This information is current as
of June 16, 2017.
Actinobacillus actinomycetemcomitans
Cytolethal Distending Toxin (Cdt): Evidence
That the Holotoxin Is Composed of Three
Subunits: CdtA, CdtB, and CdtC
Bruce J. Shenker, Dave Besack, Terry McKay, Lisa
Pankoski, Ali Zekavat and Donald R. Demuth
J Immunol 2004; 172:410-417; ;
doi: 10.4049/jimmunol.172.1.410
http://www.jimmunol.org/content/172/1/410
Subscription
Permissions
Email Alerts
This article cites 32 articles, 13 of which you can access for free at:
http://www.jimmunol.org/content/172/1/410.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2004 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
References
The Journal of Immunology
Actinobacillus actinomycetemcomitans Cytolethal Distending
Toxin (Cdt): Evidence That the Holotoxin Is Composed of
Three Subunits: CdtA, CdtB, and CdtC1
Bruce J. Shenker,2* Dave Besack,* Terry McKay,* Lisa Pankoski,* Ali Zekavat,* and
Donald R. Demuth†
A
ctinobacillus actinomycetemcomitans, a nonmotile,
Gram-negative coccobacillus, is associated with several
human diseases. These include endocarditis, meningitis,
osteomyelitis, s.c. abscesses, endophthalmitis, and periodontal disease (1–7). Although the pathogenic mechanism(s) by which A.
actinomycetemcomitans acts to cause disease is not known, it has
been shown to produce several potential virulence factors capable
of facilitating colonization, destroying host tissue, inhibiting tissue
repair, and interfering with host defenses (reviewed in Ref. 6).
With respect to the latter, several studies suggest that impaired host
defense mechanisms may contribute to infectious diseases associated with A. actinomycetemcomitans (reviewed in Refs. 6 and 8).
In this regard, we have previously shown that A. actinomycetemcomitans produces a heat-labile immunosuppressive factor that is
capable of inhibiting both human T and B cell function (9 –11).
Furthermore, we demonstrated that immunosuppression was due to
interference with the normal cell cycle progression of lymphocytes
resulting in G2 arrest. We have subsequently shown that the immunoinhibitory factor is a product of the cytolethal distending
toxin (cdt)3B gene, one of three genes encoding the Cdt (12–14).
Departments of *Pathology and †Biochemistry, University of Pennsylvania School of
Dental Medicine, Philadelphia, PA 19104
Received for publication July 18, 2003. Accepted for publication October 16, 2003.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by U.S. Public Health Service Grant DE06014.
2
Address correspondence and reprint requests to Dr. Bruce J. Shenker, Department of
Pathology, University of Pennsylvania, 240 South 40th Street, Philadelphia, PA
19104-6030. E-mail address: [email protected]
3
Abbreviations used in this paper: cdt, Cdt, cytolethal distending toxin; orf, open
reading frame.
Copyright © 2004 by The American Association of Immunologists, Inc.
The Cdts are a family of heat-labile protein cytotoxins produced
by several different bacterial species including diarrheal diseasecausing enteropathogens such as some Escherichia coli isolates,
Campylobacter jejuni, Shigella species, Haemophilus ducreyi, and
A. actinomycetemcomitans (15–21). There is now clear evidence
that Cdt is encoded by three genes, designated cdtA, cdtB, and
cdtC, which are arranged in an apparent operon (12–14, 22). These
three genes specify polypeptides with predicted or apparent molecular masses of ⬃24 to 35 kDa. The Cdts were first characterized
by their ability to cause progressive cellular distension and finally
death in some cell lines; it should be noted that the gross cellular
changes associated with Cdt activity are clearly different from
those caused by other known toxins that induce rapid morphological alterations culminating in cell death (23–26). Both the purified
immunosuppressive factor and rCdtB derived from A. actinomycetemcomitans are capable of inducing G2 arrest in the cell cycle
of mitogen-activated human T cells (12, 13). However, it should be
emphasized that Cdt-treated lymphocytes do not exhibit the morphologic alterations that are commonly observed with cell lines
such as HeLa cells, which are often used as a target cell to define
the action of the Cdts.
To date, limited information is available that defines the nature
of the Cdt holotoxin. Although we have shown that CdtB alone is
capable of inducing all the biological effects typically associated
with Cdt, our previous studies did not rule out a role for CdtA
and/or CdtC (13). Although several investigators agree with our
conclusion that CdtB is indeed the functional subunit, there is currently a controversy as to whether CdtC is also able to fulfill this
role or whether perhaps all three peptides are required to form the
holotoxin and for the expression of maximum toxic activity (27–
29). We now report that, although CdtB alone is indeed sufficient
to induce G2 arrest in human lymphocytes, both CdtA and CdtC
are required to achieve maximum cell cycle arrest. Moreover, we
0022-1767/04/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
We have shown the Actinobacillus actinomycetemcomitans produces an immunosuppressive factor encoded by the cytolethal
distending toxin (cdt)B gene, which is homologous to a family of Cdts expressed by several Gram-negative bacteria. We now report
that the capacity for CdtB to induce G2 arrest in Jurkat cells is greater in the presence of the other Cdt peptides: CdtA and CdtC.
Plasmids containing the cdt operon were constructed and expressed in Escherichia coli; each plasmid contained a modified cdt gene
that expressed a Cdt peptide containing a C-terminal His tag. All three Cdt peptides copurified with the His-tagged Cdt peptide.
Each of the peptides associated with the complex was truncated; N-terminal amino acid analysis of CdtB and CdtC indicated that
the truncation corresponds to cleavage of a previously described signal sequence. CdtA was present in two forms in crude extracts,
25 and 18 kDa; only the 18-kDa fragment copurified with the Cdt complexes. Cdt complexes were also immunoprecipitated from
A. actinomycetemcomitans extracts using anti-CdtC mAb. Exposure of Jurkat cells to 40 pg resulted in >50% accumulation of G2
cells. CdtB and CdtC were detected by immunofluorescence on the cell surface after 2-h exposure to the holotoxin. CdtA was not
detected by immunofluorescence, but all three peptides were associated with Jurkat cells when analyzed by Western blot. These
studies suggest that the active Cdt holotoxin is a heterotrimer composed of truncated CdtA, CdtB, and CdtC, and all three peptides
appear to associate with lymphocytes. The Journal of Immunology, 2004, 172: 410 – 417.
