0013-7227/02/$15.00/0
Printed in U.S.A.
Endocrinology 143(10):3984 –3993
Copyright © 2002 by The Endocrine Society
doi: 10.1210/en.2002-220344
A Prostaglandin F2␣ Analog Induces Suppressors of
Cytokine Signaling-3 Expression in the Corpus Luteum
of the Pregnant Rat: A Potential New Mechanism
in Luteolysis
J. D. CURLEWIS, S. P. TAM, P. LAU, D. H. L. KUSTERS, J. L. BARCLAY, S. T. ANDERSON,
M. J. WATERS
AND
School of Biomedical Sciences, Department of Physiology and Pharmacology and Institute for Molecular Biosciences,
University of Queensland, Queensland 4072, Australia
PRL and placental lactogen (PL) play key roles in maintaining
the rodent corpus luteum through pregnancy. Suppressors of
cytokine signaling (SOCS) have been shown to decrease cell
sensitivity to cytokines, including PRL, and so here we have
addressed the issue of whether luteolysis induced by prostaglandin F2␣ (PGF2␣) might up-regulate SOCS proteins to inhibit PRL signaling. In d 19 pregnant rats, cloprostenol, a
PGF2␣ analog, rapidly induced transcripts for SOCS-3 and, to
a lesser extent, SOCS-1. We also found increased SOCS-3 protein in the ovary by immunoblot and in the corpus luteum by
immunohistochemistry. Increased SOCS-3 expression was
preceded by an increase in STAT3 tyrosine phosphorylation
I
N RODENTS, the corpus luteum is essential for the maintenance of pregnancy because of the key roles of secreted
progesterone in facilitating embryo implantation and decidualization of the endometrial stroma as well as maintaining quiescence of the uterine myometrium. Pituitary PRL
supports the corpus luteum of early pregnancy in rodents,
and placental lactogens (PL), acting through the PRL receptor, support it from midpregnancy to term (reviewed in Ref.
1). The importance of PRL and its receptor in maintaining the
corpus luteum of pregnancy in rodents was earlier demonstrated by studies with neutralizing antisera to PRL (2) and
was more recently demonstrated with both PRL and PRL
receptor knockout mice (3, 4). Likewise, the importance of the
key signaling intermediate used by the PRL receptor to support the rodent corpus luteum, signal transducer and activator of transcription 5 (STAT5), is illustrated by the inability
of STAT5a/b double knockout mice to form or maintain a
corpus luteum (5). PRL is thought to maintain progesterone
output from the rodent corpus luteum by a range of complementary actions, including facilitation of the luteotropic
actions of estrogen by increasing the synthesis of estrogen
receptors ␣ and ␤ (6), and by up-regulating LH receptors (7,
8). PRL also increases cholesterol substrate availability for
progesterone synthesis by increasing high density lipopro-
Abbreviations: CIS, Cytokine-inducible SH2-containing protein; FP
receptor, PGF2␣ receptor; GPCR, G protein-coupled receptor; HRP,
horseradish peroxidase; 20␣-HSD, 20␣-hydroxysteroid dehydrogenase;
JAK, Janus kinase; oPRL, ovine PRL; PL, placental lactogen; PGF2␣,
prostaglandin F2␣; SOCS, suppressors of cytokine signaling; STAT, signal transducer and activator of transcription.
10 min after cloprostenol injection and was maintained for 4 h,
as determined by gel shift and immunohistochemistry. Induction of SOCS-3 was accompanied by a sharp decrease in active
STAT5, as determined by gel-shift assay and by loss of nuclear
localized STAT5. Four hours after cloprostenol administration, the corpus luteum was refractory to stimulation of
STAT5 by PRL administration, and this was not due to downregulation of PRL receptor. Therefore, induction of SOCS-3 by
PGF2␣ may be an important element in the initiation of luteolysis via rapid suppression of luteotropic support from PL.
