RESEARCH LETTER
Expression patterns of key iron and oxygen metabolism genes
during magnetosome formation in Magnetospirillum
gryphiswaldense MSR-1
Qing Wang1,2, Jin-Xin Liu1,2, Wei-Jia Zhang1,3, Tong-Wei Zhang1,2,4, Jing Yang1,2 & Ying Li1,2
1
State Key Laboratories for Agro-biotechnology, College of Biological Sciences, China Agricultural University, Beijing, China; 2France–China Biomineralization and Nano-structure Laboratory, Beijing, China; 3Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking
Union Medical College, Beijing, China; and 4Institute of Geology and Geophysics, Chinese Academy of Sciences, Beijing, China
Received 4 July 2013; revised 6 August 2013;
accepted 7 August 2013. Final version
published online 6 September 2013.
DOI: 10.1111/1574-6968.12234
MICROBIOLOGY LETTERS
Editor: Klaus Hantke
Keywords
Magnetospirillum gryphiswaldense; iron
metabolism; oxygen metabolism;
magnetosome formation; real-time
polymerase chain reaction; hierarchical
clustering.
Abstract
To evaluate the expression patterns of genes involved in iron and oxygen
metabolism during magnetosome formation, the profiles of 13 key genes in
Magnetospirillum gryphiswaldense MSR-1 cells cultured under high-iron vs.
low-iron conditions were examined. Cell growth rates did not differ between
the two conditions. Only the high-iron cells produced magnetosomes. Transmission electron microscopy observations revealed that magnetosome formation began at 6 h and crystal maturation occurred from 10 to 18 h. Real-time
polymerase chain reaction analysis showed that expression of these genes
increased during cell growth and magnetosome synthesis, particularly for ferric
reductase gene (fer6) and ferrous transport system-related genes feoAB1, feoAB2, sodB, and katG. The low-iron cells showed increased expression of feoAB1
and feoB2 from 12 to 18 h but no clear expression changes for the other genes.
Expression patterns of the genes were divided by hierarchical clustering into
four clusters for the high-iron cells and three clusters for the low-iron cells.
Each cluster included both iron and oxygen metabolism genes showing similar
expression patterns. The findings indicate the coordination and co-dependence
of iron and oxygen metabolism gene activity to achieve a balance during the
biomineralization process. Future transcriptome analysis will help elucidate the
mechanism of biomineralization in MSR-1 magnetosome formation.
Introduction
Iron is an essential element for many bacteria and plays a
crucial role in vital biochemical activities. It is a cofactor
of many redox enzymes and therefore participates directly
in redox reactions such as nitrogen fixation, photosynthesis, H2 production and consumption, membrane energetics, oxygen transport, and DNA synthesis (Braun, 2001;
Papanikolaou & Pantopoulos, 2005). On the other hand,
the switch between ferric ions (Fe3+) and ferrous ions
(Fe2+) that occurs during redox reactions may lead to
oxidative stress in bacterial cells by the Fenton reaction,
and excessive levels of reactive oxygen species (ROS) have
cytotoxic effects. The uptake and storage of iron in bacteria must therefore be efficiently regulated to avoid the
extremes of starvation and toxicity (Lee et al., 2011).
FEMS Microbiol Lett 347 (2013) 163–172
Magnetotactic bacteria (MTB) are a group of aquatic
bacteria that orient themselves and swim along magnetic
field lines. This behavior, called ‘magnetotaxis’, depends
on the presence of magnetosomes (magnetic particles
composed of Fe3O4 or Fe3S4; Bazylinski et al., 1995; Bazylinski & Frankel, 2004; Komeili, 2012). Magnetospirillum
gryphiswaldense MSR-1, a freshwater MTB species, syntheuler
sizes magnetosomes composed of Fe3O4 particles (Sch€
& Baeuerlein, 1998; Bazylinski & Frankel, 2004). A wellconserved genomic region called the ‘magnetosome island’
(MAI) has been shown to encode many proteins that participate in magnetosome formation (Murat et al., 2010).
The mamAB operon in MAI is necessary and sufficient for
magnetite biomineralization. Genes from the mamCDFG,
mamXY, and mms6 clusters are involved in the control of
crystallization and crystal size (Lohße et al., 2011).
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
Correspondence: Ying Li, State Key
Laboratory of Agro-biotechnology and
College of Biological Sciences, China
Agricultural University, Beijing, 100193,
China.