The Journal of Immunology
411
demonstrate that the holotoxin consists of a heterotrimeric complex of CdtA, CdtB, and CdtC. It should be noted that this complex
is composed of mature peptides in which a portion of its N-terminal sequence has been cleaved. Finally, we provide evidence that
all three peptides can be found associated with the lymphocytes
within 2 h of exposure to the holotoxin.
Materials and Methods
Cell culture and analysis of cell cycle
Table I.
Construction of plasmids expressing cdt genes
Several of the cdt gene constructs used in this study were derived from the
pUCAacdt2 plasmid as previously described (13); this plasmid contains
cdtA, cdtB, cdtC, a small upstream open reading frame (orf)2, and an additional 2.5 kb of sequence downstream of the cdtC gene. A series of
plasmids were constructed that lacked one or more of the open reading
frames present in pUCAacdt2. These plasmids were prepared by first digesting pUCAacdt2 with NheI, which cleaves within the cdtA gene, and
EcoRI, which cleaves in the pUC multiple cloning region (13). The resulting 3.2-kb DNA fragment contains the plasmid vector, orf2, and the first
250 residues of the cdtA gene. PCR products were then generated from
several primer pairs (see Table I) to generate a product that possesses an
upstream NheI site and a downstream EcoRI site. The resulting fragments
were subsequently ligated to the 3.2-kbp product from the restriction digestion above. Ligation with the 1946-bp P1/P1 product yielded pUCAacdtABC, which contains orf2, cdtA, cdtB, and cdtC, but lacks the 2.5-kb
sequence downstream of the cdt operon. Plasmid pUCAacdtAB, which
contains orf2, cdtA, and cdtB, was produced by ligation with the 1350-bp
P3/P4 product, and pUCAacdtA, containing only orf2 and cdtA, resulted
from ligation with the 430-bp P3/P19 product.
Plasmid pUCAacdtAC, containing the cdtA and cdtC genes, was prepared by first using P5/P6 and P7/P8 to amplify cdtA (including orf2) and
A. actinomycetemcomitans Cdt plasmid constructs
Plasmid
Primer
Sequence
PCR
Product
Size (bp)
Genes Expressed by
Construct
pUCAacdtABC
P1
P2
GGGGCACTGTTGACTGTCTGG
CCGAATTCTTAGCTACCCTGATTTCTCC
1946
orf2, cdtA, cdtB, cdtC
pUCAacdtAB
P3
P4
GGGGCACTGTTGACTGTCTGG
CCGAATTCCTCCTTAGCGATCACGAAC
1350
orf2, cdtA, cdtB
pUCAacdtAC
P5
P6
P7
P8
GGCCCGGGATAGGTGAATAATAGATG
CCGAGCTCTTAATTAACCGCTGTTGCTTC
GGGAGCTCAAGGAGAATACTATGAAA
CCGAATTCTTAGCTACCCTGATTTCTCC
927
orf2, cdtA, cdtC
P9
P10
GTTACCCGTTTCCCGGGATAGGTGAATA
GACTTAAGTTAGTGGTGGTGGTGGTGGTGATTAA
CCGCTGTTGCTTCTA
GACCCGGGCTTAAGCTAAGGAGTTTATATGCA
GCATAATCTAAAATATTACCGGACCGATGA
956
GAACCGACTCATCGGTCCGGTAATA
GACTTAAGTTAGTGGTGGTGGTGGTGGTGGCGAT
CACGAACAAAACTA
GACGGTCCGCTTAAGGAGAATACTATGAAA
GAGAATTCTTAGCTACCCTGATTTCTCCCCA
197
pUCAacdtAhisBC
P11
P12
pUCAacdtABhisC
P13
P14
P15
P16
616
orf2, cdtAhis, cdtB, cdtC
746
orf2, cdtA, cdtBhis, cdtC
593
pUCAacdtABChis
P17
P18
GAACCGACTCATCGGTCCGGTAATA
GAGAATTCTTAGTGGTGGTGGTGGTGGTGGCTAC
CCTGATTTCTCCCCA
768
orf2, cdtA, cdtB, cdtChis
pUCAacdtA
P3
P19
GGGGCACTGTTGACTGTCTGG
CCGAATTCTTAATTAACCGCTGTTGCTTC
430
orf2, cdtA
pUCAacdtC
P20
P21
GCCTGCAGTGAATCAAATCCTGATCC
GCGGATCCTTAGCTACCCTGATTTCTCC
518
cdtC
pUCAacdtA-GST
P22
P23
GCGGATCCAAGAAGTTTTTACCTG
GCGAATTCTTAATTAACCGCTGTTGC
682
cdtA-GST
pUCAacdtB-his
P24
P25
GCCTGCAGTAACTTGAGTGATTTC
GCGGATCCTTAGTGGTGGTGGTGGTGGTGGCGAT
CACGAAC
821
cdtBhis
pUCAacdtc-GST
P26
P27
GCGGATCCGAATCAAATCCTGATCCG
GCGAATTCTTAGCTACCCTGATTTCTCCCC
517
cdtC-GST
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
The T cell leukemia cell line Jurkat (E6-1; American Type Tissue Culture
Collection, Manassas, VA) was maintained in RPMI 1640 supplemented
with 10% FCS, 2 mM glutamine, 10 mM HEPES, 100 U/ml penicillin, and
100 ␮g/ml streptomycin. Cells were harvested in mid-log growth phase and
plated at 5 ⫻ 105 cells/ml in 24-well tissue culture plates. The cells were
exposed to medium or the toxin preparation as indicated and incubated for
18 h. To measure Cdt-induced cell cycle arrest, Jurkat cells were washed
and fixed for 60 min with cold 80% ethanol. After washing, the cells were
stained with 10 ␮g/ml propidium iodide containing 1 mg/ml RNase (Sigma-Aldrich, St. Louis, MO) for 30 min. Samples were analyzed on a FACStarPlus flow cytometer (BD Biosciences, San Jose, CA). Propidium iodide
fluorescence was excited by an argon laser operating at 488 nm, and fluorescence was measured with a 630/22-nm bandpass filter using linear
amplification. A minimum of 15,000 events was collected on each sample;
cell cycle analysis was performed using Modfit (Verity Software House,
Topsham, ME).
412
Analysis and isolation of expressed peptides
The plasmids were constructed so that the cdt genes were under control of
the lac promotor; all ligation mixtures were transformed into E. coli DH5␣.