(Endocrinology 143: 3984 –3993, 2002)
tein-binding sites (9, 10), luteal cholesterol esterase activity
(11), and the P450 side-chain cleavage enzyme (12). The repression of 20␣-hydroxysteroid dehydrogenase (20␣-HSD)
expression by PRL (13, 14) is also an important element in the
luteotropic actions of PRL, because it prevents further metabolism of progesterone to 20␣-hydroxyprogesterone (reviewed in Ref. 1). This repression, like the up-regulation
of estrogen receptor and potentially other actions listed
above, is believed to involve STAT5b signaling (15). These
actions are brought to an end by luteolysis at the end of
pregnancy, through a prostaglandin F2␣ (PGF2␣)-dependent process that is absent in the PGF2␣ receptor knockout
mouse (16). Recent gene array data (17) show that PGF2␣
and PRL have opposite effects on the expression of many
genes in the rat corpus luteum, raising the possibility of
functional antagonism between these two hormones.
We have recently reported that the STAT5a-dependent
actions of PRL in signaling to the milk protein ␤-lactoglobulin gene promoter are inhibited by members of the suppressors of cytokine signaling (SOCS) family of rapid response genes (18). Moreover, we observed an induction of
SOCS-3 during the initial stages of mammary gland involution caused by pup withdrawal (18). Mammary gland involution requires STAT3 (19), and SOCS-3 transcript expression is strongly up-regulated by STAT3 (20). Considering the
parallels between the apoptotic processes of mammary gland
involution and luteolysis, we tested the hypothesis that a
major element in the luteolytic action of PGF2␣ in the rat is
blockade of the luteotropic action of PRL/PL by induction of
SOCS proteins. This study reports that an analog of PGF2␣ is
3984
Curlewis et al. • SOCS3 and Luteolysis
able to potently induce SOCS-3 expression, which would
contribute substantially to its role in luteolysis.
Materials and Methods
Materials
Ovine PRL (oPRL-20) was obtained from the National Hormone and
Peptide Program (Baltimore, MD). Goat anti-PRL receptor (s46) was a
gift from J. Djiane (Jouy-en-Josas, France). Goat anti-SOCS-3 (sc 7009),
rabbit anti-STAT1 (sc346X), anti-STAT3 (sc482X), and anti-STAT5
(sc835X) were purchased from Santa Cruz Biotechnology, Inc. (Santa
Cruz, CA). Rabbit anti-SOCS-3 antibody was a gift from D. J. Hilton
(Melbourne, Australia). Biotinylated donkey antirabbit antibody
(RPN1004), streptavidin-horseradish peroxidase (HRP; RPN1015), HRPconjugated sheep antimouse antibody (NA931), and HRP-conjugated
donkey antirabbit antibody (NA934) were purchased from Amersham
Pharmacia Biotech (Uppsala, Sweden). Biotinylated rabbit antigoat antibody (85-9943) was obtained form Zymed Laboratories, Inc. (South San
Francisco, CA). Donkey antirabbit Texas Red conjugate (711-075-152)
was purchased from Jackson ImmunoResearch Laboratories, Inc. (West
Grove, PA). HRP-conjugated rabbit antigoat antibody (31402) was purchased from Pierce Chemical Co. (Rockford, IL).
Animals
All experiments were performed on d 19 pregnant Wistar rats (day
of mating plug ⫽ d 1). Animals were injected sc with cloprostenol (5 ␮g
in 0.25 ml saline; Estrumate, Schering Plough Animal Health Corp.,
North Ryde, Australia) or vehicle and then were killed 0.5–16 h later with
an overdose of pentobarbitone. The ovaries were rapidly removed and
frozen on solid CO2 (for Northern blots, Western blots, and EMSAs) or
were immersion-fixed in 4% paraformaldehyde in 0.1 m phosphate
buffer for 4 h (for immunohistochemistry). In one experiment animals
were treated with cloprostenol, followed 3 h and 25 min later by a sc
injection of oPRL (250 ␮g) or vehicle and then were killed at 4 h after
the cloprostenol. In all experiments three animals were used for each
treatment group. These experiments were approved by the University
of Queensland animal ethics committee according to the National Health
and Medical Research Council (Australia) guidelines.
Northern hybridization
Total RNA was isolated from ovaries using TRIzol reagent (Life
Technologies, Inc., Gaithersburg, MD), and Northern blots were performed for SOCS-1, SOCS-2, SOCS-3, and cytokine-inducible SH2containing protein (CIS) as previously described (18). Membranes were
stripped and rehybridized with a probe to 18S rRNA for standardization
(18). Densitometer scans were also performed as previously described
(18), and results were expressed as the fold induction relative to vehicletreated controls collected at 0.5 h.
