325
Journal of Cell Science 113, 325-336 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
JCS0964
Isoform specific expression of the neuronal F-actin binding protein, drebrin,
in specialized cells of stomach and kidney epithelia
Brigitte H. Keon1, Paul T. Jedrzejewski2, David L. Paul3 and Daniel A. Goodenough1,*
1Dept of Cell Biology, Harvard Medical School, Boston, MA 02115, USA
2The Barnett Institute, Northeastern University, Boston, MA 02115, USA
3Dept of Neurobiology, Harvard Medical School, Boston, MA 02115, USA
*Author for correspondence (e-mail: [email protected])
Accepted 20 October 1999; published on WWW 13 January 2000
SUMMARY
To further understand the functional role that the F-actin
binding protein, drebrin (developmentally regulated brain
protein), plays in the regulation of F-actin, we
characterized its expression in non-neuronal cells. Using
nanoelectrospray mass spectrometry methods, we initially
identified drebrin in non-neuronal cultured cells. Using a
drebrin-specific monoclonal antibody, we were able to
detect drebrin protein in several different cell lines derived
from fibroblasts, astrocytomas, and simple epithelia, but
not in cell lines derived from stratified epithelia. Doublelabel immunofluorescence experiments of cultured cell
monolayers revealed the localization of drebrin at the
apical plasma membrane together with a pool of
submembranous F-actin. Immunoblot analysis of mouse
organs revealed that, in addition to its high levels of
expression in brain, drebrin was present in stomach and to
a lesser degree in kidney, colon, and urinary bladder.
Drebrin protein detected in the non-brain organs migrated
faster through SDS-PAGE gels, indicating that the lower
molecular weight embryonic brain isoform (E2) may be the
prominent isoform in these organs. RT-PCR experiments
confirmed the specific expression of the E2 isoform in
adult stomach, kidney, and cultured cells. In situ
immunofluorescence experiments revealed a cell-type
specific pattern in both stomach and kidney. In stomach,
drebrin was specifically expressed in the acid-secreting
parietal cells of the fundic glands, where it accumulated at
the extended apical membrane of the canaliculi. In kidney,
drebrin was expressed in acid-secreting type A intercalated
cells, where it localized specifically to the apical plasma
membrane. Drebrin was expressed as well in the distal
tubule epithelial cells where the protein was concentrated
at the luminal surface and present at the interdigitations of
the basolateral membranes.
INTRODUCTION
these protein families (for example: Goode et al., 1998;
Holtzman et al., 1993; Kangas et al., 1999; Lueck et al., 1998;
Sutherland and Witke, 1999; Wesp et al., 1997; Yang et al.,
1999).
Drebrin is an F-actin binding protein originally identified in
chick brain as a neuronal-specific developmentally regulated
brain protein (Shirao and Obata, 1985; Ishikawa et al., 1994).
Three isoforms of drebrin have been identified in chick (Shirao
et al., 1988) as well as in mammalian species (Shirao et al.,
1992; Kojima et al., 1993; Toda et al, 1993): the adult or A
form and the embryonic forms designated E1 and E2. The
expression of each isoform is regulated both spatially and
temporally throughout neurogenesis by differential splicing of
a single gene (Shirao et al., 1990). Temporally, isoform
regulation corresponds to distinct phases in neuronal
development. The earliest embryonic isoform, E1, is thought
to function in migration, while the E2 isoform, which replaces
E1 during embryogenesis, is believed to play a role in
migration as well as in the formation of axons and dendrites.
The A isoform, which is only present in the mature neuron, is
Regulation of the membrane actin cytoskeleton underlies many
diverse cellular events including cell motility and migration,
intercellular adhesion, cell morphogenesis, intracellular vesicle
trafficking, cell polarity, endo-and exocytosis, and signal
transduction (Drubin and Nelson, 1996; Gumbiner, 1996;
Mitchison and Cramer, 1996; Schmidt and Hall, 1998). The
involvement of actin in such temporally and spatially distinct
events requires complex regulation of its dynamics and
structural organization. These regulatory activities have been
attributed to an ever-growing list of actin-binding proteins that
have been categorized into protein families based on the
presence of common modular domains, such as the SH3
domain, which mediate protein-protein interactions (Fedorov
et al., 1999; McGough, 1998; Puius et al., 1998; VanTroys et
al., 1999). Genetic studies in yeast and mice, together with
information concerning the cell-type specific expression and
subcellular distribution of these proteins in complex organisms,
are providing clues to the specific functions of members of
Key words: Drebrin, Actin, Stomach, Kidney, Epithelial cell, Parietal
cell, Intercalated cell
326
B. H. Keon and others
assumed to be involved in spine plasticity (Hayashi and Shirao,
1999). Interestingly, in healthy humans, drebrin levels in the
brain decline gradually with age. However, in patients
diagnosed with Alzheimer’s disease there is a drastic reduction
of greater than 80% in protein levels relative to healthy
individuals of the same age group (Hatanpaa et al., 1999).
Spatially, drebrin expression is regulated at the cellular and
subcellular levels. In the adult rat brain, the E2 protein is
present at consistently low levels throughout all regions of the
brain with the exception of the olfactory bulb where it is
abundantly present. In the adult brain, the A protein is found
at high levels in the forebrain region, but is present at
consistently lower levels in other less plastic regions (Hayashi
et al., 1996). At the subcellular level, the E2 and A isoforms
are targeted to different regions of actin localization. In neurons
the E2 form localizes to the submembranous region (Asada et
al., 1994), while the A form is specifically located evenly
distributed throughout the post-synaptic dendritic spine
(Hayashi et al., 1996).
Although the function of drebrin is not known, several lines
of evidence from biochemical and cell culture studies support
a general involvement for this protein in actin dynamics.
Overexpression of drebrin A or E2 cDNA in cultured
fibroblasts or neurons results in colocalization of the protein
with actin filaments and the formation of dendritic-like cell
processes (Shirao et al., 1992, 1994; Asada et al., 1994).
Drebrin binds to filamentous actin with high affinity and
competitively with F-actin stabilizing proteins such as fascin
(Sasaki et al., 1996), α-actinin, and tropomyosin (Ishikawa et
al., 1994). Although drebrin does not appear to have any direct
actin remodeling properties, it inhibits the cross-linking
activity of α-actinin and, by competing with tropomyosin and
may increase the accessibility of F-actin to modulatory proteins
such as gelsolin (Ishikawa et al., 1994). In addition to its
ability to interact with F-actin, drebrin has been coimmunoprecipitated in a stable complex together with gelsolin,
myosin and α-actinin (Hayashi et al., 1996), and has been
shown to interact directly with profilin in affinity binding
studies (Mammoto et al., 1998).
Recently, drebrin has been characterized as a member of the
newly identified ADF-H family of actin binding proteins that
share the structurally conserved actin-depolymerizing factor
(ADF) binding module referred to as the ADF-H domain, and
at least one SH3 domain (Lappalainen et al., 1998). Drebrin
orthologs have been identified in rat and human. Although not
yet identified, phylogenetic analysis predicts the existence of a
mouse drebrin protein as well. Structurally related proteins
have been identified in yeast (ABP1; Drubin et al., 1990) and
mouse (SH3P7; Sparks et al., 1996). Genetic studies in yeast
of the ABP1 (actin-binding protein 1) gene indicate a role for
this protein in endocytosis that depends on the presence of its
SH3 domain (Freeman et al., 1996; Lila and Drubin, 1997). In
mouse, SH3P7 colocalizes with actin filaments and is believed
to act as an adapter protein that links antigen receptor signaling
to components of the cytoskeleton (Larbolette et al., 1999).
