Journal of Human Hypertension (2000) 14, 43–46
 2000 Macmillan Publishers Ltd. All rights reserved 0950-9240/00 $15.00
www.nature.com/jhh
ORIGINAL ARTICLE
Role of the Gly460Trp polymorphism of
the ␣-adducin gene in primary
hypertension in Scandinavians
O Melander1, K Bengtsson2, M Orho-Melander1, U Lindblad3, C Forsblom4, L Råstam5,
L Groop1 and UL Hulthén1
Departments of 1Endocrinology and 5Community Medicine, Lund University, Malmö, Sweden; 2Primary
Health Care Centre in Skara, Skara, Sweden; 3Skaraborg Institute, Skövde, Sweden; 4Department of
Medicine, Helsinki University Central Hospital, Helsinki, Finland
Previous studies have suggested that the Trp460 allele
of the Gly460Trp polymorphism in the ␣-adducin gene
is associated with salt sensitivity and primary hypertension. The present study was undertaken to evaluate if
the Trp460 allele of this polymorphism is associated
with primary hypertension in Scandinavians. To address
this issue, 294 patients with primary hypertension and
265 normotensive control subjects from Sweden were
examined and genotyped for the Gly460Trp polymorphism using polymerase chain reaction and restriction
fragment length polymorphism methods. We then used
a population of 80 patients with primary hypertension
and 154 normotensive control subjects from Finland to
replicate the findings. The frequency of the Trp460 allele
was lower in hypertensive patients than in normotensive
controls in the Swedish population (17.7% vs 23.0%;
P ⴝ 0.03) and in the Finnish population (14.4% vs 19.5%;
NS). Therefore we also performed a pooled analysis in
which the frequency of the Trp460 allele was significantly lower in hypertensive patients than in normotensive controls (17.0% vs 21.7%; P ⴝ 0.02). In subjects who
did not receive antihypertensive medication (n ⴝ 447)
there was no difference between carriers of the three
different codon 460 genotypes (Trp-Trp; Trp-Gly and
Gly-Gly) either for systolic (128 ⴞ 18; 127 ⴞ 15 and
129 ⴞ 17 mm Hg, NS) or for diastolic blood pressure
(75.6 ⴞ 12.1; 74.7 ⴞ 9.3 and 75.0 ⴞ 10.4 mm Hg, NS). In
conclusion, the lower frequency of the Trp460 allele in
hypertensive patients than in normotensive controls
strongly argues against a pathogenic role of this allele
in primary hypertension. The results rather suggest that
another variant in linkage disequilibrium with the
Gly460Trp polymorphism increases susceptibility for
hypertension.
Journal of Human Hypertension (2000) 14, 43–46
Keywords: ␣-adducin; primary hypertension; hypertension genes; Gly460Trp polymorphism; genetics of hypertension
Introduction
Primary hypertension is a multifactorial and polygenic disease1 with a considerable genetic component.2 Abnormal renal sodium handling may be
involved in the pathogenesis of the disease.3 It has
been shown that the Milan hypertensive rat (MHS)4
and a subgroup of humans with hypertension have
enhanced transmembranic ion transport, an effect
possibly involving the cytoskeleton.5–8 Genetic differences in renal tubular salt reabsorption could
thus contribute to the development of hypertension.9–14 Cross-immunisation of cytoskeleton proteins between MHS and the normotensive rat strain
(MNS) revealed immunochemical differences in an
␣/␤ heterodimeric protein called adducin.15 Adducin is thought to interact with the actin cytoskeleton
and could thereby be important for cell signalling.16,17 Two mutations in the ␣-adducin and the ␤adducin genes could explain up to 50% of the differCorrespondence: Olle Melander, Department of Endocrinology,
Malmö University Hospital MAS, S-205 02 MALMÖ, Sweden
Received 24 April 1999; revised and accepted 10 August 1999
ence in blood pressure between the MHS and the
MNS.9 Transfection studies with cDNA from the
MHS showed altered ability of adducin to interact
with actin and increased maximum velocity of the
sodium-potassium pump.18
In humans, polymorphic markers flanking the ␣adducin gene have been shown to be associated with
primary hypertension in Italians19 and linkage has
been demonstrated between the ␣-adducin locus
and primary hypertension in French families.20 The
tryptophane variant of a polymorphism in the ␣adducin gene which codes for either glycine or tryptophane at codon 460 (Gly460Trp) has been associated with hypertension in Italian, French and
Japanese populations.20–22 In addition, Italian hypertensive carriers of the Trp460 allele have been
shown to be more salt-sensitive20 and to have a
decreased slope of the pressure natriuresis relationship23 as compared to the Gly460 homozygotes.