Tel.: +86 10 6273 3751;
fax: +86 10 6273 2012;
e-mail: [email protected]
164
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Materials and methods
Bacterial strain and growth conditions
Magnetospirillum gryphiswaldense MSR-1 cells were passaged in sodium lactate medium without ferric citrate
(SLM ) three times at 30 °C, 100 r.p.m., as described
previously (Rong et al., 2008). FeSO47H2O was excluded
from the trace element mixture in SLM . The cells were
then cultured in SLM containing ferric citrate (SLM+) or
in SLM at 30 °C, 100 r.p.m. Ferric citrate was added to
the SLM+ to a final concentration of 20 lM for optimal
magnetosome synthesis. The cell suspensions used in subsequent experiments were sampled every 6 h. All experiments were performed in triplicate.
Cell growth curve and measurement of
magnetic response (Cmag)
OD565 nm was measured with a UV-VIS spectrophotometer (UNICO2100; UNICO Instrument Co., Shanghai,
China). Cmag reflects the average magnetic orientation of
cell suspensions and was calculated by measuring the
maximum and minimum scattering intensities, as
described previously (Sch€
uler et al., 1995).
Transmission electron microscopy
MSR-1 cells were cultured in SLM+ and SLM and sampled at 6, 8, 10, 12, 15, 18 and 24 h. The cells were
coated on copper grids and washed twice with doubledistilled H2O (ddH2O). The samples were observed
directly by transmission electron microscopy (TEM,
model JEM-1230; JEOL, Tokyo, Japan). The numbers and
diameters of magnetosomes were analyzed statistically
using IMAGE J (National Institutes of Health, Bethesda,
MD), a Java-based image processing program.
Iron absorption
Samples (100 mL) of cells cultured in SLM+ and SLM
were centrifuged at 8000 g for 5 min. The precipitate was
digested by nitric acid (Rong et al., 2012), and the total
cellular iron content was measured by ICP-OES (Optima
5300DV; Perkin-Elmer, Waltham, MA). The supernatant
was used for the detection of iron concentration remaining in the medium by the ferrozine standard curve
method (Dailey & Lascelles, 1977). Ferric citrate (SigmaAldrich, St. Louis, MO) was prepared in various concentrations, reduced to ferrous ions by hydroxylamine
hydrochloride (10%), and reacted with ferrozine as a
chromogenic reagent to assess the scattering intensity at
OD565 nm and to allow us to generate a standard curve.
FEMS Microbiol Lett 347 (2013) 163–172
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
Iron and oxygen are the major factors involved in magnetosome formation in MSR-1. During the process of magnetosome biosynthesis, MSR-1 cells absorb a large number
of iron ions, resulting in a total iron content that may be
more than 2% of cell dry weight, i.e. over 100-fold higher
than the content in Escherichia coli (Bazylinski & Frankel,
2004). Because of the extreme precision necessary for this
characteristic, MTB contain many genes that are not
located in MAI but that help regulate or maintain the balance between high iron uptake and utilization vs. the ROS
produced by excessive intracellular iron. Because of a lack
of siderophores (Sch€
uler & Baeuerlein, 1996), MSR-1 cells
may need initially to reduce ferric iron (Fe3+) to ferrous
iron (Fe2+) for magnetosome formation by ferric iron
reductases (Noguchi et al., 1999). There are two ferrous
iron transport systems: FeoAB1 and FeoAB2. FeoB1 is a
true ferrous iron transport protein that is partly responsible
for iron transport into the cell to form magnetosomes,
while FeoB2 provides a protective effect against oxidative
stress in MSR-1 (Rong et al., 2008, 2012). Ferric uptake
regulator (Fur, MGR_1314) is one of five predicted Fur
superfamily proteins and was recently found to directly regulate the transcription of katG (MGR_4274), sodB
(MGR_3446), feoAB1 (EF120624.1), and feoAB2
(MGR_1447-1446) in MSR-1 (Uebe et al., 2010; Qi et al.,
2012). KatG and SodB play important roles in eliminating
ROS (Pesci & Pickett, 1996). In general, our knowledge
regarding the roles of iron and oxygen-related genes in
magnetosome formation remains limited, and there have
been few studies on the relationships between iron and oxygen metabolism and the expression patterns of these genes.
The aims of the present study were to elucidate the
expression patterns and coordination of iron and oxygen
metabolism genes under high-iron and low-iron conditions, by: (1) flask culturing MSR-1 cells in the presence
vs. absence of 20 lM Fe3+ and measuring parameters such
as OD565 nm, magnetic response value (Cmag), intracellular
iron content, and number of magnetosomes per cell; (2)
selecting 13 genes involved in iron transport, ferric reduction, iron storage, and the oxidative reaction pathway and
studying their expression profiles by quantitative real-time
polymerase chain reaction (RT-PCR; qPCR); (3) evaluating the expression regulation of the genes during the processes of cell growth and magnetosome synthesis. Our
results showed that MSR-1 cells cultured in medium with
added Fe3+ ions formed mature magnetosomes from 10 to
18 h, most of the detected genes were expressed highly
during this period, and gene expression patterns were not
notably different in high- vs. low-iron conditions. The
genes involved in iron and oxygen metabolism in MSR-1
cells display a tight co-dependence in controlling the balance between iron and oxygen levels during magnetosome
formation.