Although widely accepted as a brain-specific protein, it has
been documented that the neuronal specificity of drebrin is
restricted to the A isoform. While understated in the literature,
mRNAs corresponding to the embryonic forms have been
detected in non-neuronal cells (Fisher et al., 1994). Recently,
the drebrin protein was detected in non-neuronal cultured cells
by F-actin overlay assays and immunoblot experiments (Luna
et al., 1997). Despite these findings, however, studies of drebrin
have remained restricted to the brain and no information exists
about the presence of protein in non-neuronal cells in situ.
Information concerning the presence of drebrin isoforms in
non-brain tissues would be valuable for understanding the
specific function(s) of the drebrin proteins in actin regulation
and the significance of the isoform variants. In this study we
report the cloning and sequencing of the mouse drebrin A and
E2 cDNAs, and document for the first time the specific
expression of the embryonic isoform, E2, in non-neuronal cells
in culture and in situ. We describe the cell-type specific
expression and sub-cellular localization of drebrin protein in
mouse stomach and kidney epithelia, and demonstrate that
overexpression of the E2 isoform in cultured epithelial cells
results in a similar phenotype to that produced in neurons and
fibroblasts. Our results indicate that drebrin may play a similar
role in actin plasticity in non-neuronal cells to that which it
plays in neurons. In addition to providing new avenues of
thought concerning the function of drebrin, the data provide
new information concerning possible mechanisms of actin
remodeling in these non-neuronal cells not previously
considered.
MATERIALS AND METHODS
Cell culture and transfection experiments
Cell culture lines screened included human primary liver carcinoma
PLC, human colon adenocarcinoma Caco-2, human mammary
carcinoma MCF-7, keratinocyte HaCaT, human epidermoid
carcinoma A-431, vulvar squamous cell carcinoma-derived SV80
fibroblasts, and glioma U 333 CG/343 MG. (For sources of cell lines
see American Type Culture Collection (ATCC), Manassas, VA, and
sources sited by Keon et al., 1996.) All cell culture lines were
maintained under standardized conditions. For transfection
experiments, the MDCK II cell line was used. cDNA for human
drebrin E2 was obtained from the TIGR/ATCC Human cDNA Special
Collection (TASC). For the stable expression of drebrin E2 in MDCK
II cells, the cDNA was subcloned into the pcDNA3.1(-)/Zeo
expression vector (Clontech).
Antibodies
The drebrin specific murine monoclonal antibody clone, M2F6, was
provided as a generous gift from MBL (Watertown, MA). Affinitypurified rabbit antibodies (SA6) to the C-terminal region of mouse
AE2 (anion exchanger 2: residues 1224-1237) protein were
generously provided by Drs Seth Alper and Alan Stuart-Tilley, Beth
Israel Deaconess Medical Center, Boston. In mouse kidney, these Abs
specifically recognize the AE1 protein by virtue of the conserved Cterminal region between AE1 and AE2 (Stuart-Tilley et al., 1998).
Rabbit serum containing antibodies to the aquaporin 4 water channel
protein were generously provided by Dr Dennis Brown,
Massachusetts General Hospital, Boston. Secondary antibodies used
for immunofluorescence microscopy were Cy3-conjugated goat antimouse IgG or Cy2-conjugated donkey antibodies to rabbit IgG.
Fluorochrome coupled, as well as HRP-conjugated secondary
antibodies used in immunoblotting experiments, were from Jackson
ImmunoResearch Laboratories (West Grove, PA).
Cell and organ preparation and immunofluorescence
analysis
For immunocytochemical analysis cells were grown on glass slides
or coverslips, washed 3 times with PBS containing 2 mM MgCl2 and
Expression of drebrin E2 in stomach and kidney
0.5 mM CaCl2 (pre-warmed to 37°C), fixed in 1.5% formaldehyde
for 15 minutes at RT and permeabilized with 0.2% TX-100. For
preparation of mouse organs for immunohistochemistry, anesthetized
animals were perfused with 1.5-3% formaldehyde in PBS. All
animals were treated in accordance with the guidelines published in
NIH Guide for the Care and Use of Laboratory Animals. Dissected
organs were further incubated in the formaldehyde solution for 2
hours at room temperature or overnight at 4°C. Fixed organs were
subsequently equilibrated in 0.5 M sucrose in PBS and cryopreserved
by snap freezing in liquid nitrogen-cooled isopentane. 5-7 µm
sections were cut using a MICRON HM 500 OM cryostat. Prior to
application of primary Abs organ sections were permeabilized with
0.2% Triton X-100 in PBS and incubated in blocking buffer (PBS
containing 0.5% bovine serum albumin and 0.3% fish gelatin). For
immunostaining, primary antibodies were applied at room
temperature for 60 minutes. Abs were diluted in blocking buffer and
used at the following concentrations: murine drebrin clone M2F6; 2
µg/ml, purified rabbit pAbs, SA6; 0.8 µg/ml, rabbit serum containing
Abs to aquaporin 4 was diluted 1:100. After washing with PBS,
appropriately diluted secondary antibodies were applied for 30
minutes. Following antibody binding, specimens were washed in
PBS, rinsed in water, dehydrated in ethanol for 6 minutes at room
temperature, air dried, and mounted. Immunofluorescence was
viewed and documented using a Nikon Axioscope photomicroscope
equipped with a digital camera.
Immunoprecipitation, gel electrophoresis and immunoblot
analysis
Cells grown to confluence in 10-cm diameter sterile culture dishes
were rinsed with methionine deficient medium prewarmed to 37°C
and then incubated further for 30 minutes in the same medium
supplemented with 10% fetal calf serum, streptomycin and penicillin.
Following equilibration, 200 µCi of 35S Translabel (ICN) was added
to the medium and label incorporation proceeded for 20 hours at 37°C.
Cells were then washed with prewarmed (37°C) PBS containing 2
mM MgCl2 and 0.5 mM CaCl2, and lysed in 1 ml 20 mM HEPES
buffer, pH 7.4, containing 1% Triton X-100, 0.5% deoxycholate, 0.2%
SDS, 150 mM NaCl, 2 mM EDTA, 1 µM pepstatin, 100 µM
pefablock, and 1 µM leupeptin. Lysed cells were then collected,
homogenized gently, and equilibrated on ice for 30 minutes. Cell
lysates were clarified by centrifugation in a microfuge at 13,000 rpm
for 15 minutes at 4°C. Cleared lysates were pre-incubated for 4 hour
at 4°C with 4 mg Sepharose-coupled Protein A, pre-equilibrated in
lysis buffer. The Sepharose and bound components were recovered by
centrifugation and the pre-incubated lysates were subsequently
incubated for 16 hours at 4°C with 4 mg of Sepharose-coupled Protein
A presaturated with polyclonal antibodies. Sepharose and bound
components were recovered by centrifugation and washed 4 times
with lysis buffer. Immunoprecipitates were eluted in 2× Laemmli
buffer and heated to 95°C for 5 minutes.
Polyacrylamide gel electrophoresis (PAGE) was performed
according to standard protocols using 7% SDS-PAGE gels as
previously described (Keon et al., 1996). For PAGE and western blot
analyses of total cell lysates, cells were lysed directly in 2× SDSloading buffer preheated to 100°C and further incubated at 95°C for
5 minutes. For analysis of total protein from mouse organs, animals
were sacrificed according to the guidelines published in the NIH
Guide for the Care and Use of Laboratory Animals. Organs were
extracted immediately, washed in ice-cold PBS and minced on ice in
PBS containing protease inhibitors and DNase. Minced tissues were
solubilized in Laemmli buffer and incubated at 95°C for 7 minutes.