Immunoblotting and immunoprecipitation
The immunoblotting procedure was undertaken using the protocol
described by Tam et al. (18), with minor modifications. Briefly, frozen
ovaries were homogenized in RIPA buffer [150 mm NaCl, 1% Nonidet
P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, and
50 mm Tris (pH 7.5)] with complete protease inhibitor cocktail (catalogue
no. 1697498, Roche, Mannheim, Germany). Lysates were then boiled in
Laemmli sample buffer before being centrifuged.
For SOCS-3 immunoblotting, total lysates containing 150 ␮g protein
were electrophoresed on 13% (29:1) SDS-PAGE gels and then transferred
onto nitrocellulose membranes. The prepared nitrocellulose membranes
were incubated with Tris-buffered saline (pH 7.5) containing 3% teleostean gelatin (Sigma, St. Louis, MO; catalog no. G 7765) and 0.2%
Tween 20 to block nonspecific binding. The membranes were probed
with goat anti-SOCS-3 antibody (sc7009) at 1:250 at 4 C overnight.
Thereafter, membranes were incubated with HRP-conjugated rabbit
antigoat antibody at 1:25,000 for 1.5 h at room temperature, followed by
development with ECL Plus (Amersham Pharmacia Biotech). For the
positive control, total cell lysate from Flag-SOCS-3 cDNA vector-transfected HEK-293 cells were used as previously described (18).
Endocrinology, October 2002, 143(10):3984 –3993 3985
For PRL receptor immunoblotting, total lysate containing 200 ␮g
protein was electrophoresed on 8% (29:1) SDS-PAGE gels and then
transferred onto nitrocellulose membranes. The prepared nitrocellulose
membranes were blocked with Tris-buffered saline (pH 7.5) containing
5% skim milk powder/0.2% Tween 20 and probed with goat anti-PRL
receptor s46 (1:5000) (21, 22) at 4 C overnight. Thereafter, membranes
were incubated with HRP-conjugated rabbit antigoat antibody at
1:25,000 for 1 h at room temperature, followed by development with ECL
Plus (Amersham Pharmacia Biotech). For the positive control, total cell
lysate from rabbit PRL receptor cDNA vector-transfected COS-1 cells
was used as previously described (18). SOCS-3 and PRL receptor Western blots were quantified by densitometry, and results were expressed
as the fold induction relative to that in vehicle-treated controls.
For immunoprecipitation of STAT3, ovaries were homogenized in
RIPA buffer with 10 mm NaF, 1 mm Na3VO4, 1 mm Na4P2O7, and
complete protease inhibitor cocktail (Roche). After 30-min incubation,
the lysate was cleared by 30-min centrifugation at 15,000 rpm in a
microcentrifuge at 4 C. Lysate containing 1.5 mg protein (as determined
by the bicinchoninic acid protein assay, Pierce Chemical Co.) were
immunoprecipitated for 2 h at 4 C with 3 ␮g anti-STAT3 antibody bound
to protein A/Sepharose (Amersham Pharmacia Biotech). After extensive
washing, bound proteins were eluted by boiling in SDS-PAGE sample
buffer, run on 8.5% SDS-PAGE gels, and transferred to nitrocellulose
membranes.
The prepared nitrocellulose membranes were blocked with Trisbuffered saline (pH 7.5) containing 3% BSA/0.1% Tween 20 and probed
with monoclonal phosphotyrosine antibody 4G10 at 1:1000 (Upstate
Biotechnology, Inc., Lake Placid, NY) at room temperature for 2 h.
Thereafter, membranes were incubated with HRP-conjugated sheep antimouse antibody at 1:10,000 for 1 h at room temperature, followed by
development with ECL Plus (Amersham Pharmacia Biotech). The membrane was stripped and reprobed with anti-STAT3 antibody at 1:1000.
Immunohistochemistry
Localization of SOCS-3 immunoreactivity in the ovary was performed using two SOCS-3 primary antibodies with different protocols.