Q. Wang et al.
165
Iron and oxygen metabolism genes in Magnetospirillum
We applied the same procedure to the supernatants of
the two types of cultured MSR-1 cells and used the
standard curve to measure the iron concentration in the
medium.
RNA extraction and quantitative real-time
RT-PCR
Table 1. Primers used in this study
Gene name
Location
Primer name
Sequence (5′–3′)
Product length (bp)
fur
MGR_1314
MGR_1447
feoB2
MGR_1446
feoA1
EF120624.1
feoB1
EF120624.1
ferric iron-binding (fragment)
MGR_4079
ferredoxin
MGR_0408
thioredoxin reductase
MGR_2378
flavin reductase-like, FMN-binding
MGR_3067
sodB
MGR_3446
katG
MGR_4274
alkyl hydroperoxide reductase
MGR_2380
thiol peroxidase
MGR_4262
rpoC
MGR_3807
CCTTGAACGCCACGATTTCG
TTCCAACCGATGCCCAACCA
TCAAACCCTCTCGATTTCCA
ACAGGATCTTAAGCCCGGAG
GACGACACCAGCCAGATTT
CAACACCCTCTACACCCAA
AACCGAGGATGGCGTTT
TCAAGCGAATGCGGA
AAGGCGATGACGAGGTTCT
AAGGTGCGGTTCAGGAAGA
TCGCCTCTGCCTTGTTCTTG
CCTATTACTTTGCGGGAATGC
CCGTCCAGTTCCTGCTTCAT
AATCGCCCATCGCAACAAG
CGACTGAAGAACGCCAAGA
TGACGGCACCTTTGAACAA
ACAAGCGAGCATTCCAGA
CGGTCGTTTCGTCATCAA
CAGAAGAAGGTATGGTTCCACA
TCCCTATGACAAGACCGCT
GAAATAGCCATTGTCCCACTTG
TGAACGACGAGGAAACGGT
TAGGACTTGGCGATGGACT
CTTGGTGTTCTTCTATCCGCT
ACTGTGGTCGTGTCGGTGTT
AAATCCTTGTGGCGGAAG
ATCCGTATTTCCATCGCCTCCC
TTGCCGCACAAGCATTCGT
184
feoA2
Fur-F
Fur-R
FeoA2-F
FeoA2-R
FeoB2-F
FeoB2-R
FeoA1-F
FeoA1-R
FeoB1-F
FeoB1-R
F4079-F
F4079-R
Fdx-F
Fdx-R
Fer5-F
Fer5-R
Fer6-F
Fer6-R
Sod-F
Sod-R
Kat-F
Kat-R
AhpC-F
AhpC-R
Tpx-F
Tpx-R
rpoC-F
rpoC-R
FEMS Microbiol Lett 347 (2013) 163–172
220
166
170
238
159
207
105
162
228
230
231
203
164
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
MSR-1 cells were grown in SLM+ and SLM and harvested every 6 h. Total cellular RNA was isolated using
Trizol reagent (Tiangen Biotech Co., Beijing, China) as
follows. First, the cells were harvested at 4 °C, 12 000 g
for 1 min, ground in liquid nitrogen, incubated in 1 mL
Trizol reagent for 5 min, and added with chloroform
for protein extraction. The samples were then centrifuged at 12 000 g for 15 min at 4 °C, and 400 lL isopropanol was added for nucleic acid precipitation. The
precipitates were washed with 1 mL of 75% RNase-free
ethanol and dried on ice for 10 min. To each tube was
added 35 lL RNase-free water to dissolve RNA. To
eliminate DNA contamination, the RNA was digested
with RNase-free DNase I (TaKaRa, Otsu, Japan) for 1 h
at 37 °C. The quality and quantity of the samples were
evaluated using the A260 nm/A280 nm ratio obtained with
a NanoVue spectrophotometer (GE Healthcare, Little
Chalfont, UK).
The RNA extracted from each sample was reversetranscribed into cDNA using M-MLV reverse transcriptase (Promega, Madison, WI). Template RNA (2 lg) was
mixed with 2 lL random primer, added with ddH2O to a
final volume of 12 lL, incubated for 10 min at 70 °C,
and immediately placed on ice for 2 min. Twelve microliter of the mixture was added with 1 lL M-MLV reverse
transcriptase, 4 lL M-MLV RT 59 buffer, 0.5 lL inhibitor (TaKaRa), 1.25 lL dNTP (10 mmol), and 1.25 lL
ddH2O, and the reaction was performed sequentially for
10 min at 30 °C, 1 h at 42 °C, and 15 min at 70 °C.
