF and MAPK activities are regulated independently.
These data suggest that the normal fluctuation in MPF activity can cause the normal process of oocyte maturation in
spite of the loss of Mos and MAPK activity, confirming
the importance of MPF in oocyte maturation in the mouse.
One of the most drastic abnormalities in c-mos knockout
mouse oocytes was their entrance into the interphase instead of second meiosis after first polar body emission. In
these oocytes, MPF was inactivated to the basal level instead of being reactivated after the decrease in polar body
emission. Furuno et al. [4] have reported that suppression
of DNA replication during meiotic divisions in Xenopus
oocytes is accomplished by the Mos-mediated premature
reactivation of cdc2 kinase. Oocytes injected with antisense
c-mos oligonucleotides completed the first meiotic division
but failed to initiate second meiosis and reformed a nucleus
[19, 20]. The present results are consistent with these reports, and suggest also that in the mouse Mos plays a crucial role in the reactivation of MPF after the first polar body
emission.
In the present study, however, 56% of oocytes in the
homozygous mutant were not activated after first meiosis
and reached the second metaphase in spite of the loss of
Mos. This indicates that c-mos deletion induces some compensatory factors that reactivate MPF after first meiosis,
although there are wide variations in compensatory efficiency of the oocytes. Verlhac et al. [23] reported that their
c-mos knockout oocytes did not require Mos for MPF reactivation after the first meiosis, prompting us to think of
the high compensatory activity in their mice. Details of
these factors are still unknown, but the present results indicate that a compensatory action other than the MAPK
cascade may be at work, since MAPK in homozygous mutant oocytes was maintained in an inactive form throughout
maturation.
When matured c-mos knockout oocytes were activated
by fertilization or ethanol stimulation, some oocytes were
transformed into metaphase III instead of interphase. The
phenomenon of metaphase III has already been reported by
Kubiak [33]. Kubiak demonstrated that metaphase III frequently appeared at 11-13 h after hCG injection, due to
ethanol stimulation and fertilization, but our experimental
conditions were different from his, because all heterozygous oocytes entered the interphase after activation. Under
MEIOTIC ABNORMALITY OF c-mos KNOCKOUT MOUSE OOCYTES
normal conditions in Xenopus oocytes, the stimulus of fertilization destroys cyclin B by the ubiquitin pathway [41]
and Mos by calmodulin-dependent protein kinase II [42] or
the N-terminal proline-dependent ubiquitin pathway [43],
so that the MPF activity is decreased and the cell cycle
progresses into the interphase. Under the conditions of our
study, however, the MPF activity was maintained not by
Mos but presumably by compensatory factors. We therefore
present here the following hypothesis to account for metaphase III in c-mos knockout mice. When the metaphase II
arrested oocytes were penetrated by sperm, degradation of
cyclin B and a transient decrease in MPF activity occurred
and the cell cycle progressed into the anaphase-telophase.
In these oocytes, however, since unknown compensatory
factors other than Mos may not be degraded even if sperm
penetrate the oocyte, the decreased MPF activity may be
restored and the cell cycle then progresses into metaphase
III. Verlhac et al. [23] also reported the appearance of metaphase HI in their c-mos knockout mice, confirming the presence of Mos-compensatory factors that were not degraded
after metaphase II in the c-mos knockout oocytes.
In summary, the results of our present study indicate that
Mos is located upstream of MAPK in mouse oocytes as
well as in Xenopus oocytes, but independent of MPF activity, and that Mos/MAPK is not essential for GVBD and
first polar body emission, but is essential for maintaining
condensation of chromosomes and a normal spindle by increasing MAPK activity. In addition, one of the most important roles of Mos may be to maintain high MPF activity
after the first polar body emission to enable oocytes to
progress from first meiosis to second meiosis and to correctly degrade after fertilization in order to deactivate MPE
Finally, unknown compensatory factors other than Mos
may maintain the MPF activity in the c-mos knockout
mouse and prevent the escape from meiosis.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
ACKNOWLEDGMENTS
We thank Dr. Naohiro Hashimoto for the generous supply of c-mos
knockout mice; Dr. Hiroshi Imahie for his valuable discussion; and Ms.
Takako Saito, Dr. Takashi Tsuji, and Mr. Shin-ichi Kamijo (Mitsubishi
Kasei Institute of Life Sciences) for their assistance in this work.
24.
25.
REFERENCES
1. Sagata N, Oskarsson M, Copeland T, Brumbaugh J, Vande Woude GE
Function of c-mos proto-oncogene product in meiotic maturation in
Xenopus oocytes. Nature 1988; 335:519-525.
