pTK-CLuc Vector | NEB

Home › Products › pTK-CLuc Vector
pTK-CLuc Vector
This product has been discontinued on 1/1/17 and replaced by N0317.
This product was discontinued on 01/01/2017
Catalog #
Product
Information
Size
FAQs &
Tech Tips
Protocols &
Manuals
Concentration
Other Tools &
Resources
Description
Properties and Usage
References
Price
Quality &
Safety
Qty
Legal
Information
Advantages and Features
Related Products
Description
The pTK-CLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the Ostracod Cypridina noctiluca as a
reporter, under the control of the constitutive HSV thymidine kinase promoter. Cypridina luciferase (CLuc) is a 62 kDa protein with a native
signal peptide at the N-terminus that allows it to be secreted from mammalian cells (1,2). Because it is secreted CLuc can be detected in
the culture medium of mammalian cells expressing the reporter gene. pTK-CLuc has a multiple cloning site (MCS) between the CLuc stop
codon and the polyadenylation site. pTK-CLuc contains a selectable marker that is suited for creating stable integrants in the mammalian
cell genome.
Recommended sequencing primers for pTK-CLuc Vector (not available from NEB)
pBasic Reverse Primer (25-mer)
TCAGAAGCCATAGAGCCCACCGCAT (2827-2803)
CLuc 3´ end Forward Primer (23-mer)
GAGTTCAAGAAAGAATGCTACAT (2397-2419)
CLuc 5´ End Reverse Primer (24-mer)
GTAAGGACAGTCCTGGCAATGAAC (869-846)
Figure 1: Cypridina Luciferase (CLuc) activity obtained from different CLuc plasmids
HeLa cell supernatants (20 μl) and lysates (5 μl) were assayed with the BioLux CLuc Assay Kit (NEB #E3309). HeLa cells were seeded in 12-well
plates and transfected with 50 ng of CLuc-expressing plasmid per well. At 24 hr post-transfection, supernatants were collected and cell lysed in
100 μl per well using Luciferase Cell Lysis Buffer (NEB #B3321). The CLuc activity was measured in a Mithras LB940 (Berthold Technologies)
luminometer set to: 50 μl of injection, 2 seconds of delay and 2 seconds of integration.
Figure 2: pTK-CLuc multiple cloning site (MCS)
DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.
Highlights
TK promoter (BglII-HindIII): 18-776
Start codon of CLuc: 801-803
Stop codon: 2460-2462
CLuc coding: 801-2462
Signal peptide: 801-854
Polylinker downstream of CLuc 2463-2489 NotI, AgeI, XhoI, XbaI
Poly-A site (from SV40): 2490-2733
NeoR promoter (SV40): 3318-3653
NeoR: 3705-4499
NeoR poly-A(SV40): 4673-4803
Bacterial replication ori (pMB1) 5833-5245
Amp Resistance gene 6864-6004
Advantages and Features
Features
Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time
points).
90–95% of CLuc activity is found in the cell culture medium, with the remaining 5-10% detectable in cell lysates (Figure 1). This allows
flexibility when assaying CLuc along with other co-transfected reporters.
The activity of CLuc is high and the CLuc assay is sensitive enough to detect very small amounts of CLuc enzyme activity.
CLuc does not use the same substrate as other marine luciferases (e.g. Renilla, Gaussia). Therefore, it is possible to assay both CLuc
and GLuc independently in cell culture medium from cells expressing both reporters (3).
The pTK-CLuc Vector can be transfected into cells using any standard transfection protocol.
Applications
The pTK-CLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. pTK-CLuc Vector has a
multiple cloning site (MCS) between the CLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will
be part of the CLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability or RNAi or miRNA target evaluation.
Plasmids containing other constitutive promoter elements are also available (see Related Products).
Properties and Usage
Storage Temperature
-20°C
Related Products
Companion Products
BioLux® Cypridina Luciferase Assay Kit
pCMV-CLuc 2 Control Plasmid
pSV40-CLuc Control Plasmid
pCLuc-Basic 2 Vector
pCLuc Mini-TK 2 Vector
BioLux® Gaussia Luciferase Assay Kit
pCMV-GLuc 2 Control Plasmid
pSV40-GLuc Control Plasmid
pGLuc-Basic 2 Vector
pTK-GLuc Vector
pGLuc Mini-TK 2 Vector
References
1. Nakajima, et al. (2004). Biosci. Biotechnol. Biochem. 68, 565-570.
2. Otsuji, et al. (2004). 329, 230-237.
3. Wu, et al. (2007). Biotechniques. 42, 290-292.
FAQs
FAQs
1.
2.
3.
4.
5.
6.
Where can I find the sequence of this plasmid?
Can I make a stable cell line with pTK-CLuc Vector?
Can I transfect this plasmid into mammalian cells?
How do I assay for CLuc expression?
Can I use assay kits designed for other reporters (Gaussia, Renilla & Firefly luciferases) to assay CLuc activity?
Is there another secreted reporter that can be used with CLuc?
Datacards
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and
quality controls. The following file naming structure is used to name the majority of these document files: [Catalog
Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at [email protected] or fill out the
Technical Support Form for appropriate document.
N0322Datasheet-Lot0041402
N0322Datasheet-Lot0051505
Selection Charts
Selection Charts
Reporter Systems
Interactive Tools
Interactive Tools
DNA Sequences and Maps Tool
NEBioCalculator
Safety Data Sheet
Datacards
Safety Data Sheet
The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.
pTK-CLuc Vector
Datacards
The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and
quality controls. The following file naming structure is used to name the majority of these document files: [Catalog
Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at [email protected] or fill out the
Technical Support Form for appropriate document.
N0322Datasheet-Lot0041402
N0322Datasheet-Lot0051505
Legal and Disclaimers
Legal and Disclaimers
This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc
(NEB).
While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain
additional third party intellectual property rights for certain applications.
For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].
This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes
in humans or animals.
Licenses
Licensed under certain patents and patent applications from the National Institute of Advanced Industrial Science and Technology
("AIST") for Research and Development Purposes.
For use of the Biolux Cypridina Luciferase Assay Kit, or associated assay reagents, in human diagnosis and measurement in
relation to human health, contact [email protected].