Quantitative PCR was performed in a LightCycler 480
RT-PCR system using a LightCycler 480 SYBR Green I
Master Kit (Roche, Mannheim, Germany) according to
the manufacturer’s instructions, as described previously
(Zhang et al., 2012). The primers used for the amplification of 13 iron and oxygen metabolism genes are listed in
Table 1. The rpoC gene that encodes RNA polymerase
subunit b′ was selected as the internal control and reference. For analysis of the results, the relative expression of
166
each gene was calculated by the comparative crossing
point (CP) method and presented as 2 ΔΔCp. The data
from three replicates were averaged.
Q. Wang et al.
(a)
Hierarchical clustering analysis
(b)
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
To evaluate the trend lines of iron and oxygen metabolism gene expression, hierarchical clustering (HCL) was
performed, and a distance tree was generated using the
MULTI EXPERIMENT VIEWER (MeV) program (Saeed et al.,
2006). Each expression element was typically a log2
transformation of an expression fold change between a
later and prior time point. HCL was used to construct
a binary tree by successively grouping the genes based
on similarity. Thirteen genes were assigned on the basis
of expression similarity to different clusters their expression patterns were closest to according to k-means
clustering.
Results and discussion
Two types of MSR-1 cells differing in
magnetosome formation ability
Magnetospirillum gryphiswaldense MSR-1 has the capability of taking up large amounts of iron and synthesizing
magnetosomes (Sch€
uler & Baeuerlein, 1998; Bazylinski &
Frankel, 2004). Previous studies of MSR-1 cells have
shown that iron concentrations above 20 lM increase cell
yield and magnetism only slightly (Sch€
uler & Baeuerlein,
1996) and that 20 lM Fe3+ is sufficient for magnetosome
formation (Rong et al., 2008). We cultured MSR-1 cells
with and without the addition of 20 lM extracellular
Fe3+ (these two experimental groups are hereafter termed
‘high-iron’ and ‘low-iron’ cells, respectively). The growth
rates were similar under these two conditions, but Cmag
was zero only for the low-iron cells (Fig. 1a).
The iron content of the high-iron cells was three times
that of the low-iron cells, and the variability of this
parameter was similar to that of Cmag (Fig. 1b). The iron
concentration of the supernatants of the high-iron cells
decreased gradually over time. The iron concentration
remained at 2 lM and may have been derived from
the yeast extract in the SLM for the low-iron cells
(Fig. 1c).
In the present study, only iron content was modified,
and our phenotypic results confirmed that MSR-1 cells
cultured under low-iron vs. high-iron conditions differed
in terms of magnetosome formation. These two types of
MSR-1 cells are suitable for analysis of overall physiological differences and the relationships between such differences and the expression of genes related to iron and
oxygen metabolism.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
(c)
Fig. 1. Growth rate (OD565 nm), magnetic response (Cmag) values,
and iron uptake ability of MSR-1 cells under two culture conditions:
addition of Fe3+ (‘high-iron’) vs. no addition of Fe3+ (‘low-iron’). (a)
Cell growth rates did not differ between the two conditions. Cmag for
low-iron condition was always zero. (b) Intracellular iron content as a
percentage of cell dry weight. (c) Iron concentration in the culture
supernatant. Cells were grown in SLM with or without 20 lM ferric
citrate and harvested every 6 h. The parameters shown in (b) and (c)
were higher in high-iron than low-iron cells. The experiments were
performed in triplicate.
The three main stages of magnetosome
formation as defined by TEM
To identify the crucial time periods for cell growth and
magnetosome formation, samples obtained at the
FEMS Microbiol Lett 347 (2013) 163–172
Iron and oxygen metabolism genes in Magnetospirillum
Expression patterns of genes related to iron
and oxygen metabolism during magnetosome
formation
To elucidate the expression patterns of the genes related
to iron and oxygen metabolism during magnetosome formation, we performed qPCR analysis. In view of the three
phases of magnetosome formation described above, we
used four sampling points (6, 12, 18, and 24 h) and
analyzed the expression levels of 13 genes.