2. Yew N, Mellini ML, Vande Woude GE Meiotic initiation by the mos
protein in Xenopus. Nature 1922; 355:649-652.
3. Kanki JP, Donoghue DJ. Progression from meiosis I to meiosis II in
Xenopus oocytes requires de novo translation of the mosxe protooncogene. Proc Natl Acad Sci USA 1991; 88:5794-5798.
4. Furuno N, Nishizawa M, Okazaki K, Tanaka H, Iwashita J, Nakajo
N, Ogawa Y, Sagata N. Suppression of DNA replication via Mos
function during meiotic divisions in Xenopus oocytes. EMBO J 1994;
13:2399-2410.
5. Sagata N, Watanebe N, Vande Woude GF, Ikawa Y. The c-mos protooncogene product is a cytostatic factor responsible for meiotic arrest
in vertebrate eggs. Nature 1989; 342:512-518.
6. Hanks SK, Quinn AM, Hunter T. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 1988; 241:42-52.
7. Posada J, Nelson Y, Ahn NG, Vande Woude GF, Cooper JA. Mos
stimulates MAP kinase in Xenopus oocytes and activates a MAP kinase in vitro. Mol Cell Biol 1993; 13:2546-2553.
8. Nebreda AR, Hunt T. The c-mos proto-oncogene protein kinase turns
on and maintains the activity of MAP kinase, but not MPF, in cellfree extracts of Xenopus oocytes and eggs. EMBO J 1993; 12:19791986.
9. Nebrada AR, Hill C, Gomez N, Cohen P, Hunt T. The protein kinase
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
1323
mos activates MAP kinase in vitro and stimulates the MAP kinase
pathway in mammalian somatic cells in vivo. FEBS Lett 1993; 333:
183-187.
Shibuya EK, Ruderman JV. Mos induces the in vitro activation of
mitogen-activated protein kinases in lysates of frog oocytes and mammalian somatic cells. Mol Biol Cell 1993; 4:781-790.
Haccard O, Sarcevic B, Lewellyn A, Hartley R, Roy L, Izumi T,
Eleanor E, Mallar JL. Induction of metaphase arrest in cleaving Xenopus embryos by MAP kinase. Science 1993; 262:1262-1265.
Kosako H, Gotoh Y, Nishida E. Requirement for the MAP kinase
kinase/MAP kinase cascade in Xenopus oocyte maturation. EMBO J
1994; 13:2131-2138.
Propst F, Vande Woude GE Expression of c-mos proto-oncogene transcripts in mouse tissues. Nature 1985; 315:516-518.
Goldman DS, Kiessling AA, Millette CF, Cooper GM. Expression of
c-mos RNA in germ cells of male and female mice. Proc Natl Acad
Sci USA 1987; 84:4509-4513.
Mutter GL, Wolgemuth DJ. Distinct developmental patterns of c-mos
protooncogene expression in female and male mouse germ cells. Proc
Natl Acad Sci USA 1987; 84:5301-5305.
Zhao X, Batten B, Singh B, Arlinghaus RB. Requirement of the c-mos
protein kinase for murine meiotic maturation. Oncogene 1990; 5:
1727-1730.
Paules RS, Buccione R, Moschel RC, Vande Woude GE Eppig JJ.
Mouse Mos protooncogene product is present and functions during
oogenesis. Proc Natl Acad Sci USA 1989; 86:5395-5399.
Zhao X, Singh B, Batten BE. The role of c-mos proto-oncoprotein in
mammalian meiotic maturation. Oncogene 1991; 6:43-49.
O'keefe SJ, Wolfes H, Kiessling AA, Cooper GM. Microinjection of
antisense c-mos oligonucleotides prevents meiosis II in the maturing
mouse egg. Proc Natl Acad Sci USA 1989; 86:7038-7042.
O'Keefe SJ, Kiessling AA, Cooper GM. The c-mos gene product is
required for cyclin B accumulation during meiosis of mouse eggs.
Proc Natl Acad Sci USA 1991; 88:7869-7872.
Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K, Nagayoshi M, Takeda N, Ikawa Y, Aizawa S.
Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature
1994; 370:68-71.
Colledge WH, Carlton MBL, Udy GB, Evans MJ. Disruption of c-mos
causes parthenogenetic development of unfertilized mouse eggs. Nature 1994; 370:65-68.