All samples were centrifuged prior to loading onto SDS-PAGE gels
for analysis.
Mass spectrometry
For mass spectrometric analysis of the coprecipitate,
immunoprecipitation experiments were performed as previously
327
described but without the incorporation of radiolabeled methionine.
SDS-PAGE purified immunoprecipitates were digested in situ
overnight in Eppendorf tubes at 37°C with modified trypsin (Promega,
Madison, WI) at an approximate ratio of 10:1 (protein:enzyme) (see
protocol in Shevchenko et al., 1996). Digests were purified over Poros
R2 50 microcolumns and eluted into nanospray needles with 5%
formic acid 50% acetonitrile (see Shevchenko et al., 1996).
Electrospray mass spectra were acquired on a Finnigan LCQ ion trap
mass spectrometer (San Jose, CA) equipped with an ESI ion source.
The standard spray needle assembly was replaced with a nanospray
source of in-house design (see Jedrzejewski and Lehmann, 1997). The
nanospray needles (Protana, Denmark) were positioned on-axis 0-2
mm from the heated capillary orifice. Solutions were sprayed with a
needle potential of about + 0.8 kV. Tandem MS spectra were acquired
with relative CID of between 20 and 35%.
Protein identification was accomplished using the Sequest
tandem MS spectra correlation program (Yates et al., 1995) to
search the non-redundant protein database (OWL ver. 29: NCBI,
ftp://ncbi.nlm.nih.gov/repository/OWL).
Reverse transcription-polymerase chain reaction (RT-PCR)
and cDNA sequencing
For RT-PCR analysis, RNA from mouse organs was prepared as
previously described (Keon et al., 1996). One µg of RNA was reversed
transcribed using the Retroscript kit (Ambion). Reactions were carried
out in the presence (+) and absence (−) of the reverse transcriptase
enzyme. Four µl from each 25 µl reaction was used as template for
PCR analysis. PCR primers were based on human drebrin E coding
region (GenBank accession # D17530). For isotope analysis, forward
PCR primers were 5′-ATC GAG GAG CAC AGG AGG AAA-3′
(corresponding to nucleotides # 791-811); reverse primers were 5′AGG CCA TAG GTC AAT GAG GCT-3′ (corresponded to nucleotide
#1517-1538). For PCR cloning of full length mouse drebrin A and E2
cDNAs, forward PCR primers were 5′-CCC GAA TTC ATG GCC
GGC GTC AGC TTC-3′ (corresponded to the initiation codon at
nucleotide # 18, to #36 with an upstream EcoRI site for subcloning),
and reverse primers were 5′-GGG GAA TTC ATC ACC ACC CTC
GAA GCC CTC GAA GCC CTC-3′ (an EcoRI site was added to the
end of 21 nucleotides corresponded to #2024-2045 of human drebrin
E). PCR was performed under the following conditions: initial
denaturation at 95°C for 5 minutes; 30, 3 temperature cycles: 95°C
for 30 seconds, 64°C for 15 seconds, 72°C for 1 minute; and final
extension at 72°C for 1.5 minutes. Amplified products were analyzed
by ethidium bromide agarose gel electrophoresis. Results were
documented using the Nucleotech gel imaging system and acquired
data were inverted to produce a clearer image of black bands on a
white background.
RESULTS
Mass spectrometric analysis revealed the presence
of drebrin in non-neuronal cultured cells
While screening for proteins associated with the TJ-associated
protein symplekin, we consistently coprecipitated a
polypeptide with an approximate Mr of 115×103. To determine
the identity of this polypeptide, the coprecipitate was separated
by SDS-PAGE and digested with trypsin in situ. Subsequent
nanoelectrospray mass spectrometry (MS) analysis resulted in
a tryptic map (Fig. 1A) representing a protein-specific profile
of trypsin-generated peptides, a number of which were
sequenced by tandem MS (e.g. Fig. 1B). Sequence and mass
data generated from these tandem MS spectra were used to
search a non-redundant protein database (OWL version 29.6)
with the Sequest spectra correlation program. The Sequest
328
B. H. Keon and others
Fig. 1. Mass spectrometric identification of drebrin in non-neuronal cultured cells. Nanoelectrospray mass spectrum (A) of drebrin tryptic map
from an in-gel digest. Asterisks indicate trypsin autolysis peptides. Tandem mass spectrum (B) of T7 drebrin peptide. Nearly complete
sequence of this peptide was verified by the presence of complementary Bn-ions (N terminus derived fragment ions) and Yn-ions (C terminus
derived fragment ions). Unlabeled fragment ions correspond to immonium or internal fragment ions. For complete nomenclature of tandem
fragment-ions see Roepstorff and Fohlman (1984).
program returned highly significant values (e.g. Xcorr of 3 and
deltaCN of 0.2 for data in Fig. 1B) for the drebrin gene product,
an F-actin binding protein, that has been documented in the
literature to exhibit brain specific expression (Shirao, 1995).
Although the predicted mass of drebrin is 71 kDa, it has
been documented in the literature that the drebrin proteins run
anonymously through SDS-PAGE gels with an approximate
Mr of 100-125×103 (Shirao and Obata, 1985). The
discrepancy between the apparent and the cDNA predicted
sizes of drebrin might be attributed to its acidic nature as well
as to post-translational modification(s) resulting in an
aberrant gel mobility of this protein. From the peptide map
data we have identified two putative phosphorylation sites
(data not shown) within the N-terminal domain of drebrin.
The biological significance of these putative sites remains to
be determined.
Attempts to immunoprecipitate the symplekin-drebrin
complex using the drebrin-specific mAb, M2F6, have been
inconclusive, leaving open the question as to whether or not
this interaction is biologically significant. However, on its
own, the identification in non-neuronal cells of an F-actin
binding protein thought to be brain-specific warranted
further investigation as it raises the possibility that this
protein may have a broader function in the cell than
previously considered.
Western blot analysis confirmed the presence of
drebrin as a major component in several different
non-neuronal cultured cell lines
Detection of the drebrin message in non-brain tissue has been
reported in the literature (Shirao et al., 1987) and is evidenced
by the diverse sources of ESTs entered in GenBank. The
presence of drebrin protein in non-neuronal cells, however,
has not been investigated. To determine the extent of drebrin
protein present in cultured cells, we analyzed total protein
from several diverse cultured cell lines using the drebrinspecific monoclonal antibody, M2F6, in immunoblot
experiments (Fig. 2). A drebrin polypeptide of similar size
(Mr ~120×103) and amount was detected in several different
cell lines derived from simple epithelia (lanes 1-3), but not in
cell lines derived from stratified epithelia (lanes 4 and 5).
Drebrin protein was also present in cell lines derived from
fibroblasts (lane 6) and in astrocytoma-derived glioma cells
(lane 7).
Expression of drebrin E2 in stomach and kidney
329
Fig. 2. Detection of drebrin in cultured cell lines of diverse origin.
Immunoblot analysis of drebrin protein in total cell lysates of
confluent cell monolayers: human mammary carcinoma MCF-7 (lane
1), human primary liver carcinoma PLC (lane 2), human colon
adenocarcinoma Caco-2 (lane 3), keratinocyte HaCaT (lane 4),
human epidermoid carcinoma A-431 (lane 5), vulvar squamous cell
carcinoma-derived fibroblasts SV80 (lane 6) and astrocytomaderived U333 CG/343 (lane 7). Drebrin was detected indirectly by
mouse monoclonal Ab, M2F6, followed by binding of HRP-coupled
anti-mouse IgG and reaction with a chemiluminescence substrate.