Cultures of transformed E. coli were grown in 500 ml of LB broth and
induced with 0.1 mM isopropyl ␤-D-thiogalactoside for 2 h; bacterial cells
were harvested, washed, and resuspended in 50 mM Tris (pH 8.0). The
cells were frozen overnight, thawed, and sonicated. Extracts were analyzed
for the presence of Cdt peptides by Western blot (described below) and for
immunosuppressive activity, which was defined based upon the induction
of G2 arrest in Jurkat cells (see above; Ref. 12).
Histidine-tagged peptides were isolated by nickel affinity chromatography as previously described (13). Briefly, the sonicated bacterial extracts
were applied to a histidine-binding column (HiTrap Chelating HP; Amersham Biosciences, Uppsala, Sweden). The column was washed, and Histagged proteins were eluted with 500 mM imidazole.
The CdtABChis peptides were subjected to N-terminal amino acid analysis using Edmund degradation. Sequencing was performed on an Applied
Biosystems (Foster City, CA) Procise sequencer using manufacturer’s software by the Wistar Protein and Molecular Biology Core facility (Wistar
Institute, Philadelphia, PA). The derived N-terminal peptide sequence was
compared with known protein sequences using the National Center for
Biotechnology Information Blast program.
Expression of cdtBhis and cdtA-gst gene and isolation of
recombinant protein
PUCAacdtBhis encodes cdtB with a C-terminal histidine tag, but lacking
the signal sequence. The plasmid was prepared as previously described
(13). The resulting plasmid was digested with PstI and BamH1 to remove
the insert, which was subsequently ligated into pUC19 under control of the
lac operator and used to transform E. coli DH5␣.
Cultures of transformed E. coli pUCAacdtBhis were grown as described
above. The cells were frozen overnight, thawed, and sonicated. The expressed protein was contained in inclusion bodies, which were isolated,
solubilized, and refolded using a modification of the procedure that we
previously described (13). Briefly, the inclusion bodies were isolated by
centrifugation (10,000 ⫻ g) and washed in 50 mM Tris (pH 8.0) containing
2 M urea. The inclusion bodies were solubilized in 50 mM Tris (pH 8.0)
containing 8 M urea and 100 mM 2-ME; solubilization was allowed to
proceed for 2 h at 37°C. Following centrifugation, the solubilized protein
was isolated on a histidine-binding column. The isolated protein was then
refolded by sequential dialysis in 4, 2, 1, and 0.5 M urea in PBS (pH 7.4);
the final dialysis was with PBS (pH 7.4) containing 200 ␮M glutathione
and 0.4 M L-arginine.
A plasmid that directs the expression of the CdtC protein was constructed in pGEX-6p-2 to generate a GST fusion protein as previously
described (13). PUCAacdtA-GST was similarly prepared by ligation of the
666-bp P22/P23 PCR product (see Table I) into pGEM-T. The insert was
then isolated from the resulting plasmid by digestion with BamH1 and
EcoRI, ligated into pGEX-6p-2, and transformed into E. coli DH5␣. The
GST-fusion proteins were purified as previously described (13) and used to
generate antisera and mAb.
FIGURE 1. Effect of single-gene deletions on A. actinomycetemcomitans Cdt-induced G2 arrest. A, Jurkat cells were exposed to varying concentrations
(micrograms per milliliter) of cell extract derived from E. coli transformed with pUCAacdtABC (F), pUCAacdtAB (‚), pUCAacdtBC (䡺), pUCAacdtAC
(E), or pUC19 (〫) and subjected to cell cycle distribution based upon propidium iodide fluorescence using flow cytometry. Results are plotted as
percentage of G2 cells (mean ⫾ SD) of three experiments vs extract protein concentration; SD is indicated by bars. ED50 values, which represent the
concentration required to induce 50% G2 cells, are shown in the inset. Cell cycle distribution for control cells (exposed to medium only) was 48.9 ⫾ 2.0%
(G0/G1), 35.7 ⫾ 2.3% (S), and 15.4 ⫾ 1.4% (G2/M). B, Shown is a Western blot analysis of E. coli extracts derived from cdt gene-containing plasmids.
Cell extracts were fractionated by SDS-PAGE and analyzed by Western blot using anti-CdtB mAb, anti-CdtC mAb, and anti-CdtA polyclonal sera. The
blots were analyzed by digitized scanning densitometry; the numbers indicate the relative density in comparison to pUCAacdtABC. Results are representative of three experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
cdtC, respectively. The PCR products were ligated to pGEM-T (Promega,
Madison, WI), and the plasmids were transformed into E. coli DH5␣ (Invitrogen, Carlsbad, CA). The inserts were isolated by digestion with XmaI/
SacI (cdtA) and SacI/EcoRI (cdtC); cdtC was then ligated to pUC19 following digestion of the plasmid with SacI/EcoR1; the resulting plasmid
was then digested with XmaI/SacI and ligated to cdtA.
Plasmid pUCAacdtBC, in which cdtA was inactivated, was prepared by
digesting pUCAacdtABC with NheI, and then blunting with Klenow polymerase, followed by religation. The resulting plasmid thus contains a
frameshift mutation in the cdtA gene.
PUCAacdtC, which contains only cdtC, was constructed from the P20/
P21 PCR product, which was first ligated to pGEM-T, digested with PstI
and BamHI, and then ligated to pUC19.
Three additional plasmids were constructed that contain orf2 and the
three cdt genes; each plasmid contains a penta-His sequence that encodes
a C-terminal His tag on either cdtA (pUCAacdtAhisBC), cdtB (pUCAacdtABhisC), or cdtC (pUCAacdtABChis). To construct pUCAacdtAhisBC, two
PCR products were generated using the P9/P10 (SmaI-cdtAhis-AflII) and
P11/P12 (SmaI-AflII-cdtB-RsrII) primer pairs; the latter PCR product and
pUCAacdtABC were digested with SmaI/RsrII and ligated. The intermediate plasmid and the SmaI-cdtAhis-AflII PCR product were digested with
SmaI/AflII and ligated. PUCAacdtABhisC was constructed from two PCR
products P13/P14 (RsrII-cdtBhis-AflII) and P15/P16 (RsrII-AflII-cdtCEcoRI); the latter PCR product and PUCAacdtABC were digested with
EcoRI/RsrII and ligated. The intermediate plasmid along with the other
PCR product were digested with RsrII/AflII and ligated. PUCAacdtABChis
was generated from the PCR product produced with P17/P18 (RsrII-cdtBcdtChis-EcoRI). The PCR product and pUCAacdtABC were digested with
EcoRI and RsrII and then ligated.