However, in other studies no association has been
found between the Gly460Trp polymorphism and
hypertension24 –26 or sodium metabolism.25
The present study was undertaken to investigate
whether the Trp460 allele of the Gly460Trp poly-
␣-Adducin gene and primary hypertension
O Melander et al
44
morphism in the ␣-adducin gene is associated with
primary hypertension, using two Scandinavian casecontrol populations.
of the weight in kg to the square of the height in
metres (kg/m2).
Materials and methods
Genotyping
Study subjects
Total genomic DNA was extracted from venous
blood by standard methods.27 Polymerase chain
reaction (PCR) and restriction fragment length polymorphism (RFLP) methods were created to genotype
the study subjects for the Gly460Trp polymorphism.
A gene segment surrounding the Gly460Trp polymorphism in the ␣-adducin gene was amplified with
PCR using primers ‘␣-add-460-F’ (5′-ACAGAA
CTGGCTACCCTTATC) and ‘␣-add-460mm-R’ (5′TTGGGACTGCTTCCATTCGGCC) of which the latter contains a nucleotide mismatch (underlined) to
create a Sau96I recognition site in case of the Gly460
allele sequence. The primers were designed according to the published ␣-adducin cDNA sequence.28
PCR was performed with 50 ng of genomic DNA in
a total volume of 20 ␮l containing 10 pmol of each
primer, 2 nmol dNTPs, 0.5 U Taq polymerase
(Perkin–Elmer, Foster City, CA, USA) in 1 × PCRbuffer for Taq-polymerase (10 mM Tris HCl pH 8.3;
50 mM KCl; 1.5 mM MgCl2; 0.001% gelatin)
(Perkin–Elmer), 1.5% formamide and 1.5 mM
MgCl2. PCR conditions were as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of
denaturation (94°C for 30 sec), annealing (60°C for
30 sec) and extension (72°C for 30 sec), with the
final extension at 72°C for 10 min. The PCR product
was digested with 1 U of Sau96I (New England Biolabs, Beverly, MA, USA) for 3 h in 37°C using the
buffer recommended by the manufacturer. The fragments were separated on 4.5% multipurpose agarose
gel with ethidium bromide and visualised under
ultraviolet light.
The study subjects were recruited from health care
centres in the Skaraborg and Scania regions in
southern Sweden and from the Botnia region in
western Finland. A total of 294 unrelated patients
with primary hypertension and 265 unrelated healthy normotensive control subjects from Sweden
were first enrolled in the study. We then used a
population of 80 unrelated patients with primary
hypertension and 154 unrelated healthy normotensive controls from Finland to replicate the findings.
Patients with primary hypertension had either a
diagnosis of established primary hypertension
before the age of 60 years and were on chronic pharmacological antihypertensive treatment, or had a
systolic and diastolic blood pressure above 160/95
mm Hg, respectively, at the time of the study examination and were less than 60 years old. If there was
any uncertainty concerning the diagnosis of primary
hypertension, the medical records were checked.
Subjects with diabetes mellitus, kidney disease, secondary hypertension or any other chronic disease
were excluded. The normotensive controls were
selected as follows: (1) systolic and diastolic blood
pressure ⭐150 mm Hg and ⭐85 mm Hg, respectively; (2) no personal history of elevated blood
pressure, diabetes mellitus or any other chronic disease; (3) absence of medication; and (4) no family
history of hypertension in first-degree relatives. The
clinical characteristics of the study subjects are
shown in Table 1.
The study was approved by the ethics committee
of the Medical Faculty of Lund University and all
the study participants had given a written informed consent.
Phenotyping
Blood pressure was measured in the supine position
after 5 min rest with a sphygmomanometer by specially trained nurses. Height was measured to the
nearest centimetre and weight to the nearest 0.1 kg.
Body mass index (BMI) was calculated as the ratio
Statistics
Frequency differences were estimated by ␹2-test and
differences in continuous variables by t-test and
ANOVA or Mann–Whitney and Kruskal–Wallis test
depending on whether the variable was normally
distributed or not, using a BMDP statistical package
(version 1.1). All tests were two sided and a P-value
of less than 0.05 was considered statistically significant.
Table 1 Clinical characteristics of study subjects. Continuous variables are given as means ± s.d.