Paraffin sections (5 ␮m) were dewaxed, rehydrated, pretreated with 3%
H2O2, blocked with 10% normal horse serum, and then incubated with
either rabbit anti-SOCS-3 (Hilton; 1:200) or nonimmune rabbit serum
(negative control) overnight at 4 C. After washing in PBS, sections were
incubated with biotinylated donkey antirabbit (1:200) for 2 h at room
temperature, washed, then incubated with streptavidin-HRP complex
(1:200) for another 2 h. Sections were developed for 5–7 min with diaminobenzidene substrate before being counterstained with hematoxylin, dehydrated, and mounted. To verify the specificity of SOCS-3 staining in response to cloprostenol, immunolabeling with another antibody
was also performed on fixed ovaries that were equilibrated in 30%
sucrose/0.1 m PBS before being frozen and sectioned (10 ␮m) on a
cryostat. Sections were washed in PBS, treated with 3% H2O2, serumblocked, then incubated with goat anti-SOCS-3 antibody (sc7009; 1:1000)
for 24 h at 4 C. After further washing in PBS, biotinylated rabbit antigoat
was used as the secondary antibody, followed by streptavidin-HRP
complex and diaminobenzidene for visualization. All immunolabeling
was performed on slides with paired ovaries, one from each treatment.
Sections were viewed with a Zeiss Axioskop light microscope (Carl
Zeiss, New York, NY), and images were acquired with an Olympus
Corp. DP11 digital camera system (New Hyde Park, NY).
STAT3 and STAT5 immunostaining were examined on fixed ovarian
tissue from which cryostat sections were prepared as described above.
Sections were then incubated with either rabbit anti-STAT3 (sc482X;
1:1000) or rabbit anti-STAT5 (sc835X; 1:1000) for 24 h at 4 C. They were
then rinsed in PBS, incubated with donkey antirabbit Texas red (1:400)
for 18 h at 4 C, washed, and coverslipped. Confocal immunofluorescence
images were obtained using a Nikon Eclipse E600 upright microscope
(Melville, NY) with a confocal scanning system [Radiance 2000HP Scanhead with three descanned detectors, Bio-Rad Laboratories, Inc. (Richmond, CA)] equipped with a four-line argon laser (488-nm line) and a
helium/neon laser (568-nm line). A 570LP (long-pass) filter was used;
the excitation/emission maxima for Texas Red is 596/615 nm. Images
were captured with the Lasersharp 2000 software (Bio-Rad Laboratories,
Inc.) and edited in Adobe Photoshop 4.0 (Adobe Systems, San Jose, CA).
3986
Endocrinology, October 2002, 143(10):3984 –3993
Curlewis et al. • SOCS3 and Luteolysis
FIG. 2. Western blot for SOCS-3 in ovaries from animals killed 0.5– 8
h after treatment with vehicle (⫺) or cloprostenol (⫹). Dissected ovaries were homogenized with RIPA buffer and then analyzed for protein expression of SOCS-3 as described in Materials and Methods.
Endogenous and Flag-SOCS-3 fusion proteins are indicated (arrows).
The positive control marker for SOCS-3 consists of a flag-tagged
SOCS-3 protein product that is 2 kDa greater in molecular mass than
endogenous protein, as previously described (18). The bottom panel
shows the mean induction relative to vehicle-treated controls (⫾SEM;
n ⫽ 3 rats). *, P ⬍ 0.05 compared with vehicle-treated rats at the same
time.
FIG. 1. Cloprostenol induces SOCS-3 mRNA expression in the ovary.
Day 19 pregnant Wistar rats were injected sc with cloprostenol (5 ␮g)
or vehicle and were then killed 0.5–16 h later. Ovaries were dissected,
and total RNA was extracted. The RNA was then analyzed for SOCS
gene expression by Northern analysis and was normalized with the
18S rRNA probe as previously described (18). The top panel shows
representative Northern blots. The bottom panels show the mean
induction of SOCS mRNA ⫾ SEM (n ⫽ 3 rats) for vehicle-treated (0.5
and 4 h) and cloprostenol-treated (0.5– 8 h) groups. P ⬍ 0.05 compared
with either vehicle-treated control.