A. actinomycetemcomitans Cdt IS A HETEROTRIMER
The Journal of Immunology
413
Western blot analysis of Cdt plasmid constructs and Cdt-treated
Jurkat cells
Relative expression of Cdt peptides by E. coli transformed by the various
plasmid constructs was assessed by Western blot analysis. Briefly, 20 ␮g
of each extract was separated by 10% SDS-PAGE and then transferred to
nitrocellulose. The membrane was blocked with BLOTTO and then incubated with primary Abs for 18 h at 4°C (12). CdtA was detected with a
polyclonal rabbit antisera; CdtB and CdtC were detected with mAb:
CdtB19D6 and Cdtc6C11, respectively. His-tagged proteins were detected
with anti-His mAb (Novagen, Madison, WI). Membranes were washed,
incubated with either goat anti-mouse Ig (1/1000 dilution; Southern Biotechnology Associates, Birmingham, AL) or donkey anti-rabbit (1/1000;
Amersham Biosciences) conjugated to HRP. The Western blots were developed using chemiluminescence (ECL; Amersham Biosciences) and analyzed by digital densitometry (Kodak Image Systems, Rochester, NY).
Flow-cytometric and Western blot analysis of Jurkat cells for
Cdt peptides
Jurkat cells (2 ⫻ 106) were incubated in the presence of medium alone or
2 ␮g/ml AhisBC, ABhisC, or ABChis for 2 h. The cells were washed, exposed to normal mouse IgG (10 ␮g/ml; Zymed Laboratories, San Francisco, CA), and then stained (30 min) for cell surface Cdt peptides with
anti-His mAb (2.5 ␮g; Novagen) conjugated to Alexa Fluor 488 (Zenon
One Alexa Fluor; Molecular Probes, Eugene, OR) according to the manufacturer’s directions; normal mouse IgG similarly conjugated was used as
a control. After washing, the cells were fixed in 2% paraformaldehyde and
analyzed by flow cytometry as previously described (12).
The association of Cdt peptides with Jurkat cells was also analyzed by
Western blot. Jurkat cell cultures were incubated as described for the FACS
experiments. Replicate cultures were pooled, washed, and resuspended in
PBS containing 0.1 mM PMSF (12); SDS sample buffer and reducing agent
(Invitrogen) were added, and the samples were fractionated by 10% SDSPAGE and transferred to nitrocellulose. The membrane was blocked with
BLOTTO and then incubated with anti-His mAb (100 ng/ml; Novagen) for
18 h at 4°C. Membranes were washed and incubated with goat anti-mouse
Ig (1/1000 dilution; Southern Biotechnology Associates) conjugated to
HRP; the blots were developed using chemiluminescence and analyzed as
described above.
Immunoprecipitation of Cdt peptides from A.
actinomycetemcomitans cell extract
Anti-CdtC mAb (CdtC6C11) was immobilized using protein G (Seize X
protein G immunoprecipitation kit; Pierce, Rockford, IL) according to the
FIGURE 3. Isolation and analysis of His-tagged Cdt complexes. A, Histagged peptides were purified from cell extracts derived from E. coli transformed with pUCAacdtAhisBC, pUCAacdtABhisC, or pUCAacdtABChis,
using a histidine-binding column. Immobilized peptides were eluted with
imidazole and analyzed by SDS-PAGE and Western blot. The top panel
represents the Coomassie-stained SDS-PAGE gel. Lower panels represent
Western blots developed with anti-His mAb, anti-CdtA sera, and anti-CdtB
and anti-CdtC mAb. Data are representative of at least three experiments.
B, Shown are the results of N-terminal amino acid analysis that was performed on each of the three peptides recovered from the histidine-binding
column after pUCAacdtABChis-derived extracts were applied. The numbers represent the corresponding residue in the deduced amino acid sequence for each of the Cdt peptides.
manufacturer’s specifications. The immobilized Ab (500 ␮g) was incubated overnight with 500 ␮g of crude soluble sonic extract prepared from
A. actinomycetemcomitans as previously described (11). After extensive
washing of the Ab-gel matrix, Cdt peptides were eluted at pH 2.8; the
elution was neutralized by the addition of 1 M Tris (pH 9.5). Samples were
then fractionated by SDS-PAGE and analyzed by Western blot as described above.
Production of polyclonal antisera and mAbs to Cdt peptides
CdtA and CdtC were expressed as GST fusion proteins and purified as
described above; rCdtB containing a C-terminal histidine tag was purified
as described. Anti-CdtB and -CdtC mAb were generated as previously
described (24). Briefly, BALB/c mice (Charles River Breeding Laboratories, Wilmington, MA), 10 –12 wk old, were immunized by i.p. injection
with 10 –20 ␮g of Cdt peptide on days 0, 10, 20, and 30, and allowed to rest
for 30 days. Three days before fusion, the animals received 10 ␮g of
peptide i.v. Splenocytes were fused to Sp2/0-Ag14 myeloma cells in the
presence of 50% polyethylene glycol (Kodak 1450). The cells were then
dispersed in Kennett’s HY medium containing 20% FBS, glutamine, oxaloacetate, pyruvate, hypoxanthine, and azaserine. The cells were fed 7
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 2. Effect of CdtA and CdtC on CdtB-induced G2 arrest. Jurkat
cells were treated with varying concentrations of CdtB in the absence (F)
or presence (E) of 1 ␮g/ml cell extracts derived from E. coli transformed
with pUCAacdtA and pUCAacdtC. After 18 h, cells were analyzed for cell
cycle distribution by flow cytometry based upon propidium iodide fluorescence. The percentage of G2 cells (mean ⫾ SD) for three experiments is
plotted vs CdtB concentration. ED50 values are presented in the inset. Control cells exposed to medium only averaged 16.6% G2 cells.
414
A. actinomycetemcomitans Cdt IS A HETEROTRIMER
days later in medium lacking azaserine. Clones were visible 7–9 days after
fusion and were screened by ELISA when they covered approximately
one-half of the bottom of the well.