Immunofluorescence analysis revealed the
association of drebrin with a distinct pool of F-actin
at apical plasma membranes of cultured epithelial
cells
We characterized the subcellular distribution of drebrin in
cultured cells by indirect immunofluorescence light
microscopy (Fig. 3). In the cultured polarized epithelial cell
line PLC (derived from a human primary liver carcinoma),
detection of drebrin via binding of mAb M2F6 revealed a
concentration of the protein at plasma membranes between
neighboring cells (Fig. 3A,C). No detectable signal was evident
at free cell borders (note Fig. 3A,B; bottom right corner). The
staining pattern at the interacting cell borders was granular in
appearance, and the accumulation of protein was non-uniform
in nature. In some cells a second pool of drebrin was
concentrated in a floccular pattern in the central region of the
cell (Fig. 3C). It was not possible at the light microscope level
Fig. 3. Immunolocalization of drebrin in association with F-actin at apical membranes of PLC cells. (A and B) Immunofluorescence and phase
contrast images of PLC cell monolayers stained with drebrin Ab. Drebrin Abs decorated cell-cell borders but were absent from free cell borders
(lower right corner). (C and D) Cells were stained doubly with drebrin mAb, M2F6 (C), and fluorochrome-conjugated phalloidin (D). Drebrin
colocalized with a distinct pool of submembranous actin but was not detected in association with actin stress fibers (D; arrows). Bars, 15 µm.
330
B. H. Keon and others
to determine whether this pool of protein was cytosolic or
membrane-associated.
To determine if drebrin colocalized in vivo with F-actin in
cultured epithelial cells, we labeled cells with both drebrin
antibody (Fig. 3C) and fluorochrome-conjugated phalloidin
(Fig. 3D). Drebrin colocalized with the granular accumulation
of F-actin at plasma membrane borders between adjacent
cells; however, no drebrin signal was detected at the
phalloidin-stained stress fibers (Fig. 3D, arrows).
Interestingly, the non-uniformity of drebrin accumulation at
the plasma membranes paralleled that of actin. Drebrin
colocalized as well with filamentous actin concentrated
at the cell center, although the intensities of the
fluorescent signals were in variable proportions
between different cells.
Detection of drebrin isoform E2 in stomach,
colon, kidney, and urinary bladder of adult
mice
To determine the specificity of drebrin expression in
vivo, we screened total protein from various mouse
organs using the M2F6 mAb (Fig. 4A). Immunoblot
analysis revealed the presence of 2 drebrin isoforms in
adult brain: the most abundant, slower migrating A form
and the less abundant E2 form. In non-brain adult
organs, the highest amounts of drebrin protein were
present in the stomach and kidney. Lesser amounts of
protein were detected in the colon and urinary bladder,
and trace amounts of protein could be detected in heart,
lung, liver, and epididymis. The consistent low levels of
protein detected in these organs may be due to
peripheral innervation, or the specific presence of
protein in other groups of cells present at low density.
Interestingly, in all cases of non-neuronal expression in
adult organs, only the faster migrating E2 isoform was
detected. Our results were not only consistent with the
previously described developmental specificity of
drebrin isoform expression in brain, but also further
demonstrated an organ-specific level of regulation as
well.
To confirm the isoform specificity of organ
expression, we performed RT-PCR experiments using
RNA isolated from embryonic mouse brain (E19), adult
mouse brain, kidney and stomach. In addition, in order
to distinguish which isoform was expressed in cultured
cells, RNA from PLC cells was analyzed in comparison
to the drebrin-negative cell line, HaCaT (Fig. 4B).
Primers for PCR were designed to amplify the region
containing insert 1 (present in E2 and A, but lacking in
E1) and insert 2 (present in A only; see Fig. 4C and
Materials and Methods). Our results from brain samples
were consistent with those reported in the literature
(Shirao, 1995; Hayashi et al., 1998): the E2 isoform was
present at embryonic day 19 and was replaced as the
dominant form by the isoform A in the adult. Our results
from RNA derived from adult mouse kidney and
stomach were consistent with our conclusion that the
isoform present in the non-brain adult organs was the
E2 form. Additionally, we were able to identify the
isoform expressed in the cultured cell lines as the E2
form.
Cloning of mouse drebrin A and E2 cDNA
Phylogenetic analysis of the ADF-H family of drebrin-like
proteins predicts a mouse drebrin gene (Lappalainen et al.,
1998). To date, however, mouse drebrin cDNA sequence has
not been published. To verify the identity of the RT-PCR
products, we obtained sequence information. As expected, the
E2 isoform contained insert 1, but lacked insert 2 (see
schematic, Fig. 4C). Fig. 5 shows comparison of the nucleotide
sequence obtained from the RT-PCR amplicon derived from
mouse stomach, to the published rat drebrin A sequence
(GenBank accession #X59267). In the rat sequence, insert 1
Fig. 4. Expression of drebrin isoforms in mouse. (A) Immunoblot analysis of
drebrin among total protein from various adult mouse organs. For detection of
drebrin, mAb M2F6 was used in conjunction with HRP-conjugated secondary
Abs and detection by chemiluminescence. The slower migrating band
represents the A isoform, and the faster migrating band, isoform E2.
(B) Ethidium bromide staining of amplification products from RT-PCR
analysis of drebrin expression in embryonic mouse brain (E19), and adult
mouse brain, kidney, and stomach, as well as the cultured cell lines PLC and
HaCaT. Plus and minus signs indicate the presence or absence of reverse
transcriptase enzyme in the reaction mixture. Data were inverted to produce
black on white images. (C) Diagram of drebrin isoform domain structure.
PCR primers (arrows) were designed to amplify the domain containing the
isoform-specific inserts (insert 1 in E2, and both insert 1 and 2 in A). ADF;
Actin depolymerizing factor domain. SH3; src homolgy 3 region.
Expression of drebrin E2 in stomach and kidney
Fig. 5. Sequence analysis of the E2designated amplicons from kidney and
stomach. The absence of insert 2 (base #
245-288 of rat drebA sequence) in the mouse
amplicons confirmed the specific
amplification of the product from the drebrin
E2 isoform. Complete cDNAs for mouse
drebrin A and E2 were cloned by RT-PCR
and their sequences have been entered into
GenBank under accession numbers
AF187147 and AF187148.