Variable
Sex (% males)
Age (years)
BMI (kg/m2)
SBP (mm Hg)
DBP (mm Hg)
Proportion of subjects on
antihypertensive treatment (%)
Swedish
hypertensives
(n = 294)
Swedish
controls
(n = 265)
Finnish
hypertensives
(n = 80)
Finnish
controls
(n = 154)
All hypertensives
(n = 374)
All controls
(n = 419)
42.5
60.0 ± 10.7
27.8 ± 4.2
152 ± 18
85.9 ± 10.0
100
43.4
59.0 ± 10.3
26.1 ± 3.8*
125 ± 13*
71.5 ± 7.1*
0*
50.0
48.7 ± 8.6
28.7 ± 4.6
150 ± 18
94.6 ± 10.3
65
50.7
56.1 ± 9.9†
26.0 ± 3.5†
12.6 ± 13†
75.6 ± 6.2†
0†
44.1
57.6 ± 11.3
28.0 ± 4.3
151 ± 18
87.7 ± 10.7
92.5
46.1
58.0 ± 10.2
26.1 ± 3.7‡
125 ± 13‡
73.0 ± 7.0‡
0‡
All, Swedish and Finnish subjects pooled; *P ⬍ 0.001 Swedish controls vs Swedish hypertensives; †P ⬍ 0.001 Finnish controls vs
Finnish hypertensives; ‡P ⬍ 0.001 All controls vs All hypertensives.
Journal of Human Hypertension
␣-Adducin gene and primary hypertension
O Melander et al
Results
The genotype frequency distributions observed in
the Swedish and the Finnish populations were similar to those expected from the allele frequencies
according to the Hardy–Weinberg equilibrium.
The frequency of the Trp460 allele was lower in
hypertensive patients than in normotensive controls
in both the Swedish and the Finnish populations
(Table 2). Therefore we also performed a pooled
analysis of the two populations in which the frequency of the Trp460 allele was significantly lower
in hypertensive patients compared to normotensive
controls (Table 2). The genotype frequency distributions of the Gly460Trp polymorphism did not significantly differ between hypertensive patients and
normotensive controls either in the Swedish or in
the Finnish population but approached a significant
difference in the pooled material (P = 0.05) (Table 3).
The proportion of subjects carrying the Trp-Trp or
the Trp-Gly codon 460 genotypes was significantly
lower in hypertensive patients than in normotensive
controls in the pooled material (31.3% vs 38.2%,
P = 0.04). There was no significant difference
between carriers of the different codon 460 genotypes (Trp-Trp, n = 24; Trp-Gly, n = 144; and GlyGly, n = 279) among study subjects who were not on
antihypertensive medication (n = 447) either for systolic (128 ± 18; 127 ± 15; and 129 ± 17 mm Hg, NS)
or for diastolic blood pressure (75.6 ± 12.1;
74.7 ± 9.3 and 75.0 ± 10.4 mm Hg, NS). Except for a
± 10.4 slight difference in diastolic blood pressure
in Swedish hypertensive patients and in Finnish
hypertensive patients, of whom the majority were
on treatment (Table 1), there was no difference in
blood pressure between carriers of the different
genotypes in any of the groups studied (Table 3).
Discussion
The Trp460 allele of the Gly460Trp polymorphism
has been suggested to be associated with salt sensitivity and primary hypertension.20 In the present
study, performed in two Scandinavian case-control
populations, the frequency of the Trp460 allele was
not increased in patients with primary hypertension
which is in line with some other recent studies.24 –26
Table 2 Allele frequencies of the Gly460Trp polymorphism in
hypertensives and controls
460 allele
Swedish hypertensives
(n = 294)
Swedish controls (n = 265)
Finnish hypertensives (n = 80)
Finnish controls (n = 154)
All hypertensives (n = 374)
All controls (n = 419)
Trp
Gly
104 (17.7%)*
484 (82.3%)
122
23
60
127
182
408
137
248
621
656
(23.0%)
(14.4%)
(19.5%)
(17.0%)†
(21.7%)
(77.0%)
(85.6%)
(80.5%)
(83.0%)
(78.3%)
All, Swedish and Finnish subjects pooled. *P = 0.03 for difference
in allele frequency between Swedish hypertensives and Swedish
controls; †P = 0.02 for difference in allele frequency between All
hypertensives and All controls.
Table 3 Genotype frequency distributions and blood pressure
values in different codon 460 genotype carriers. Blood pressure
values are given as means ± s.d.