Polyclonal antisera to CdtA was generated in rabbits (New Zealand
White; Charles River Breeding Laboratories) by injecting animals with 25
␮g of protein on days 0, 10, 20, and 30. Rabbit sera were screened for
anti-CdtA Abs by Western blot.
Results
Previously, we generated several plasmids that express various
combinations of the A. actinomycetemcomitans cdt genes to determine the requirement of individual genes for the expression of
toxin activity. These experiments suggested that expression of
cdtB alone is sufficient to induce G2 arrest in human T cells; however, they left open the possibility that either CdtA and/or CdtC
also contributed to maximal expression of toxic activity. To determine the role of CdtA and CdtC, we first analyzed extracts
derived from E. coli transformed with each of these plasmids for
their relative capacity to induce G2 arrest in the T cell leukemia
cell line, Jurkat. As shown in Fig. 1A, maximum toxin activity was
observed when all three cdt genes were present (pUCAacdtABC).
Significant, albeit reduced, activity was also observed in extracts
derived from plasmids that contain both the cdtA/cdtB or the cdtB/
cdtC genes; ED50 values (defined as the amount of extract protein
required to induce cell cycle arrest resulting in 50% G2 cells) were
28.2 ␮g/ml (pUCAacdtAB) and 14.8 ␮g/ml (pUCAacdtBC) compared with 0.0004 ␮g/ml (pUCAacdtABC) when all three cdt
genes were present. No toxin activity was observed from extracts
derived from pUCAacdtAC, which lacks the cdtB gene or from the
pUC control. To determine whether differences in toxin activity
were due to variances in peptide expression, we also compared the
extracts for the level of Cdt peptide expression by Western blot
(Fig. 1B). With the exception of pUCAacdtBC, all extracts contained similar levels of the Cdt protein. It is not clear why expression of CdtB and CdtC are reduced in pUCAacdtBC; however, the
level of the peptides do not account for the differences in activity
observed between pUCAacdtABC and those extracts derived from
plasmids lacking either the cdtA or cdtC gene. Moreover, these
results raise the possibility that CdtB and CdtC form a more active
toxin than CdtA and CdtB. It is noteworthy that all extracts derived
from plasmids containing the cdtA gene contained two immuno-
reactive peptides; one peptide had a molecular mass of ⬃25 kDa
presumably corresponding to the full-length product and a smaller
18-kDa peptide. The level of expression of the 25-kDa peptide was
similar for all plasmids, whereas the 18-kDa peptide was slightly
reduced in pUCAacdtAB and pUCAacdtAC extracts.
The next series of experiments were conducted to further demonstrate the requirement for all three Cdt peptides in expression of
maximum toxic activity. Previously, we reported that rCdtB alone
is able to induce G2 arrest in lymphocytes; similarly, as shown in
Fig. 2, rCdtB is capable of inducing G2 arrest in Jurkat cells. Furthermore, the addition of 1 ␮g/ml each extract derived from pUCAacdtA and pUCAacdtC significantly increased CdtB toxicity;
the ED50 for CdtB alone was reduced from 2.5 to 0.02 ␮g/ml in the
presence of extracts containing CdtA and CdtC. Similar results
were observed for extracts derived from pUCAacdtAC (results not
shown). It should be noted that the effect of CdtA and CdtC was
concentration dependent; further increases in extract concentration
lowered the ED50 value for CdtB, and likewise, decreases in extract levels resulted in higher ED50 values (results not shown). The
addition of extract from either pUCAacdtA and pUCAacdtC
caused a small, but reproducible, decrease in the ED50 for CdtB. At
concentrations tested (0.1–20 ␮g/ml), pUCAacdtA and pUCAacdtC alone were not capable of inducing G2 arrest; furthermore, the
addition of control extracts derived from pUC19 had no effect on
CdtB toxicity.
Although the nature of the Cdt holotoxin is not known, our
results suggest that, to produce maximum toxicity, the toxin is
most likely composed of all three Cdt peptides. To explore this
possibility, we constructed three plasmids, pUCAacdtAhisBC, pUCAacdtABhisC, and pUCAacdtABChis, all of which contain the cdt
operon, but express peptides with a His tag on CdtA, CdtB, or
CdtC, respectively. Following transformation and expression in E.
coli, the His-tagged peptides were immobilized and purified using
histidine-binding columns. The purified peptides were analyzed by
SDS-PAGE and Western blot (Fig. 3A). In each instance, all three
Cdt peptides copurified with the Cdt peptide containing the His
tag. As expected, the His-tagged peptides migrated more slowly
than the normal counterpart and therefore appeared to have a
slightly higher molecular mass. CdtA migrated to a molecular
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 4. Nucleotide and encoded amino acid sequence of A. actinomycetemcomitans cdtA gene. The numbers on the right count the nucleotides
consecutively. The N-terminal amino acids of the truncated CdtA found as part of the CdtABChis complexes was determined by Edmunds degradation and
are shown underlined. Underlined sequences preceding and following the cdtA gene represent ribosome binding sites for the cdtA and cdtB gene,
respectively.
The Journal of Immunology
mass corresponding to ⬃18 kDa, suggesting that the complexes
contain the truncated form of CdtA, which was also present in
other E. coli extracts (Fig. 1B). Identity of each peptide was also
confirmed using mAbs that recognize CdtB or CdtC, or a polyclonal sera that recognizes CdtA (Fig. 3A). Because CdtB and
CdtC have been shown to contain a signal sequence, we wanted to
determine whether the toxin complex was composed of full-length
peptides or the cleaved product. N-terminal amino acid analysis
was performed on each of the three peptides isolated from the
extract derived from the pUCAacdtABChis plasmid (Fig. 3B). The
N terminus for CdtB and CdtC corresponds with residues 23 and
21, respectively, of the deduced amino acid sequence for these
proteins. In both instances, this is consistent with cleavage of the
signal sequence of these proteins (12). As noted in Fig. 1B, two
immunoreactive CdtA bands were observed in the E. coli extracts.