331
ratdrebA.SEQ
rtpcrdre408con.seq
781
840
AAGCTGAAGAGGCCAAGAGGAGGTTAAAGGATCAGTCTATCTTTGGTGATCAGCGAGATG
AAGCGGAAGAGGCCAAGAGGCGGTTGAAGGAGCAGTCTATCTT.GGTGACCATCGGGATG
ratdrebA.SEQ
rtpcrdre408con.seq
841
900
AAGAGGAAGAGTCCCAGATGAAGAAGTCGGAATCTGAGGTGGAGGAGGCAGCTGCCATCA
AGGAGGAAGAGACCCACATGAAGAAGTCAGAGTCGGAGGTGGAGGAGGCAGCAGCTATTA
ratdrebA.SEQ
rtpcrdre408con.seq
901
960
TTGCCCAGCGGCCTGATAACCCACGGGAGTTCTTCAGACAGCAGGAACGAGTGGCTTCAG
TTGCCCAGCGGCCTGACAACCCAAGGGAGTTCTTCAAGCAGCAGGAAAGAGTCGCATCGG
ratdrebA.SEQ
rtpcrdre408con.seq
961
1020
CCTCTGGTGGCAGCTGTGACGCACCCTCGCCCTTCAACCACCGACCAGGTCGTCCGTACT
CCTCTGCGGGCAGCTGTGATGTACCCTCGCCCTTCAACCATCGACCAGG...........
ratdrebA.SEQ
rtpcrdre408con.seq
1021
1080
GCCCTTTCATAAAGGCATCGGACAGTGGGCCTTCCTCCTCCTCCTCTTCCTCCTCTTCCC
............................................................
ratdrebA.SEQ
rtpcrdre408con.seq
1081
1140
CTCCACGGACTCCCTTTCCCTATATCACCTGCCACCGCACCCCAAACCTCTCTTCCTCCC
............................................................
ratdrebA.SEQ
rtpcrdre408con.seq
1141
1200
TCCCATGCAGTCACCTGGACAGCCACCGGAGGATGGCGCCCACTCCCATTCCCACCCGGA
.......CAGCCACCTGGACAGCCACCGGAGGATGGCGCCCACTCCCATCCCCACGCGGA
ratdrebA.SEQ
rtpcrdre408con.seq
1201
1260
GCCCATCTGATTCCAGCACAGCCTCCACCCCCATCACGGAGCAGATCGAGAGGGCCCTGG
GCCCGTCTGACTCCAGCACCGCCTCCACCCCTGTCGCTGAGCAGATAGAGCGGGCCCTGG
ratdrebA.SEQ
rtpcrdre408con.seq
1261
1320
ATGAGGTCACATCCTCGCAGCCTCCACCCCCACCTCCACCACCCCCACCAGCTCAAGAGG
ATGAGGTCACCTCCTCGCAGCCTCCACCACTGCCACCGCCACCCCCACCAGCCCAAGAGA
(highlighted in blue) spans nucleotides #1148-1279, and insert
2 (highlighted in yellow) spans nucleotides #1010-1147. The
RT-PCR product obtained from mouse stomach is missing
nucleotides corresponding to rat nucleotides #1010-1147. The
sequence derived from the mouse stomach RT-PCR product
was therefore identified as mouse drebrin E2. Using primers
designed on the basis of human drebrin E2 sequence (see
methods section), we cloned the RT-PCR derived cDNA for the
entire coding regions of mouse drebrin A and E2. Sequence
analysis revealed high homology between the cloned mouse
cDNAs and the published drebrin orthologs in human, rat, and
chick. We therefore identified the cloned cDNAs as mouse
drebrin A and E2. Sequences have been entered into the
GenBank with accession numbers AF187147 and AF187148.
Overexpression of drebrin E2 in cultured epithelial
cells promotes the formation of cell extensions
To determine whether or not drebrin E2 functions similarly in
cultured neurons and epithelial cells, MDCK cell lines were
subcloned from single cells stabily transfected with the drebrin
E2 cDNA. Four cell lines of unique lineage were inspected
visually and compared to 2 lines subcloned from cells stably
transfected with the expression vector without insert. Two of
the drebrin transfected cell lines displayed a morphology
Fig. 6. Overexpression of drebrin E2 in MDCK cells. Upper panel:
representative views of stable clonal cell lines derived from MDCK
II cells following transfection with drebrin E2 cDNA. Lower panel:
immunoblot analysis of transfected clonal lines (MII clones 1-4), and
a cell line established from cells transfected with vector alone (V).
For detection of drebrin protein (hDreE2), the M2F6 mAb was used.
This Ab reacts weakly with canine drebrin and requires extended
exposure for signal detection. Detection of the human drebrin
occurred in a matter of seconds.
distinguishable from the other cell lines (Fig. 6). In these lines
(designated clones 3 and 4), cells often were more fibroblastic
in appearance and exhibited long, narrow membrane
projections (Fig. 6, clone 4 is representative). This was in
contrast to the typical epithelial appearance of clones 1 and 2
(Fig. 6, clone 2 is representative), as well as the two lines
carrying the vector alone (not shown; Fig. 6, clone 2 is
representative). To determine which cell lines transcribed and
translated the drebrin cDNA, we analyzed cell lysates from
each cell line for the presence of the exogenous drebrin protein
332
B. H. Keon and others
Fig. 7. Immunolocalization of
drebrin in mouse stomach.
(A) Drebrin was specifically
present in the acid-secreting
parietal cells of the stomach
gastric gland. (B) High power
micrograph showing
accumulation of drebrin at the
canalicular membranes (thick
arrow), with some protein
present at the basolateral
membrane (thin arrow). Drebrin
was not detected in chief cells
(arrowhead). Bars: 18 µm (A);
9 µm (B).
(Fig. 6, bottom panel). Immunoblot analysis revealed that cell
lines 1 and 2, as well as the control vector cell line, did not
contain any detectable exogenous drebrin protein in contrast to
the strong signal detected in lines 3 and 4. The overexpression
of drebrin E2 in MDCK epithelial cells thus correlated with the
formation of the observed cell projections.
The distribution of drebrin E2 in mouse stomach is
specific for parietal cells
The amount of drebrin protein present in mouse stomach was
consistently higher than in any other organ besides the brain
(see Fig. 4A). We analyzed the distribution of drebrin in
stomach by immunostaining cryosections of adult mouse
stomach (Fig. 7). An intense signal was detected in the acidsecreting parietal cells of the fundic mucosa (Fig. 7A,B), but
was absent from chief cells (7B; arrowhead). As expected,
signal also was detected in the peripheral parasympathetic
ganglia, but was virtually absent from the vascular
endothelium; occasionally signal was detected at the luminal
surface of the endothelium (not shown). The surface mucous
cells and gastric pits were also negative for drebrin (not
shown), indicating that drebrin was not generally expressed in
all simple epithelial cells.
In parietal cells, the majority of the drebrin signal was
distributed in association with the extended apical membrane
of the canaliculus (Fig. 7B; thick arrow), although some signal
was also present at the basolateral membranes (Fig. 7B; thin
arrow). To characterize the subcellular distribution of drebrin,
Fig. 8. Colocalization of drebrin with F-actin at parietal cell
canaliculi. Double staining with drebrin mAb (A) and fluorochromeconjugated phalloidin (B) produced identical staining patterns within
the parietal cells. In addition, phalloidin decorated the cortical actin
belt associated with the terminal web of the chief cells (large
arrows). (C) Combined image of A and B reveals most of the drebrin
signal is colocalized with actin, although actin signal corresponding
to the cortical actin belt is not drebrin associated. The small arrow
indicates a key area enlarged in Fig. 9. Bar, 18 µm.
we performed double-label indirect immunofluorescence
experiments using drebrin mAb (Fig. 8A) and fluorochromeconjugated phalloidin (Fig. 8B). In parietal cells, actin
filaments are abundant in the microvilli and submembranous
regions of the canaliculi (Namikawa et al., 1998). Drebrin
colocalized with F-actin in these regions (Fig. 8C), but was
Expression of drebrin E2 in stomach and kidney
Fig. 9. Illustration of drebrin at
the apical membrane of the
canalicular lumen.