The expression patterns of the 13 genes under highiron conditions (Fig. 3a and b) indicate that most of the
genes were transcribed following the increase in magnetic
response of magnetosome-forming cells (Fig. 1a). To analyze the relationships between expression of iron- and
oxygen-related genes and magnetosome biosynthesis and
cell growth, the 13 selected genes were subjected to HCL
to identify patterns of regulation (Fig. 3c) and were
divided into four distinct clusters. Further extraction by
k-means clustering from the HCL revealed the expression
trend for each gene (Fig. 3d, left) and the overall trend
for each cluster (Fig. 3d, right). The k-means clustering
FEMS Microbiol Lett 347 (2013) 163–172
revealed that the members of each cluster showed a consistent trend of expression and each of the clusters except
Cluster III contained iron and oxygen metabolism genes.
Cluster I contained six genes that displayed a stable
increase during the log phase. The flavin reductase gene
(FMN-binding, fer6, MGR_3076) showed a sharp increase
in expression from 12 to 18 h. The alkyl hydroperoxide
reductase gene (ahpC, MGR_2380), thioredoxin reductase
gene (fer5, MGR_2378), and ferric uptake regulator gene
(fur, MGR_1314) showed expression increases primarily
from 6 to 12 h. All of the genes were down-regulated
between 12 and 18 h. Cluster II contained only ferric-iron
binding (fragment, MGR_4079) and sodB (MGR_3446),
which showed increases from 6 to 12 h and decreases
from 12 to 18 h. In Cluster III, the expression of feoA1
increased continuously throughout all cell growth stages.
The expression patterns of Cluster IV were somewhat
similar to those of Cluster I with the difference that both
of two iron-related genes and two oxygen-related genes
showed drastic increases in expression from 12 to 18 h.
Suzuki et al. (2006) observed up-regulation of high-affinity
ferrous iron transport genes in magnetosome-forming
Magnetospirillum magneticum AMB-1 cells grown under
high-iron conditions. In MSR-1, the FeoB2 protein participates in magnetosome formation when FeoB1 is
deleted, and both FeoB proteins indirectly protect the
cells from oxidative stress (Rong et al., 2012). MGR_1314
was first identified as a regulator of iron transport systems in MSR-1 by Uebe et al. (2010). Qi et al. (2012)
used a chromatin immunoprecipitation (ChIP) assay to
show that expression of the genes feoAB1 (EF120624.1),
feoAB2 (MGR_1447 and MGR_1446), sodB (MGR_3446),
and katG (MGR_4274) was directly regulated by Fur in
MSR-1. These findings have important implications for
iron and oxygen metabolism. Because no obvious differences in fur expression in MSR-1 were demonstrated in
these studies, we presume that Fur (MGR_1314) is
involved not only in functions related indirectly to iron
metabolism but also in other cellular biochemical
processes (Niederhoffer et al., 1990; Dian et al., 2011).
Siderophores are not found in MSR-1, and the rate of
iron uptake for Fe3+ is higher than that for Fe2+ in this
strain (Sch€
uler & Baeuerlein, 1996). However, the ferrous
rather than the ferric iron is the redox form that is
required for magnetosome synthesis. Thus, reduction of
ferric iron is essential. Ferric iron is typically reduced first
to ferrous iron, which can be taken up by ferrous iron
transporters. At least six ferric reductases are present in
MSR-1 (Meng et al., 2007). FeR5 and FeR6 are ferric iron
reductases but also display thioredoxin reductase activity
and flavin reductase activity, respectively (Zhang et al.,
2013). We observed increases in the expression of both
fer5 (MGR_2378) and fer6 (MGR_3076) during
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
following points were prepared for TEM: (1) before wildtype cells became magnetic; (2) when wild-type cells
became magnetic; (3) when Cmag was maximal; (4) when
Cmag began to decline. TEM analysis showed that the
high-iron cells did not produce magnetosomes prior to
6 h (Fig. 2a); this interval may reflect the preparation
period for magnetosome synthesis. After 6 h, the cells
began to form magnetosomes, and the number and
size of magnetosomes increased gradually with time
(Fig. 2b–d). The magnetosome number per cell increased
from 6–15 ( 4.3) at 8–10 h, to 16–20 ( 6.1) at 12 h
(Fig. 2g), and the magnetosome diameter increased from
16–20 ( 6.5) nm at 8–10 h, to 21–25 ( 6.2) nm at
12 h (Fig. 2h). At 18 h, the magnetosomes were mature
(Fig. 2d) and mainly had a diameter of 21–25
( 6.5) nm and 25–30 ( 6.5) nm (Fig. 2h). At 24 h,
the magnetosome number decreased (Fig. 2e and g). In
the low-iron cells, no magnetosomes were formed
(Fig. 2f), as reflected by the Cmag value of 0. The findings
for the high-iron cells indicated that magnetosome formation began after 6 h, the magnetosomes underwent
rapid crystal growth and maturation from 8 to 12 h, and
the biomineralization process was completed by 18 h. We
therefore divided magnetosome formation into three
phases: lag phase (0–6 h), log phase (6–18 h), and
stationary phase (18–24 h). Additionally, the results
demonstrated once again that it is reasonable to use the
non-magnetosome-forming cells as a reference to study
the expression profiles of 13 iron and oxygen metabolism
genes during the process of magnetosome formation.