45
Codon 460 genotype
Trp-Trp
Trp-Gly
Gly-Gly
Swedish HT (n = 294)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
8 (2.7)
137 ± 13
78.3 ± 9.6
88 (29.9)
198 (67.4)
153 ± 17
152 ± 19
87.5 ± 8.7 85.5 ± 10.4*
Swedish NT (n = 265)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
15 (5.7)
123 ± 14
70.7 ± 5.4
92 (34.7)
125 ± 12
72.2 ± 8.0
158 (59.6)
125 ± 13
71.2 ± 6.6
Finnish HT (n = 80)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
2 (2.5)
172 ± 3
110.0 ± 11.3
Finnish NT (n = 154)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
7 (4.5)
126 ± 10
76.3 ± 4.5
All HT (n = 374)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
10 (2.7)
107 (28.6) 257 (68.7)
144 ± 19
151 ± 18
152 ± 18
84.6 ± 16.3 88.1 ± 8.8 87.7 ± 11.1
All NT (n = 419)
Genotypes, n (%)
SBP (mm Hg)
DBP (mm Hg)
22 (5.3)
124 ± 13
72.5 ± 5.7
19 (23.8)
59 (73.7)
145 ± 22
150 ± 16
91.1 ± 9.0 95.2 ± 10.2*
46 (29.9)
125 ± 14
76.2 ± 6.5
101 (65.6)
126 ± 13
75.3 ± 6.2
138 (32.9) 259 (61.8)
125 ± 13
126 ± 13
73.6 ± 7.7 72.8 ± 6.8
All, Swedish and Finnish subjects pooled; HT, patients with primary hypertension; NT, healthy control subjects; *P ⬍ 0.05
(ANOVA).
In contrast, the frequency of the Trp460 allele was
significantly lower in hypertensive patients than in
normotensive controls in the Swedish study population (P = 0.03) and in the two study populations
pooled (P = 0.02). This constitutes strong evidence
against a significant role for the Trp460 allele in the
pathogenesis of primary hypertension. The size of
our pooled Scandinavian material (374 hypertensive
patients and 419 normotensive controls) is of the
same magnitude as the size of the pooled FrenchItalian material in which the association of the
Trp460 allele to primary hypertension was originally described (477 hypertensive patients and 332
normotensive controls).20 Furthermore, the definition of primary hypertension and the inclusion
criteria for controls in our study were very similar
to the ones used in both the French29,30 and Italian
populations19 studied in the original report.20 Thus,
there are no obvious clinical differences between the
subjects used or differences in power between the
two studies which could explain the divergent
results. The fact that the frequency of the Trp460
allele was significantly lower in hypertensive
patients than in normotensive controls in the Swedish population and in the Swedish and Finnish
populations pooled, raises the possibility that
another variant located within a short genetic distance, elsewhere in the ␣-adducin gene or in another
gene nearby, is in linkage disequilibrium with the
Journal of Human Hypertension
␣-Adducin gene and primary hypertension
O Melander et al
46
Gly460Trp polymorphism and confers increased
susceptibility to hypertension.
In conclusion, our results strongly argues against
a pathogenic role of the Trp460 variant in human
primary hypertension. The results rather suggest
that another variant in linkage disequilibrium with
the Gly460Trp polymorphism increases susceptibility for hypertension.
Acknowledgements
This study was supported by grants from the Swedish Medical Research Council, the Swedish Heart
and Lung Foundation, the Medical Faculty of Lund
University, Malmö University Hospital, Skaraborg
Institute, the Skaraborg County Council, the Albert
Påhlsson Research Foundation, the Crafoord Foundation, the Ernhold Lundströms Research Foundation, the Sigrid Juselius Foundation and The
Region Skane. We thank Lena Rosberg for excellent
technical assistance.
13
14
15
16
17
18
References
1 Lifton RP, Jeunemaitre X. Finding genes that cause
human hypertension. J Hypertens 1993; 11: 231–236.
2 Ward R. Familial aggregation and genetic epidemiology of blood pressure. In: Laragh JH, Brenner BM
(eds). Hypertension: Pathophysiology, Diagnosis and
Management. Raven Press: New York, 1990, pp 81–
100.
3 Woolfson RG, de Wardener HE. Primary renal abnormalities in hereditary hypertension. Kidney Int 1996;
50: 717–731.
4 Barber BR, Ferrari P, Bianchi G. The Milan hypertensive strain: a description of the model. In: Ganten D,
de Jong W (eds). Handbook of Hypertension. Elsevier:
Amsterdam, 1994, pp 316–345.