Interestingly, only the smaller fragment was found to be associated
with the complexes isolated on the His-binding columns. Analysis
of this peptide indicates that the N terminus of the truncated CdtA
FIGURE 6. Cell cycle analysis of His-tagged CdtABC complexes. Purified His-tagged Cdt complexes were analyzed for their capacity to induce
G2 arrest in Jurkat cells. Jurkat cells were treated with medium alone (A),
or 40 pg of either CdtAhisBC (B), CdtABhisC (C), or CdtABChis (D), and
subjected to cell cycle analysis 18 h later. Numbers represent the percentage of cells in the G0/G1, S, and G2/M phase of the cell cycle. Results are
representative of at least three experiments; 15,000 cells were analyzed for
each sample.
peptide corresponds to residue 59 of the deduced amino acid sequence of this protein (Fig. 4). It is noteworthy that, under the
conditions that we ran the histidine-binding columns, the fulllength CdtAhis eluted at lower concentrations of imidazole; no
other Cdt peptides were associated with this form of CdtA. In
addition, immunoprecipitation of the holotoxin from A. actinomycetemcomitans extracts with anti-CdtC mAb coprecipitated CdtA
and CdtB (Fig. 5A). It should be noted that, although both the
full-length and truncated CdtA peptides were present in the A.
actinomycetemcomitans extract, only the truncated form of CdtA
was immunoprecipitated with the holotoxin by anti-CdtC mAb.
Thus, CdtA may undergo unique processing during assembly of
the toxin.
Each of the His-tagged toxin complexes were also assessed
for their ability to interact with Jurkat cells. First, we tested the
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. Immunoprecipitation of A. actinomycetemcomitans Cdt holotoxin. Anti-CdtC mAb was immobilized using protein G and used to
immunoprecipitate CdtC from crude extracts of A. actinomycetemcomitans
strain 652. A, The crude extracts (C) and the immunoprecipitated (IP) Cdt
peptides were analyzed by Western blot with anti-CdtA sera, anti-CdtB
mAb, and anti-CdtC mAb; results with control IgG (Ctl) are also shown.
The immunoprecipitated complex was analyzed for its ability to induce cell
cycle arrest. B and C, Jurkat cells were exposed to medium (B) or 10 ng of
the toxin complex (C) and subjected to cell cycle analysis 18 h later. Numbers represent the percentage of cells in the G0/G1, S, and G2/M phase of
the cell cycle. Results are representative of two experiments.
415
416
A. actinomycetemcomitans Cdt IS A HETEROTRIMER
Discussion
complexes for toxin activity; Jurkat cells were exposed to 40 pg of
each of the purified complexes and then subjected to cell cycle
analysis 18 h later. As shown in Fig. 6, untreated cells exhibited a
typical cell cycle profile for Jurkat cells: 49.4% G0/G1 phase,
35.1% S phase, and 15.5% G2/M phase. In contrast, cells exposed
to either CdtAhisBC, CdtABhisC, or CdtABChis exhibited a significant increase in the percentage of cells in the G2/M phase: 69.4,
66.9, and 57.6%, respectively. The A. actinomycetemcomitans Cdt
holotoxin was biologically active; exposure of Jurkat cells to 10 ng
of holotoxin resulted in G2 arrest of 73% of the cells (Fig. 5, B and
C). We also analyzed Jurkat cells for the presence of Cdt peptides
by using immunofluorescence in conjunction with flow cytometry
(Fig. 7). Following exposure to the toxin complexes for 2 h, both
CdtB and CdtC were detected on the surface of Jurkat cells; mean
channel fluorescence increased from 7.8 in control cells to 12.7
(CdtB) and 29.9 (CdtC). The presence of CdtA was not detected in
these experiments. However, all three Cdt peptides were detected
in the Western blots of Jurkat cell lysates with the anti-His mAb
(Fig. 8). This suggests that the level of cell-associated CdtA may
be lower than CdtB and CdtC.
FIGURE 8. Western blot analysis of Jurkat cells treated with Cdt complexes. Jurkat cells were exposed to medium or 2 ␮g/ml CdtAhisBC,
CdtABhisC, or CdtABChis for 2 h; Cdt complexes used in these experiments
are identical with those characterized in Fig. 3. The cells were washed,
solubilized, and analyzed by Western blot following SDS-PAGE.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 7. Flow-cytometric analysis of Jurkat cells treated with Cdt
complexes. Jurkat cells were exposed to medium (A) and 2 ␮g/ml
CdtAhisBC (B), CdtABhisC (C), or CdtABChis (D) for 2 h. The cells were
then stained with anti-His mAb conjugated to PE and analyzed by flow
cytometry. Numbers represent the mean channel fluorescence. Results are
representative of three experiments.
All known Cdt operons contain three genes, cdtA, cdtB, and cdtC,
encoding proteins with similar molecular masses (20 –35 kDa).
However, there are conflicting reports regarding whether a single
gene or multiple cdt genes encode the holotoxin responsible for the
induction of cell cycle arrest in target cells. Our previous studies
demonstrated that CdtB alone was sufficient to induce lymphocytes
to undergo G2 arrest; however, these studies did not rule out the
possibility of a role for either CdtA or CdtC. Likewise, Frisk et al.
(28) and Wising et al. (30) showed that CdtB is the active component of the H. ducreyi Cdt; however, they also proposed that
toxicity is dependent upon the other two Cdt components. In another study, Lara-Tejero and Galan (31) used recombinant C. jejuni peptides to demonstrate that the holotoxin was likely composed of the three Cdt proteins. In contrast, Stevens et al. (29)
reported that cdtC encodes the structural toxin of H. ducreyi. In the
present study, we quantitatively analyzed a series of plasmids that
express various combinations of the cdt genes and demonstrate that
maximum toxin activity is dependent upon the availability of all three
cdt genes. Indeed, a holotoxin comprised of CdtABC was ⬎50,000fold more active than toxins composed of CdtAB or CdtBC. It is
noteworthy that the levels of Cdt peptides were comparable in extracts
derived from pUCAacdtABC and pUCAacdtAB; hence, the
⬎50,000-fold difference in activity cannot simply be explained by
variations in protein expression. Furthermore, pUCAacdtBC, which
expressses CdtB and CdtC, exhibited twice the activity of pUCAacdtAB (expressing CdtA and CdtB), yet the former plasmid expressed
approximately one-fifth the amount of CdtB protein. This suggests
that CdtB and CdtC form a more active toxin than CdtA and CdtB.
Finally, purified rCdtB was significantly more active (⬎100-fold) in
the presence of exogenous CdtA and CdtC, although the toxic activity
did not reach levels observed in pUCAacdtABC extracts. This could
reflect the requirement for processing of Cdt peptides.