(A) Enlargement of the area in
Fig. 8 containing the smaller
arrow. Drebrin (shown in red)
stains the canaliculi of the
parietal cells. Phalloidin (shown
in green) not only co-stains the
canaliculi with the drebrin Ab
but also stains the cortical actin
belt of the adjacent chief cells,
delineating the lumen of the gland. (B) A diagrammatic
interpretation of the staining pattern observed in A. L = lumen of the
gastric gland.
absent from the cortical actin belts of parietal cells and
neighboring chief cells (arrows). Decoration of cortical actin
with phalloidin clearly delineated the luminal space of the
gastric glands. Fig. 9A shows an enlargement of the region
indicated by the smaller arrow in Fig. 8, which demonstrates
the continuity of the canalicular lumen with the lumen of the
gland (illustrated for clarity by the cartoon in Fig. 9B).
The distribution of drebrin E2 in mouse kidney is
specific for the distal tubule epithelium and
collecting duct intercalated cells
Besides stomach, the next most abundant signal for drebrin in
non-brain tissue was detected in the kidney (see Fig. 4A). We
therefore characterized the cellular distribution of drebrin in
cryosections of mouse kidney, and again found a cell-type
Fig. 10. Immunolocalization of
drebrin in mouse kidney.
(A) Detection of drebrin in distal
tubule epithelium (arrows) and
collecting ducts (arrowheads).
(B) Phase contrast companion
image for A. Bar, 30 µm.
333
specific expression pattern. Drebrin staining was most
prevalent in distal convoluted tubules of the cortex (Fig. 10A,
arrows) and in the collecting ducts of the medullary rays
(Fig. 10A, arrowheads). In the distal tubules, drebrin was
concentrated at the apical cell membranes and in a striated
pattern in the basal cytoplasm, associated with the complex
interdigitations of the basolateral membranes characteristic of
this cell type (Fig. 10A,B; arrows).
To more precisely define the localization of drebrin in the
collecting ducts, we co-stained cryosections of mouse kidney
with antibodies that recognize the anion exchanger protein,
AE1 (also referred to as Band 3; kindly provided by Drs Seth
Alper and Alan Stuart-Tilley), or the aquaporin 4 protein
(kindly provided by Dr Dennis Brown). In kidney epithelium,
AE1 is specifically expressed in type A intercalated cells
(Alper et al., 1989; Stuart-Tilley et al., 1998) while aquaporin
4 is expressed in principal cells of collecting ducts (Frigeri et
al., 1995). Both proteins are located at the basal membranes of
their respective cell types. Drebrin was detected in epithelial
cells lining the collecting ducts in both the outer zone of the
medulla and the cortex. These cells coexpressed AE1 and
drebrin and distributed these proteins to opposite membrane
domains (Fig. 11A,B). The specific presence of the AE1
protein identified these cells as type A intercalated cells (Alper
et al., 1989; Stuart-Tilley et al., 1998). In type A intercalated
cells, drebrin was concentrated at the apical membrane, in
contrast to the AE1 protein that was concentrated at the basal
membrane. We were unable to detect any co-existence of
drebrin staining with aquaporin positive principal cells (data
not shown).
DISCUSSION
Drebrin, a member of the ADF-H family of actin binding
proteins (Lappalainen et al., 1998), was originally discovered
in chick brain where expression of its three isoform variants is
developmentally regulated (Kojima et al., 1988, 1993). Despite
reports that drebrin mRNA is present in organs other than brain
(Kojima et al., 1988; Fisher et al., 1994), drebrin continues to
be regarded and studied primarily as a neuronal F-actin binding
protein. In this study we report the cloning of mouse drebrins
A and E2 cDNA. Drebrin E2 was expressed in both epithelial
cells and neurons. Overexpression in cultured epithelial cells
334
B. H. Keon and others
Fig. 11. Distribution of drebrin in intercalated cells of collecting
ducts. (A and B) Drebrin mAb (shown in red) shows a concentration
of drebrin at apical cell borders of type A intercalated cells, where
AE1 protein (shown in green) is present at the basal membranes.
Bars: 7 µm (A); 11 µm (B).
resulted in changes in cell morphology similar to those
observed in neurons (Shirao et al., 1992, 1994), indicating that
the role of drebrin in actin modulation is not neuronal specific.
Investigation of specific isoform expression and protein
distribution patterns outside of the brain revealed an association
of drebrin with acid-secreting cells in stomach and kidney.
Our findings that drebrin was present in cultured cell lines
were consistent with and extended a previous report in the
literature in which drebrin protein was identified in fibroblasts
and mammary carcinoma cells by F-actin overlay blots (Luna
et al., 1997). In this study, Luna and colleagues found that
drebrin was present and bound F-actin in vitro. We have
documented that drebrin was colocalized with filamentous
actin in epithelial cells in vivo, and further demonstrated that
this interaction was specific for submembranous actin.
A survey of mouse organs revealed that drebrin was present
as a minor component in several different organs and as a major
protein component in both stomach and kidney. Analyses of
drebrin expression in stomach and kidney revealed that drebrin
was present in these organs in highly specialized cell types. In
stomach, we found drebrin expression to be specific for the
acid-secreting parietal cells of the gastric glands. The parietal
cell contains two major membrane systems that are responsible
for the ability of these cells to secrete acid in a controlled
response to stimuli: The cytoplasmic tubulovesicular system
harbors the proton generating H/K ATPase, and the
intracellular canaliculi are invaginated extensions of the apical
plasma membrane facing the glandular lumen. Upon
stimulation of acid secretion, these two systems undergo
massive membrane remodeling to deliver the gastric H/K
ATPase to the apical surface for secretion of protons into the
lumen (Ito and Schofield, 1974; Forte et al., 1977). Although
the mechanisms responsible for these remodeling events are
not understood, it is clear that the actin cytoskeleton plays a
major role (Mercier et al., 1989; Smith et al., 1993; Yao et al.,
1993). Morphological studies have documented the presence
of actin filaments in cores of microvilli and submembranous
regions of the canalicular membrane (Namikawa et al., 1998).
In the present study we demonstrated the colocalization of
drebrin with these pools of actin in parietal cells. During the
process of delivery of the tubulovesicles to the canalicular
membrane, the canalicular actin network becomes much less
orderly. Drebrin may play a role in the events that underlie this
actin remodeling activity.
The kidney epithelium is comprised of highly specialized
cells arranged in a spatially organized manner consistent with
the physiological activities along the length of the nephron. We
have identified drebrin in two types of cells in distal parts of
the nephron where selective reabsorption and secretion occurs.
Drebrin was abundantly present in distal convoluted tubule
epithelium and in collecting ducts of the cortex and outer
medulla. The distal tubule epithelium is comprised of cuboidal
epithelial cells with short apical microvilli and extensive
intercellular interdigitations that greatly amplify the surface
area of the Na+K+ATPase-rich basolateral membranes. Drebrin
was concentrated at the apical membrane surfaces as well as
at the basolateral interdigitations. In the collecting duct, drebrin
was specifically expressed in intercalated cells, but was absent
from principal cells. There are at least two types of intercalated
cells, the proton secreting type A (alpha) cells, and the
bicarbonate secreting type B (beta) cells (Alper et al., 1989;
Brown and Breton, 1996). We identified drebrin in the acidsecreting type A intercalated cells. In type A cells drebrin was
concentrated at the apical plasma membrane where the proton
pump protein, H+V-ATPase, is maintained by active membrane
recycling in response to signaling cascades (Brown and Breton,
1996, and references therein). The distribution pattern of
drebrin in these cells was reminiscent of that of the actin
severing protein, gelsolin (Lueck et al., 1998). This is of
particular interest since these two proteins have been isolated
together in a stable complex (Hayashi et al., 1996).