5 Bianchi G et al. A possible primary role for the kidney
in essential hypertension. Am J Hypertens 1989; 2:
2s–6s.
6 Ferrari P et al. G. Sodium transport kinetics in erythrocytes and inside-out vesicles from Milan rats. J Hypertens 1991; 9: 703–711.
7 Ferrari P et al. Na+/K+/Cl− cotransport in resealed
ghosts from erythrocytes of the Milan hypertensive
rats. Biochim Biophys Acta 1992; 1111: 111–119.
8 Cusi D et al. Erythrocyte Na+,K+,Cl− cotransport and
kidney function in essential hypertension. J Hypertens
1993; 11: 805–813.
9 Bianchi G et al. Two point mutations within the adducin genes are involved in blood pressure variation.
Proc Natl Acad Sci USA 1994; 91: 3999– 4003.
10 Camussi A, Bianchi G. Genetics of essential hypertension. From the unimodal-bimodal controversy to molecular technology. Hypertension 1988; 12: 620–628.
11 Bianchi G et al. Blood pressure changes produced by
kidney cross-transplantation between spontaneously
hypertensive rats and normotensive rats. Clin Sci Mol
Med 1974; 47: 435– 448.
12 Guidi E et al. Hypertension may be transplanted with
Journal of Human Hypertension
19
20
21
22
23
24
25
26
27
28
29
30
the kidney in humans: a long-term historical prospective follow-up of recipients grafted with kidneys coming from donors with or without hypertension in their
families. J Am Soc Nephrol 1996; 7: 1131–1138.
Bianchi G et al. Renal dysfunction as a possible cause
of essential hypertension in predisposed subjects. Kidney Int 1983; 23: 870–875.
Salvati P, Ferrario RG, Parenti P, Bianchi G. Renal
function of isolated perfused kidneys from hypertensive (MHS) and normotensive (MNS) rats of the Milan
strain: role of calcium. J Hypertens 1987; 5: 31–38.
Salardi S et al. Erythrocyte adducin differential
properties in the normotensive and hypertensive rats
of the Milan strain. Characterization of spleen adducin
m-RNA. Am J Hypertens 1989; 2: 229–237.
Hughes CA, Bennett V. Adducin: a physical model
with implications for function in assembly of spectrinactin complexes. J Biol Chem 1995; 270: 18990–18996.
Matsuoka Y, Hughes CA, Bennett V. Adducin regulation. Definition of the calmodulin-binding domain
and sites of phosphorylation by protein kinases A and
C. J Biol Chem 1996; 271: 25157–25166.
Tripodi G et al. Hypertension-associated point
mutations in the adducin alpha and beta subunits
affect actin cytoskeleton and ion transport. J Clin
Invest 1996; 97: 2815–2822.
Casari G et al. Association of the alpha-adducin locus
with essential hypertension. Hypertension 1995; 25:
320–326.
Cusi D et al. Polymorphisms of alpha-adducin and salt
sensitivity in patients with essential hypertension.
Lancet 1997; 349: 1353–1357.
Castellano M et al. Alpha-adducin gene polymorphism
and cardiovascular phenotypes in a general population. J Hypertens 1997; 15: 1707–1710.
Tamaki S et al. Polymorphism of alpha-adducin in
Japanese patients with essential hypertension. Hypertens Res 1998; 21: 29–32.
Manuta P et al. ␣-Adducin polymorphisms and renal
sodium handling in essential hypertensive patients.
Kidney Int 1998; 53: 1471–1478.
Kato N et al. Lack of association between the alphaadducin locus and essential hypertension in the
Japanese population. Hypertension 1998; 31: 730–733.
Kamitani A et al. Human alpha-adducin gene, blood
pressure, and sodium metabolism. Hypertension 1998;
32: 138–143.
Ishikava K et al. No association between alpha-adducin 460 polymorphism and essential hypertension in
a Japanese population. Am J Hypertens 1998; 11:
502–506.
Vandenplas S et al. Blot hybridisation analysis of genomic DNA. J Med Genet 1984; 21: 164 –172.
Joshi R et al. Primary structure and domain organization of human alpha and beta adducin. J Cell Biol
1991; 115: 665–675.
Bonnardeaux A et al. Lack of evidence for linkage of
the endothelial cell nitric oxide synthase gene to
essential hypertension. Circulation 1995; 91: 96–102.
Soubrier F et al. Similar frequencies of renin gene
restriction fragment legnth polymorphisms in hypertensive and normotensive subjects. Hypertension
1990; 16: 712–717.