The requirement for all three cdt genes for the production of a
maximally active toxin is consistent with observations on the Cdt
toxins of H. ducreyi (28) and C. jejuni (31). However, it is not
clear whether toxic activity arises from the independent action of
the three Cdt proteins or whether CdtA, CdtB, and CdtC associate
into an active heterotrimer. The physical composition of the Cdt
holotoxin has remained elusive, partially because of the difficulty
in purifying the putative holotoxin or the individual native proteins. To investigate the structure of the Cdt holotoxin, plasmids
containing the cdt operon were constructed with a penta-His sequence on either CdtA, CdtB, or CdtC. The expressed toxin was
then isolated by nickel affinity chromatography, and the purified
protein(s) were analyzed by Western blotting. Our results clearly
demonstrate that the purified toxin is a complex of all three Cdt
proteins. Moreover, we also demonstrated that the heterotrimeric
complex is not only present in crude extracts of A. actinomycetemcomitans, but it is also extremely active. These results indicate that the
holotoxin is not an artifact of expression of cdt genes in E. coli
It is noteworthy that, although pUCAacdtAhisBC, pUCAacdtABhisC, and pUCAacdtABChis contained the complete nucleotide
sequence for each of the cdt genes, N-terminal sequencing of the
purified peptides showed that each polypeptide was truncated. This
was not surprising for CdtB and CdtC, because their deduced
amino acid sequences clearly contain consensus signal sequences
and the N-terminal sequence was identical with the predicted mature protein sequence (12). However, a signal sequence has not
been previously identified for CdtA. It is particularly relevant that
all plasmids containing the cdtA gene expressed two immunoreactive CdtA bands corresponding to 25 and 18 kDa. Frisk et al.
(28) also observed similar CdtA peptides when H. ducreyi cdtA
The Journal of Immunology
Acknowledgments
We acknowledge the School of Dental Medicine Flow Cytometry and Imaging facility for their support of these studies. We would also like to thank
Drs. Kelly Jordan-Sciutto and Carolyn Gibson for their helpful discussions.
References
1. Zambon, J. J. 1985. Actinobacillus actinomycetemcomitans in human periodontal
disease. J. Clin. Periodontol. 12:1.
2. Salman, R. A., S. J. Bonk, D. G. Salman, and R. S. Glickman. 1986. Submandibular space abscess due to Actinobacillus actinomycetemcomitans. J. Oral
Maxillofac. Surg. 44:1002.
3. Patel, P. K., and M. W. Seitchick. 1986. Actinobacillus actinomycetemcomitans:
a new cause for granuloma of the parotid gland and buccal space. Plast. Reconstr.
Surg. 77:476.
4. Bromley, G. S., and M. Solender. 1986. Hand infection caused by Actinobacillus
actinomycetemcomitans. J. Hand Surg. 11:434.
5. Hofstad, T., and A. Stallemo. 1981. Subacute bacterial endocarditis due to Actinobacillus actinomycetemcomitans. Scand. J. Infect. Dis. 13:78.
6. Wilson, M., and B. Henderson. 1995. Virulence factors of Actinobacillus actinomycetemcomitans relevant to the pathogenesis of inflammatory periodontal diseases. FEMS Microbiol. Rev. 17:365.
7. Sullivan, P., W. Clark, and P. Kaiser. 2002. Bilateral endogenous endophthalmitis
caused by HACEK microorganism. Am. J. Ophthalmol. 133:144.
8. Shenker, B. J. 1987. Immunologic dysfunction in the pathogenesis of periodontal
diseases. J. Clin. Periodontol. 14:489.
9. Shenker, B. J., C.-C. Tsai, and N. S. Taichman. 1982. Suppression of lymphocyte
responses by Actinobacillus actinomycetemcomitans. J. Periodontal Res. 17:462.
10. Shenker, B. J., W. P. McArthur, and C. C. Tsai. 1982. Immune suppression
induced by Actinobacillus actinomycetemcomitans. I. Effects on human peripheral blood lymphocyte responses to mitogens and antigens. J. Immunol. 128:148.
11. Shenker, B. J., L. Vitale, and C. King. 1995. Induction of human T cells that
coexpress CD4 and CD8 by an immunomodulatory protein produced by Actinobacillus actinomycetemcomitans. Cell. Immunol. 164:36.
12. Shenker, B. J., T. L. McKay, S. Datar, M. Miller, R. Chowhan, and
D. R. Demuth. 1999. Actinobacillus actinomycetemcomitans immunosuppressive
protein is a member of the family of cytolethal distending toxins capable of
causing a G2 arrest in human T cells. J. Immunol. 162:4773.
13. Shenker, B. J., R. H. Hoffmaster, T. L. McKay, and D. R. Demuth. 2000. Expression of the cytolethal distending toxin (Cdt) operon in Actinobacillus actinoimycetemcomitans: evidence that the CdtB protein is responsible for G2 arrest
of the cell cycle in human T cells. J. Immunol. 165:2612.
14. Shenker, B. J., R. H. Hoffmaster, A. Zekavat, N. Yamguchi, E. T. Lally, and
D. R. Demuth. 2001. Induction of apoptosis in human T cells by Actinobacillus
actinomycetemcomitans cytolethal distending toxin is a consequence of G2 arrest
of the cell cycle. J. Immunol. 167:435.
15. Comayras, C., C. Tasca, S. Y. Peres, B. Ducommun, E. Oswald, and J. De Rycke.
1997. Escherichia coli cytolethal distending toxin blocks the HeLa cell cycle at
the G2/M transition by preventing cdc2 protein kinase dephosphorylation and
activation. Infect. Immun. 65:5088.
16. Okuda, J., M. Fukumoto, Y. Takeda, and M. Nishibuchi. 1997. Examination of
diarrheagenicity of cytolethal distending toxin: suckling mouse response to the
products of the cdtABC genes of Shigella dysenteriae. Infect. Immun. 65:428.
17. Okuda, J., H. Kurazono, and Y. Takeda. 1995. Distribution of the cytolethal
distending toxin A gene (cdtA) among species of Shigella and Vibrio, and cloning
and sequencing of the cdt gene from Shigella dysenteriae. Microb. Pathog. 18:
167.
18. Scott, D. A., and J. B. Kaper. 1994. Cloning and sequencing of the genes encoding Escherichia coli cytolethal distending toxin. Infect. Immun. 62:244.
19. Pickett, C. L., D. L. Cottle, E. C. Pesci, and G. Bikah. 1994. Cloning, sequencing,
and expression of the Escherichia coli cytolethal distending toxin genes. Infect.