Drebrin expression appeared to occur in cells that have
unique and specific requirements for actin plasticity. In
neurons, the fact that drebrin isoforms are expressed at
different time periods throughout development likely reflects
the unique requirements of neurons at each stage for actin
plasticity. While the subcellular distribution pattern of the
earliest neuronal embryonic isoform is not well documented,
there are distinct differences between drebrins A and E2. The
A form does indeed appear to be neuronal specific. This form
is highly specific as well in its subcellular distribution to the
post-synaptic dendritic spine (Hayashi and Shirao, 1999). The
E2 form, in contrast, is specific in its subcellular distribution
(both in neurons and non-neuronal cells) to the
submembranous actin network.
We thank the members of the Goodenough and Paul labs for their
support and helpful discussions. We extend our appreciation to Drs
Dennis Brown and John Hartwig for their interest and stimulating
discussions. For critical reading of the manuscript we thank Drs
Thomas White and Vivian Wong. We are grateful to Drs Dennis
Expression of drebrin E2 in stomach and kidney
Brown, Seth Alper, and Alan Stuart-Tilley for their generous gifts of
antibodies. We also acknowledge the generosity of the Molecular and
Biological Laboratories International Co. (Watertown, MA) for their
gift of drebrin antibody. This research was supported by NIH grants
GM 18974 to D.A.G. and GM 37751 to D.L.P. B.H.K. is supported
by NRSA postdoctoral training grant T32 NS07009.
REFERENCES
Alper, S. L., Natale, J., Gluck, S., Lodish, H. F. and Brown, D. (1989).
Subtypes of intercalated cells in rat kidney collecting duct defined by
antibodies against erythroid band 3 and renal vacuolar H+-ATPase. Proc.
Nat. Acad. Sci. USA 86, 5429-5433.
Asada, H., Uyemura, K. and Shirao, T. (1994). Actin-binding protein,
drebrin, accumulates in submembranous regions in parallel with neuronal
differentiation. J. Neurosci. Res. 38, 149-159.
Brown, D. and Breton, S. (1996). Mitochondria-rich, proton-secreting
epithelial cells. J. Exp. Biol., 199, 2345-2358.
Drubin, D. G., Mulholland, J., Zhu, Z. M. and Botstein, D. (1990).
Homology of a yeast actin-binding protein to signal transduction proteins
and myosin-I. Nature 343, 288-290.
Drubin, D. G. and Nelson, W. J. (1996). Origins of cell polarity. Cell 84,
335-344.
Fisher, L. W., McBride, O. W., Filpula, D., Ibaraki, K. and Young, M. F.
(1994). Human drebrin (DBN1): cDNA sequence, mRNA tissue distribution
and chromosomal localization. Neurosci. Res. Commun. 14, 35-42.
Fedorov, A. A., Fedorov, E., Gertler, F. and Almo, S. C. (1999). Structure
of EVH1, a novel proline-rich ligand-binding module involved in
cytoskeletal dynamics and neural function. Nature Struct. Biol. 6, 661-665.
Forte, T. M., Machen, T. E. and Forte, J. G. (1977). Ultrastructural changes
in oxyntic cells associated with secretory function: a membrane-recycling
hypothesis. Gastroenterology 73, 941-955.
Freeman, N. L., Lila, T., Mintzer, K. A., Chen, Z., Pahk, A. J., Ren, R.,
Drubin, D. G. and Field, J. (1996). A conserved proline-rich region of the
Saccharomyces cerevisiae cyclase-associated protein binds SH3 domains
and modulates cytoskeletal localization. Mol. Cell Biol. 16, 548-556.
Frigeri, A., Gropper, M., Umenishi, R., Kawashima, M., Brown, D. and
Verkman, A. S. (1995). Localization of MIWC and GLIP water channel
homologs in neuromuscular, epithelial and glandular tissues. J. Cell Sci. 108,
2993-3002.
Goode B. L., Drubin D. G. and Lappalainen, P. (1998). Regulation of the
cortical actin cytoskeleton in budding yeast by twinfilin, a ubiquitous actin
monomer-sequestering protein. J. Cell Biol. 142, 723-733.
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue
architecture and morphogenesis. Cell 84, 345-357.
Hatanpaa, K., Isaacs, K. R., Shirao, T., Brady, D. R. and Rapoport, S. I.
(1999) Loss of proteins regulating synaptic plasticity in normal aging of the
human brain and in Alzheimer disease. J. Neuropathol. Exp. Neurol. 58,
637-643.
Hayashi, K., Ishikaawa, R., Ye, L.-H., He, X.-L., Takata, K., Kohama, K.
and Shirao, T. (1996). Modulatory role of drebrin on the cytoskeleton
within dendritic spines in the rat cerebral cortex. J. Neurosci. 16, 7161-7170.
Hayashi, K., Suzuki, K. and Shirao, T. (1998). Rapid conversion of drebrin
isoforms during synapse formation in primary culture of cortical neurons.
Brain Res. Dev. Brain Res. 111, 137-141.
Hayashi, K. and Shirao, T. (1999). Change in the shape of dendritic spines
caused by overexpression of drebrin in cultured cortical neurons. J.
Neurosci. 19, 3918-3925.
Holtzman, D. A., Yang, S. and Drubin, D. G. (1993). Synthetic-lethal
interactions identify two novel genes, SLA1 and SLA2, that control
membrane cytoskeleton assembly in Saccharomyces cerevisiae. J. Cell Biol.
122, 635-644.
Ishikawa, R., Hayashi, K., Shirao, T., Xue, Y., Takagi, T., Sasaki, Y. and
Kohama, K. (1994). Drebrin, a development-associated brain protein from
rat embryo, causes the dissociation of tropomyosin from actin filaments. J.
Biol. Chem. 269, 29928-29933.
Ito, S. and Schofield, G. C. (1974). Studies on the depletion and
accumulation of microvilli and changes in the tubulovesicular compartment
of mouse parietal cells in relation to gastric acid secretion. J. Cell Biol. 63,
364-382.
Jedrzejewski, P. T. and Lehmann, W. D. (1997). Detection of modified
peptides in enzymatic digests by capillary liquid chromatography
335
electrospray mass spectrometry and a programmable skimmer CID
acquisition routine. Anal. Chem. 69, 294-301.
Kangas, H., Ulmanen, I., Paunio, T., Kwiatkowski, D. J., Lehtovirta, M.,
Jalanko, A. and Peltonen, L. (1999). Functional consequences of
amyloidosis mutation for gelsolin polypeptide – analysis of gelsolin-actin
interaction and gelsolin processing in gelsolin knock-out fibroblasts. FEBS
Lett. 454, 233-239.
Keon, B. H., Schäfer, S., Kuhn, C., Grund, C. and Franke, W. W. (1996).
Symplekin, a novel type of tight junction plaque protein. J. Cell Biol. 134,
1003-1018.
Kojima, N., Kato, Y., Shirao, T. and Obata, K. (1988). Nucleotide sequences
of two embryonic drebrins, developmentally regulated brain proteins and
developmental change in their mRNAs. Brain Res. 464, 207-215.
Kojima, N., Shirao, T. and Obata, K. (1993). Molecular cloning of a
developmentally regulated brain protein, chicken drebrin A and its
expression by alternative splicing of the drebrin gene. Brain. Res. Mol. Brain
Res. 19, 101-14.
Lappalainen, P., Kessels, M. M., Cope, M. J. and Drubin, D. G. (1998).