Oligonucleotide probes and EMSA
Double-stranded oligonucleotide probes used in EMSA and for cold
competition were: STAT5 DNA binding element, 5⬘-AGA TTTCTAGGAATTCAATCC-3⬘ (sc-2565; Santa Cruz Biotechnology, Inc.); STAT
DNA-binding element on SOCS-3 promoter, 5⬘-CAGTTCCAGGAATCGGGGGGC-3⬘ (20); and acute phase response element, GATCCTTCCGGGAATTCCTA (23). The methodology for EMSA and supershift has
been previously described in detail (18). Cold competition studies involved coincubation of unlabeled probes with labeled probes at 10- and
50-fold molar excesses with nuclear extracts in binding buffer for 30 min
on ice before gel separation.
Statistics
All data were log transformed before analysis to normalize variance.
Northern blots were analyzed by one-way ANOVA. Where significant
treatment effects were obtained, Duncan’s new multiple range test was
then used to compare individual means. For Western blots, two-way
ANOVA was used to test for effects of treatment and time. However,
because there were significant (P ⬍ 0.05) treatment ⫻ time interactions
in both analysis (Figs. 2 and 10), we then performed independent oneway ANOVA at each time point.
Results
PGF2␣ analog induces SOCS-3 mRNA and protein
expression in the ovary
Administration of cloprostenol to d 19 pregnant rats
caused a rapid and significant (P ⬍ 0.01, by ANOVA) increase in SOCS-1 and SOCS-3 mRNA. The increase in SOCS-1
mRNA was only evident at 0.5 h, whereas the increase in
SOCS-3 mRNA was more sustained, lasting from 0.5– 4 h
after cloprostenol treatment (Fig. 1). This increased SOCS-3
mRNA expression could be detected as early as 15 min after
cloprostenol administration (results not shown). SOCS-2 and
CIS mRNA were expressed in the ovary, but were not influenced by cloprostenol.
SOCS-3 protein expression in the ovary was determined
by Western blot. Ovaries from cloprostenol- and vehicletreated rats were collected 0.5, 2, 4, and 8 h after treatment.
At 2 and 4 h, cloprostenol caused a significant (P ⬍ 0.05)
increase in SOCS-3 protein (Fig. 2), but at 8 h, SOCS-3 protein
expression was not different between vehicle and
cloprostenol.
Curlewis et al. • SOCS3 and Luteolysis
Effect of PGF2␣ analog on distribution of SOCS-3 protein in
the ovary
The cellular distribution of SOCS-3 in the ovary at d 19 of
pregnancy was examined 4 h after the injection of either
vehicle or cloprostenol. In both groups of animals SOCS-3
immunoreactivity was largely confined to the corpora lutea
(Fig. 3a), with low levels of staining also present in some
Endocrinology, October 2002, 143(10):3984 –3993 3987
interstitial cells and blood vessels. Within luteal cells, SOCS-3
immunoreactivity was confined to the cytoplasmic compartment. Overall SOCS-3 immunoreactivity was more intense in
the corpora lutea of cloprostenol-treated animals, although,
as shown in Fig. 3, c– h, the distribution was not uniform
across all cells of a corpus luteum, and the intensity also
differed between corpora lutea (not shown).
FIG. 3. SOCS-3 immunoreactivity in the ovary of d 19 pregnant rats obtained 4 h after vehicle or cloprostenol injection. SOCS-3 labeling (brown)
was observed predominantly in corpora lutea of ovaries immunolabeled with rabbit anti-SOCS-3 antibody (a), but not in those immunolabeled
with nonimmune rabbit serum (b). Within luteal cells, cytoplasmic SOCS-3 immunolabeling was more intense in the corpora lutea of cloprostenol-treated animals (d and f) than in vehicle controls (c and e). Sections are counterstained with hematoxylin (blue). Differences between
treatments in the intensity of cytoplasmic SOCS-3 labeling were confirmed with a goat anti-SOCS3 antibody: vehicle (g) vs. cloprostenol (h).
Results are representative of three rats for each treatment.
3988
Endocrinology, October 2002, 143(10):3984 –3993
Curlewis et al. • SOCS3 and Luteolysis
PGF2␣ analog inhibits STAT5 activation
Previous studies have shown that a low level of nuclear
phosphorylated STAT5 is maintained through pregnancy,
presumably due to activation of PRL receptor by PL (24).