Verlhac M-H, Kubiak JZ, Weber M, Geraud G, Colledge WH, Evans
MJ, Maro B. Mos is required for MAP kinase activation and is involved in microtubule organization during meiotic maturation in the
mouse. Development 1996; 122:815-822.
Mercier B, Gaucher C, Feugeas O, Mazurier C. Direct PCR from
whole blood, without DNA extraction. Nucleic Acids Res 1990; 18:
5908.
Eppig JJ, Telfer EE. Isolation and culture of oocytes. Methods Enzymol 1993; 255:77-80.
Toyoda Y, Yokoyama M, Hoshi T. Studies on the fertilization of
mouse eggs in vitro. I. In vitro fertilization of eggs by fresh epididymal sperm. Jpn J Anim Reprod 1971; 16:147-151.
Nicolson GL, Yanagimachi R, Yanagimachi H. Ultrastructural localization of lectin binding sites on the zonae pellucidae and plasma
membranes of mammalian eggs. J Cell Biol 1975; 66:263-274.
Whitten WK. Nutrient requirements for culture of preimplantation embryos in vitro. Adv Biosci 1971; 6:129-139.
Kilmartin JV, Wright B, Milstein C. Rat monoclonal antitubulin antibodies derived by using a new non secreting rat cell line. J Cell Biol
1982; 93:576-582.
Pelech SL, Meijer L, Krebs EG. Characterization of maturation-activated histone Hl and ribosomal S6 kinases in Sea Star oocytes. Biochemistry 1987; 26:7960-7968.
Naito K, Toyoda Y. Function of histone HI kinase activity during
meiotic maturation in porcine oocytes. J Reprod Fertil 1991; 93:467473.
Choi T, Aoki F Mori M, Yamashita M, Nagahama Y, Kohmoto K.
Activation of p34cdc2 protein kinase activity in meiotic and mitotic
cell cycles in mouse oocytes and embryos. Development 1991; 113:
789-795.
Kubiak JZ. Mouse oocytes gradually develop the capacity for activation during the metaphase II arrest. Dev Biol 1989; 136:537-545.
Zhou R, Oskarsson M, Paules RS, Schulz N, Cleveland D, Vande
Woude GE Ability of the c-mos product to associate with and phosphorylate tubulin. Science 1991; 251:671-675.
Fukasawa K, Murakami MS, Blair DG, Kuriyama R, Hunt T, Fis-
1324
36.
37.
38.
39.
ARAKI ET AL.
chinger P, Vande Woude GE Similarities between somatic cells overexpressing the mos oncogene and oocytes during meiotic interphase.
Cell Growth Differ 1994; 5:1093-1103.
Fukasawa K, Vande Woude GE Mos overexpression in Swiss 3T3
cells induces meiotic-like alterations of the mitotic spindle. Proc Natl
Acad Sci USA 1995; 92:3430-3434.
Sobajima T, Aoki F, Kohmoto K. Activation of mitogen-activated protein kinase during meiotic maturation in mouse oocytes. J Reprod
Fertil 1993; 97:389-394.
Verlhac MH, Kubiak JZ, Clarke HJ, Maro B. Microtubule and chromatin behavior follow MAP kinase activity but not MPF activity during meiosis in mouse oocytes. Development 1994; 120:1017-1025.
Verlhac MH, Pennart HD, Maro B, Cobb MH, Clarke HJ. MAP kinase
becomes stably activated at metaphase and is associated with micro-
40.
41.
42.
43.
tubule-organizing centers during meiotic maturation of mouse oocytes.
Dev Biol 1993; 158:330-340.
Hashimoto N, Kishimoto T. Regulation of meiotic metaphase by a
cytoplasmic maturation-promoting factor during mouse oocyte maturation. Dev Biol 1988; 126:242-252.
Glotzer M, Murray AW, Kirschner MW. Cyclin is degraded by the
ubiquitin pathway. Nature 1991; 349:132-138.
Lorca T, Cruzalegui FH, Fesquet D, Cavadore JC, Mery J, Means A,
Doree M. Calmodulin-dependent protein kinase II mediates inactivation of MPF and CSF upon fertilization of Xenopus eggs. Nature
1993; 366:270-273.
Nishizawa M, Furuno N, Okazaki K, Tanaka H, Ogawa Y, Sagata N.
2
Degradation of Mos by the N-terminal proline (Pro )-dependent ubiquitin pathway on fertilization of Xenopus eggs: possible significance
of natural selection for Pro 2 in Mos. EMBO J 1993; 12:4021-4027.