167
168
Q. Wang et al.
(a)
(b)
(c)
(d)
(e)
(f)
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
(g)
(h)
Fig. 2. TEM micrographs of MSR-1 cells under high-iron vs. low-iron conditions, and the distributions of magnetosome number and magnetite
crystal diameter. (a–e) Cells were cultured with 20 lM ferric citrate and harvested at 6, 10, 12, 18, or 24 h. (f) Cells were cultured without ferric
citrate for 24 h. For the high-iron cells, magnetosome formation began after 6 h and the maturation period was from 10 to 18 h. No
magnetosome formation occurred in the low-iron cells. (g) Distribution of magnetosome number per cell in 200 high-iron cells as observed by
TEM. (h) Magnetite crystal diameter in 200 high-iron cells as observed by TEM. The peak period of magnetosome formation was from 10 to 18 h.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 347 (2013) 163–172
169
Iron and oxygen metabolism genes in Magnetospirillum
(a)
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
(c)
(b)
(d)
Fig. 3. Transcription levels and HCL of genes related to iron and oxygen metabolism under high-iron condition. (a) Relative expression levels of
iron metabolism genes. (b) Relative expression levels of oxygen metabolism genes. (c) HCL of fold change patterns of iron and oxygen
metabolism genes using the MULTI EXPERIMENT VIEWER program, v 4.8.1. The expression matrix shows a false-color view on a red-green scale, with
green representing low expression and red representing high expression. (d) k-means clustering of each gene and the overall trend from the HCL
in (c). Fold change was defined as the logarithmic value of the relative expression ratio between a later and a prior time point. The expression
trends of most of the studied genes were similar to that of magnetic response (Cmag). The genes fer5, fer6, feo, ahpC, sodB, and katG all
showed increasing expression during the process of magnetosome formation.
magnetosome maturation, and the expression patterns of
these two genes were consistent (Fig. 3c). These findings
indicate that FeR5 and FeR6 play complementary roles
FEMS Microbiol Lett 347 (2013) 163–172
during the process of magnetosome synthesis in MSR-1
(Zhang et al., 2013) following energy exchange by simultaneous electron transfer and oxidative reactions. In
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
170
Q. Wang et al.
agreement with this concept, Suzuki et al. (2006)
observed increased transcription levels of ferric reductase
(amb3335) genes in magnetosome-forming cells of
M. magneticum AMB-1. Other peroxidases such as thiol
peroxidase (tpx) are also expressed highly during the process of magnetosome formation. MSR-1 cells do not form
magnetosomes when the concentration of dissolved
(a)
(b)
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
(c)
oxygen is high, even when sufficient iron is supplied
(Sch€
uler & Baeuerlein, 1998; Zhang et al., 2011), as was
also observed in studies of M. magnetotacticum MS-1
(Blakemore et al., 1979) and M. magneticum AMB-1 (Suzuki et al., 2006). The findings suggest that the genes
related to oxygen and iron metabolism in these MTB
have a co-dependent relationship and that iron metabo-
(d)
Fig. 4. Transcription levels and HCL of genes related to iron and oxygen metabolism under low-iron condition. (a–d) As in Fig. 3. Under low-iron
condition, feo showed increased expression between 12 and 18 h, but there were no clear expression changes for the other genes.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 347 (2013) 163–172
171
Iron and oxygen metabolism genes in Magnetospirillum
FEMS Microbiol Lett 347 (2013) 163–172
balance. Further in-depth studies of cellular iron and oxygen metabolism and its regulation will help clarify the cell
physiological phenomena associated with magnetosome
formation in MSR-1; many of these phenomena remain
poorly known. Approaches that incorporate transcriptome
analysis of MSR-1 cells under low-iron vs. high-iron conditions will allow us to trace all of the iron and oxygen
metabolism genes that participate in magnetosome
formation.
Acknowledgements
This study was supported in part by the Chinese National
Natural Science Foundation (Grant No. 30970041 and
31270093), the Chinese Universities Scientific Fund
(2012YJ031), and the Innovation Program for Undergraduates at China Agricultural University (Grant No. 2011BKS-20). The authors thank Dr. S. Anderson for English
editing of the manuscript.
References
Bazylinski DA & Frankel RB (2004) Magnetosome formation
in prokaryotes. Nat Rev Microbiol 2: 217–230.