Here we used immunofluorescence to examine the cellular
distribution of STAT5 in luteal cells from vehicle- or cloprostenol-treated animals. Four hours after vehicle injection,
STAT5 immunostaining in the majority of luteal cells was
most intense in the nucleus compared with cytoplasm (Fig. 4,
A and C). In contrast, 4 h after cloprostenol treatment, the
nucleus was devoid of immunostaining and appears as a
black circle surrounded by cytoplasmic immunostaining for
STAT5 (Fig. 4, B and D). Similar differences in STAT5 cellular
localization were also evident in corpora lutea collected 2 h
after cloprostenol or vehicle injection (results not shown).
We also used EMSAs to evaluate the effect of cloprostenol
on STAT5 in the ovary at 0.5, 2, 4, and 8 h after cloprostenol
or vehicle treatment. In Fig. 5A we used a STAT5 DNAbinding element and found that a high level of active STAT5
was maintained during the sampling period in vehicletreated controls. In contrast, active STAT5 was reduced at all
time points after cloprostenol injection. Supershift with antiSTAT5 confirmed that the predominant DNA element-binding activity was due to STAT5. This result was confirmed
with the STAT DNA-binding element from the SOCS-3 promoter (Fig. 5B), which binds STAT1, -3, and -5 (20, 25). Again,
active STAT was present at all time points after vehicle injection, and activity was inhibited by cloprostenol. Supershift
with anti-STAT5 confirmed that the major band was due to
active STAT5, but in cloprostenol-treated animals a faint
band just above the position of the main band of active STAT
A
C
B
D
FIG. 4. Nuclear STAT5 immunostaining in luteal cells is reduced by
cloprostenol. Confocal images of STAT5 immunoreactivity in the corpus luteum of ovaries obtained 4 h after vehicle (A and C) or cloprostenol (B and D) injection. Sections were labeled with rabbit antiSTAT5 antibody and visualized with donkey antirabbit Texas Red
conjugate. Results are representative of the pattern seen in three rats
from each treatment.
FIG. 5. Nuclear localized STAT5 DNA binding in ovaries of d 19
pregnant rats is inhibited by cloprostenol treatment. Ovaries obtained from pregnant rats treated with cloprostenol (⫹) or vehicle (⫺)
for 0.5– 8 h were extracted for nuclear protein, which was subjected
to EMSA. A, The method and the STAT5 DNA-binding element used
as a probe were previously described (18, 55). The STAT5 gel-shift
band was confirmed by STAT5-specific antibody supershift. Equal
loading was confirmed by Oct-1 gel shift (lower panel). Three individual rats from each treatment group were analyzed. B, EMSA using
the STAT DNA-binding element on SOCS-3 promoter shows evidence
for binding of nuclear protein in addition to STAT5. Nuclear extracts
from A were analyzed by EMSA and STAT5 antibody supershift using
radiolabeled STAT-responsive element of the SOCS-3 promoter.
Three rats from each treatment group were analyzed.
was seen up to 4 h after treatment. This additional faint band
could be due to activation of either STAT1 or STAT3.
PGF2␣ analog causes STAT3 activation
Additional EMSAs were undertaken to identify the STATs
activated by cloprostenol injection. In Fig. 6A nuclear extracts
from ovaries collected 0.5 h after vehicle or cloprostenol
injection show strong binding to the STAT DNA-binding
element from the SOCS-3 promoter (control; lanes 7 and 8).
Supershift with anti-STAT1 had no appreciable effect (lanes
1 and 2). Supershift with anti-STAT5 (lanes 5 and 6) moved
the major band in both vehicle- and cloprostenol-treated
samples, but a faint band, just above the major STAT5 band,
remained visible. In contrast, supershift with anti-STAT3
(lanes 3 and 4) reduced the apparent width of the main band,
which is most evident in the cloprostenol-treated sample
(lane 4). Cold competition with either probe inhibited binding (lanes 9 –12). In Fig. 6B an additional experiment was
performed on ovarian nuclear extracts from cloprostenoltreated animals collected 0.5 h after treatment. In the two
supershift experiments anti-STAT5 shifted the lower band of
active STAT (lanes 1 and 4), but a second band of slightly
lower mobility remained evident. However, when antiSTAT3 and anti-STAT5 were used together (lanes 2 and 5),
both the upper and lower bands were shifted. Cold competition with the SOCS-3 probe reduced binding in both bands
(lane 7). In contrast, competition with the STAT5 probe (10fold molar excess) did not remove the upper band (lane 8).