The ADF homology (ADF-H) domain: a highly exploited actin-binding
module. Mol. Biol. Cell 9, 1951-1959.
Larbolette, O., Wollscheid, B., Schweikert, J., Nielsen, P. J. and Wienands,
J. (1999). SH3P7 is a cytoskeleton adapter protein and is coupled to signal
transduction from lymphocyte antigen receptors. Mol. Cell Biol. 19, 15391546.
Lila, T. and Drubin, D. G. (1997). Evidence for physical and functional
interactions among two Saccharomyces cerevisiae SH3 domain proteins, an
adenylyl cyclase-associated protein and the actin cytoskeleton. Mol. Biol.
Cell 8, 367-385.
Lueck, A., Brown, D. and Kwiatkowski, D. J. (1998). The actin-binding
proteins adseverin and gelsolin are both highly expressed but differentially
localized in kidney and intestine. J. Cell Sci. 111, 3633-3643.
Luna, E. J., Pestonjamasp, K. N., Cheney, R. E., Strassel, C. P., Lu, T. H.,
Chia, C. P., Hitt, A. L., Fechheimer, M., Furthmayr, H. and Mooseker,
M. S. (1997). Actin-binding membrane proteins identified by F-actin blot
overlays. Soc. Gen. Physiol. Ser. 52, 3-18.
Mammoto, A., Sasaki, T., Asakara, T., Hotta, I., Imamura, H., Takahashi,
K., Matsuura, Y., Shirao, T. and Takai, Y. (1998). Interactions of drebrin
and gephyrin with profilin. Biochem. Biophys. Res. Commun. 243, 86-89.
McGough, A. (1998). F-actin-binding proteins. Curr. Opin. Struct. Biol. 8,
166-176.
Mercier, F., Reggio, H., Devilliers, G., Bataille, D. and Mangeat, P. (1989).
Membrane-cytoskeleton dynamics in rat parietal cells: mobilization of actin
and spectrin upon stimulation of gastric acid secretion. J. Cell Biol. 108,
441-453.
Mitchison, T. J. and Cramer, L. P. (1996). Actin-based cell motility and cell
locomotion. Cell 84, 371-379.
Namikawa, T., Araki, K. and Ogata, T. (1998). Localization of cytoskeletal
filaments during membrane rearrangement in rat parietal cells stimulated
with gastrin. Arch. Histol. Cytol. 61, 47-56.
NIH Institute of Laboratory Animal Resources, Commission on Life
Sciences, National Research Council (1996). Guide for the Care and Use
of Laboratory Animals. National Academy Press: Washington, D.C.
Puius, Y. A., Mahoney, N. M. and Almo, S. C. (1998). The modular structure
of actin-regulatory proteins. Curr. Opin. Cell Biol. 10, 23-34.
Roepstorff, P. and Fohlman, J. (1984). Proposal for a common nomenclature
for sequence ions in mass spectra of peptides. Biomed Mass Spectrom. 11,
601.
Sasaki, Y., Hayashi, K., Shirao, T., Ishikaawa, R. and Kohama, K. (1996).
Inhibition by drebrin of the actin-bundling activity of brain fascin, a protein
localized in filopodia of growth cones. J. Neurochem. 66, 980-988.
Schmidt, A. and Hall, M. N. (1998). Signaling to the actin cytoskeleton.
Annu. Rev. Cell Dev. Biol. 14, 305-338.
Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. (1996) mass
spectrometric sequencing of proteins from silver stained polyacrylamide
gels. Anal. Chem. 68, 850-858.
Shirao, T. and Obata, K. (1985). Two acidic proteins associated with brain
development in chick embryo. J. Neurochem. 44, 1210-1216.
Shirao, T., Inoue, H. K., Kano, Y. and Obata, K. (1987). Localization of a
developmentally regulated neuron-specific protein S54 in dendrites as
revealed by immunoelectron microscopy. Brain Res. 413, 374-378.
Shirao, T., Kojima, N., Kato, Y. and Obata, K. (1988). Molecular cloning
of a cDNA for the developmentally regulated brain protein, drebrin. Brain
Res. 464, 71-74.
Shirao, T., Kojima, N., Terada, S. and Obata, K. (1990). Expression of three
336
B. H. Keon and others
drebrin isoforms in the developing nervous system. Neurosci. Res. Suppl.
13, S106-111.
Shirao, T., Kojima, N. and Obata, K. (1992). Cloning of drebrin A and
induction of neurite-like processes in drebrin-transfected cells. Neuroreport
3, 109-112.
Shirao, T., Hayashi, K., Ishikawa, R., Isa, K., Asada, H., Ikeda, K. and
Uyemura, K. (1994). Formation of thick, curving bundles of actin by
drebrin A expressed in fibroblasts. Exp. Cell Res. 215, 145-153.
Shirao, T. (1995). The roles of microfilament-associated proteins, drebrins, in
brain morphogenesis: a review. J. Biochem. 117, 231-236.
Smith, P. R., Bradford, A. L., Joe, E. H., Angelides, K. J., Benos, D. J. and
Saccomani, G. (1993). Gastric parietal cell H(+)-K(+)-ATPase microsomes
are associated with isoforms of ankyrin and spectrin. Am. J. Physiol. 264,
C63-70.
Sparks, A. B., Hoffman, N. G., McConnell, S. J., Fowlkes, D. M. and Kay,
B. K. (1996). Cloning of ligand targets: systematic isolation of SH3 domaincontaining proteins. Nature Biotechnol. 14, 741-744.
Stuart-Tilley, A. K., Shmukler, B. E., Brown, D. and Alper, S. L. (1998).
Immunolocalization and tissue-specific splicing of AE2 anion exchanger in
mouse kidney. J. Am. Soc. Nephrol. 9, 946-959.
Sutherland, J. D. and Witke, W. (1999). Molecular genetic approaches to
understanding the actin cytoskeleton. Curr. Opin. Cell Biol. 11, 142-151.
Toda, M., Shirao, T., Minoshima, S., Shimizu, N., Toya, S. and Uyemura,
K. (1993). Molecular cloning of cDNA encoding human drebrin E and
chromosomal mapping of its gene. Biochem. Biophys. Res. Commun. 196,
468-472.
Toda, M., Shirao, T. and Uyemura, K. (1999). Suppression of an actinbinding protein, drebrin, by antisense transfection attenuates neurite
outgrowth in neuroblastoma B104 cells. Brain Res. Dev. Brain Res. 114,
193-200.
Van Troys, M., Vandekerckhove, J. and Ampe, C. (1999). Structural
modules in actin-binding proteins: towards a new classification. Biochim.
Biophys. Acta. 1448, 323-348.
Wesp, A., Hicke, L., Palecek, J., Lombardi, R., Aust, T., Munn, A. L. and
Riezman, H. (1997). End4p/Sla2p interacts with actin-associated proteins
for endocytosis in Saccharomyces cerevisiae. Mol. Biol. Cell 8, 2291-2306.
Yang, S., Cope, M. J. T. V. and Drubin, D. G. (1999). Sla2p is associated
with the yeast cortical actin cytoskeleton via redundant localization signals.
Mol. Biol. Cell 10, 2265-2283.
Yao, X., Thibodeau, A. and Forte, J. G. (1993). Ezrin-calpain I interactions
in gastric parietal cells. Am. J. Physiol. 265, C36-C46.
Yates, J. R., Eng, J. K. and McCormac, A. L. (1995). Mining genomes:
correlating tandem mass spectra of modified and unmodified peptides to
sequences in nucleotide databases. Anal. Chem. 67, 3202-3210.