Bazylinski DA, Frankel RB, Heywood BR, Mann S, King JW,
Donaghay PL & Hanson AK (1995) Controlled
biomineralization of magnetite (Fe3O4) and greigite (Fe3S4)
in a magnetotactic bacterium. Appl Environ Microbiol 61:
3232–3239.
Blakemore RP, Maratea D & Wolfe RS (1979) Isolation and
pure culture of a freshwater magnetic spirillum in
chemically defined medium. J Bacteriol 140: 720–729.
Braun V (2001) Iron uptake mechanisms and their
regulation in pathogenic bacteria. Int J Med Microbiol 291:
67–79.
Dailey HJ & Lascelles J (1977) Reduction of iron and synthesis
of protoheme by Spirillum itersonii and other organisms.
J Bacteriol 129: 815–820.
Dian C, Vitale S, Leonard GA, Bahlawane C, Fauquant C,
Leduc D, Muller C, de Reuse H, Michaud-Soret I &
Terradot L (2011) The structure of the Helicobacter pylori
ferric uptake regulator Fur reveals three functional metal
binding sites. Mol Microbiol 79: 1260–1275.
Komeili A (2012) Molecular mechanisms of
compartmentalization and biomineralization in
magnetotactic bacteria. FEMS Microbiol Rev 36: 232–255.
Lee JY, Passalacqua KD, Hanna PC & Sherman DH (2011)
Regulation of petrobactin and bacillibactin biosynthesis in
Bacillus anthracis under iron and oxygen variation. PLoS
One 6: e20777.
Lohße A, Ullrich S, Katzmann E, Borg S, Wanner G, Richter
M, Voigt B, Schweder T & Sch€
uler D (2011) Functional
analysis of the magnetosome island in Magnetospirillum
gryphiswaldense: the mamAB operon is sufficient for
magnetite biomineralization. PLoS One 6: e25561.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
lism is regulated in coordination with defenses against
oxidative stress during magnetosome synthesis (Sch€
uler &
Baeuerlein, 1996).
We speculated that, during magnetosome formation,
absorbed Fe3+ is reduced to Fe2+ by ferric reductases such
as FeR5 and FeR6, and the ferrous iron transport system
(FeoAB) facilitates the transportation and utilization of
Fe2+ (Fig. 3a). The absorption of large amounts of iron
may result in ROS production in the cells, which in turn
triggers expression of oxygen metabolism genes such as sodB
(MGR_3446), katG (MGR_4274), and feoB2 (MGR_1446;
Fig. 3b). These observations indicate that MSR-1 cells
initiated expression of iron-related genes for absorption
of iron from the medium and for magnetosome biosynthesis, and that oxygen-related genes were expressed
highly at the same time for protection against oxidative
stress.
In the cells cultured under low-iron condition, the 13
genes displayed different expression patterns. feoAB1 and
feoB2 were the only genes that showed slightly increasing
expression from 12 to 18 h; feoA2 showed an increase
from 6 to 12 h (Fig. 4a and b). These findings suggest that
the gene feoAB is relieved from repression by Fe-Fur under
iron-limited conditions (Qi et al., 2012; Yu & Genco,
2012). Analysis by HCL and k-means clustering gave similar results under high-iron conditions, and three main
clusters were observed (Fig. 4c and d). Each of the clusters
included different iron and oxygen metabolism genes. In
Cluster I, most of the genes showed decreasing expression
from 6 to 12 h and increasing expression from 12 to 18 h.
The genes in Cluster II showed the opposite trend. Three
genes in Cluster III showed no obvious difference in
expression between the three growth stages. In contrast to
the high-iron cells, the low-iron (non-magnetosome-forming) cells showed no apparent expression of iron and oxygen metabolism genes (except for the two Feo system
genes) and displayed low iron absorption ability (Fig. 1b).
These findings indicate that the expression of iron and
oxygen metabolism genes is coordinated and that this
relationship is particularly important during the process
of magnetosome formation.
The process of magnetosome synthesis evidently
involves the function of not only the genes in the MAI
but also those related to iron and oxygen metabolism. A
crucial remaining question is: how many genes are
involved in magnetosome synthesis? Ongoing advances in
cell transcriptome and gene network analysis are expected
to help provide the answer. The present results show that
the expression of certain genes related to iron and oxygen
metabolism in MSR-1 cells is coordinated during the process of magnetosome synthesis. Such ‘crosstalk’ between
iron and oxygen metabolism genes plays a crucial role in
the maintenance of cellular iron metabolism and oxygen
172
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
Sch€
uler D & Baeuerlein E (1996) Iron-limited growth and
kinetics of iron uptake in Magnetospirillum gryphiswaldense.