Immun. 62:1046.
20. Mayer, M., L. Bueno, E. Hansen, and J. M. DiRienzo. 1999. Identification of a
cytolethal distending toxin gene locus and features of a virulence-associated region in Actinobacillus actinomycetemcomitans. Infect. Immun. 67:1227.
21. Pickett, C. L., and C. A. Whitehouse. 1999. The cytolethal distending toxin family. Trends Microbiol. 7:292.
22. Shenker, B. J., and I. Gray. 1976. Enrichment of PHA transformed lymphocytes
in samples containing mixed populations. J. Immunol. Methods 13:161.
23. Lally, E. T., I. R. Kieba, D. R. Demuth, J. Rosenbloom, E. E. Golub,
N. S. Taichman, and C. W. Gibson. 1989. Identification and expression of the
Actinobacillus actinomycetemcomitans leukotoxin gene. Biochem. Biophys. Res.
Commun. 159:256.
24. Lally, E. T., I. Kieba, A. Sato, C. Green, J. Rosenbloom, J. Korostoff, J. Wang,
B. J. Shenker, S. Ortlepp, M. Robinson, and P. C. Billings. 1997. RTX toxins
recognize a ␤2 integrin on the surface of human target cells. J. Biol. Chem.
272:30463.
25. Wang, J. F., I. R. Kieba, J. Korostoff, T. L. Guo, N. Yamaguchi, H. Rozmiarek,
P. C. Billings, B. J. Shenker, and E. T. Lally. 1998. Molecular and biochemical
mechanisms of Pasteurella haemolytica leukotoxin-induced cell death. Microb.
Pathog. 25:317.
26. Alfa, M. J., P. DeGagne, and P. A. Totten. 1996. Haemophilus ducreyi hemolysin
acts as a contact cytotoxin and damages human foreskin fibroblasts in cell culture.
Infect. Immun. 64:2349.
27. Li, L., A. Sharipo, E. Chaves-Olarte, M. Mascucci, V. Levitsky, M. Thelastam,
and T. Frisan. 2002. The Haemophilus ducreyi cytolethal distending toxin activates sensors of DNA damage and repair complexes in proliferating and nonproliferating cells. Cell. Microbiol. 4:87.
28. Frisk, A., M. Lebens, C. Johansson, H. Ahmed, L. Svensson, K. Ahlman, and
T. Lagergard. 2001. The role of different protein components from the Haemophilus ducreyi cytolethal distending toxin in the generation of cell toxicity. Microb.
Pathog. 30:313.
29. Stevens, M., J. Latimer, S. Lumbley, C. K. Ward, L. Cope, T. Lagergard, and
D. S. Hansen. 1999. Characterization of a Haemophilus ducreyi mutant deficient
in expression of cytolethal distending toxin. Infect. Immun. 67:3900.
30. Wising, C., L. Svensson, A. Aitken, V. Sundaeus, K. Ahlman, I. Jonsson,
L. Molne, and T. Lagergard. 2002. Toxicity and immunogenicity of purified
Haemophilus ducreyi cytolethal distending toxin in a rabbit model. Microb.
Pathog. 33:49.
31. Lara-Tejero, M., and J. E. Galan. 2001. CdtA, CdtB, and CdtC form a tripartite
complex that is required for cytolethal distending toxin activity. Infect. Immun.
69:4358.
32. Mao, X., and J. M. DiRienzo. 2002. Functional studies of the recombinant subunits of a cytolethal distending toxin. Cell. Microbiol. 4:245.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
was expressed in E. coli. Interestingly, only the 18-kDa fragment
was associated with the tripeptide Cdt complexes isolated from
both E. coli and A. actinomycetemcomitans extracts. The N terminus of the 18-kDa peptide (LLSSSKN) corresponds to residues
59 – 66 in the full-length protein, confirming that the molecular
mass of this peptide was ⬃6000 Da smaller than the complete
CdtA protein. A secondary sequence was also detected at much
lower concentration (LSSSKNG) corresponding to residues 60 –
66. The mechanism of posttranslational modification of CdtA is
not known. Moreover, it is likely that the complexes of truncated
peptides represent the active holotoxin. Our observations demonstrate not only that formation of the Cdt holotoxin requires all three
Cdt peptides but also that the active complex may require processing of CdtA. Preliminary studies using isogenically expressed fulllength peptides and truncated peptides confirm this requirement.
Flow-cytometric analysis of Jurkat cells treated for 2 h with
His-tagged toxin complexes demonstrated that CdtB and CdtC
could be detected on the surface of cells. Longer exposure times
(up to 4 h) did not result in increased immunofluorescence. CdtA
was not detected by immunofluorescence with the anti-His mAb.
However, CdtA was detected by Western blot analysis, suggesting
that all three Cdt peptides associate with cells. These findings differ from those of Mao and DiRienzo (32). One possible explanation for these differences is that they used full-length Cdt peptides
that contained an N-terminal His tag, whereas we used mature
proteins that are similar to that expressed by A. actinomycetemcomitans. Our failure to detect CdtA by flow cytometry could be
due to inaccessibility of the CdtA-His tag when either the complex
or peptide is associated with cells. Alternatively, it is possible that
CdtA is either rapidly released, internalized, or modified, so that it
is no longer immunologically reactive or available. Future experiments will focus on these possibilities as well as address whether
these peptides are internalized.
In conclusion, our results demonstrate that, whereas CdtB alone
is a potent immunoinhibitory factor capable of inducing G2 arrest
in lymphocytes, it is considerably more potent in the presence of
CdtA and CdtC. Moreover, the A. actinomycetemcomitans holotoxin appears to be composed of a tripeptide complex composed of
CdtA, CdtB, and CdtC, and furthermore, each of the proteins is
present in the active complex as truncated peptides. At this point,
it is premature to speculate as to whether the toxin simply acts at
the cell surface to trigger a signal transduction cascade or enters
the cell and interacts with specific subcellular targets. Clearly, further investigation is required to identify the cellular target(s) and
molecular events by which Cdts induce cell cycle arrest. Finally,
although the purified holotoxin is capable of inducing G2 arrest in
a number of cell types such as HeLa cells, it is most potent on
normal human lymphocytes and lymphoid cell lines, suggesting
that, from a pathogenic perspective, the toxin most likely acts as an
immunoinhibitory agent.
417