Arch Microbiol 166: 301–307.
Sch€
uler D & Baeuerlein E (1998) Dynamics of iron uptake and
Fe3O4 biomineralization during aerobic and microaerobic
growth of Magnetospirillum gryphiswaldense. J Bacteriol 180:
159–162.
Sch€
uler D, Uhl R & Baeuerlein E (1995) A simple light
scattering method to assay magnetism in Magnetospirillum
gryphiswaldense. FEMS Microbiol Lett 132: 139–145.
Suzuki T, Okamura Y, Calugay RJ, Takeyama H & Matsunaga
T (2006) Global gene expression analysis of iron-inducible
genes in Magnetospirillum magneticum AMB-1. J Bacteriol
188: 2275–2279.
Uebe R, Voigt B, Schweder T, Albrecht D, Katzmann E, Lang
C, B€
ottger L, Matzanke B & Sch€
uler D (2010) Deletion of a
fur-like gene affects iron homeostasis and magnetosome
formation in Magnetospirillum gryphiswaldense. J Bacteriol
192: 4192–4204.
Yu CX & Genco CA (2012) Fur-mediated global regulatory
circuits in pathogenic Neisseria species. J Bacteriol 194:
6372–6381.
Zhang Y, Zhang XJ, Jiang W, Li Y & Li JL (2011)
Semicontinuous culture of Magnetospirillum gryphiswaldense
MSR-1 cells in an autofermentor by nutrient-balanced and
isosmotic feeding strategies. Appl Environ Microbiol 77:
5851–5856.
Zhang WJ, Santini CL, Bernadac A, Ruan J, Zhang SD, Kato
T, Li Y, Namba K & Wu LF (2012) Complex spatial
organization and flagellin composition of flagellar propeller
from marine magnetotactic ovoid strain MO-1. J Mol Biol
416: 558–570.
Zhang C, Meng X, Li NX, Wang W, Sun Y, Jiang W, Guan
GH & Li Y (2013) Two bifunctional enzymes with ferric
reduction ability play complementary roles during
magnetosome synthesis in Magnetospirillum gryphiswaldense
MSR-1. J Bacteriol 195: 876–885.
FEMS Microbiol Lett 347 (2013) 163–172
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 17, 2016
Meng X, Jiang W, Yang L & Li Y (2007) A novel ferric
reductase purified from Magnetospirillum gryphiswaldense
MSR-1. Curr Microbiol 55: 71–75.
Murat D, Quinlan A, Vali H & Komeili A (2010)
Comprehensive genetic dissection of the magnetosome gene
island reveals the step-wise assembly of a prokaryotic
organelle. P Natl Acad Sci USA 107: 5593–5598.
Niederhoffer EC, Naranjo CM, Bradley KL & Fee JA (1990)
Control of Escherichia coli superoxide dismutase (sodA and
sodB) genes by the ferric uptake regulation (fur) locus.
J Bacteriol 172: 1930–1938.
Noguchi Y, Fujiwara T, Yoshimatsu K & Fukumori Y (1999)
Iron reductase for magnetite synthesis in the magnetotactic
bacterium Magnetospirillum magnetotacticum. J Bacteriol
181: 2142–2147.
Papanikolaou G & Pantopoulos K (2005) Iron metabolism and
toxicity. Toxicol Appl Pharmacol 202: 199–211.
Pesci EC & Pickett CL (1996) Genetic organization and
enzymatic activity of a superoxide dismutase from the
microaerophilic human pathogen, Helicobacter pylori. Gene
143: 111–116.
Qi L, Li J, Zhang WJ, Liu JN, Rong CB, Li Y & Wu LF (2012)
Fur in Magnetospirillum gryphiswaldense influences
magnetosomes formation and directly regulates the genes
involved in iron and oxygen metabolism. PLoS One 7: e29572.
Rong CB, Huang YJ, Zhang WJ, Jiang W, Li Y & Li JL (2008)
Ferrous iron transport protein B gene (feoB1) plays an
accessory role in magnetosome formation in
Magnetospirillum gryphiswaldense strain MSR-1. Res
Microbiol 159: 530–536.
Rong CB, Zhang C, Zhang Y, Qi L, Yang J, Guan GH, Li Y &
Li JL (2012) FeoB2 functions in magnetosome formation
and oxidative stress protection in Magnetospirillum
gryphiswaldense strain MSR-1. J Bacteriol 194: 3972–3976.
Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V,
Howe EA, Li J, Thiagarajan M, White JA & Quackenbush J
(2006) TM4 microarray software suite. Meth Enzymol 411:
134–193.
Q. Wang et al.