Finally, cold competition (10-fold molar excess) with the
Curlewis et al. • SOCS3 and Luteolysis
Endocrinology, October 2002, 143(10):3984 –3993 3989
FIG. 6. Cloprostenol treatment induces STAT3
binding to the STAT DNA-binding element on
SOCS-3 promoter in ovaries from pregnant rats. A,
EMSA was performed on nuclear extracts from ovaries collected 0.5 h after treatment with vehicle (⫺)
or cloprostenol (⫹). In vehicle-treated ovarian nuclear extract, only STAT5 is present when analyzed
by anti-STAT5 antibody supershift and cold competition studies. Cloprostenol-treated nuclear extracts showed both STAT3 and STAT5 gel-shift
bands when analyzed by antibody supershift. The
results are representative of two independent experiments. B, Ovarian nuclear extracts from two
individual rats treated with cloprostenol (0.5 h)
were analyzed by EMSA. STAT3 and -5 were found
to be present in the extracts by both antibody supershift and cold competition analyses.
acute phase response element probe, which preferentially
binds STAT3, resulted in loss of the upper band (lane 10) with
the lower band also reduced at 50-fold molar excess (lane 11).
To verify that STAT3 is activated by cloprostenol treatment, nuclear ovarian extracts, collected 10 min and 2 h after
vehicle or cloprostenol injection, were immunoprecipitated
with anti-STAT3, followed by Western blot with antiphosphotyrosine. Blots were then stripped and reprobed with
anti-STAT3. The results in Fig. 7 show increased tyrosinephosphorylated STAT3 in ovary from cloprostenol-treated
animals at both 10 min and 2 h.
Finally, we used immunohistochemistry to investigate the
cellular localization of STAT3 in luteal cells 4 h after vehicle
or cloprostenol treatment. In vehicle-treated animals, intense
STAT3 immunoreactivity was found predominantly in the
cytoplasm, with the nucleus evident as a dark circle (Fig. 8).
In contrast, 4 h after cloprostenol treatment the intensity of
STAT3 immunostaining in luteal cells was greater in the
nucleus than in the cytoplasm.
Response to PRL injection
We determined whether the corpus luteum of cloprostenol-treated animals could respond to an injection of PRL with
increased STAT3 or STAT5 activity. All animals were treated
with cloprostenol, followed 3 h and 25 min later by an injection of PRL (250 ␮g oPRL, sc) or vehicle. Rats were killed
4 h after cloprostenol treatment, and ovarian nuclear extracts
were subjected to EMSA with both the STAT5 DNA-binding
element (Fig. 9A) and the STAT DNA-binding element from
the SOCS-3 promoter (Fig. 9B). Treatment with PRL did not
stimulate the level of active STAT above that in the controls
3990
Endocrinology, October 2002, 143(10):3984 –3993
Curlewis et al. • SOCS3 and Luteolysis
FIG. 7. Cloprostenol induces STAT3 tyrosine phosphorylation in the
ovary 10 min and 2 h after injection. Ovarian protein lysates from two
individual cloprostenol-treated (⫹) or vehicle-treated (⫺) rats were
immunoprecipitated for STAT3 and immunoblotted with antiphosphotyrosine antibody. Tyrosine phosphorylation of STAT3 was induced by cloprostenol treatment. Reprobing of the membrane
with anti-STAT3 antibody indicated that STAT3 protein was not
up-regulated.
A
B
FIG. 8. Nuclear STAT3 immunostaining in luteal cells is increased by
cloprostenol. Confocal images of STAT3 immunoreactivity in the corpus luteum of ovaries obtained 4 h after vehicle (A) or cloprostenol (B)
injection. Sections were labeled with rabbit anti-STAT3 antibody and
developed with donkey antirabbit Texas Red conjugate. Results are
representative of the pattern seen in three rats for each treatment.
FIG. 9. Ovarian STAT3 and -5 nuclear binding is unresponsive to
PRL after cloprostenol treatment. Day 19 pregnant rats were injected
with cloprostenol, followed 3.25 h later with an injection of oPRL (250
␮g, sc; ⫹) or vehicle (⫺). Nuclear extracts were analyzed for STATs
by EMSA with the STAT5 DNA-binding element (A) and the STAT
DNA-binding element (B) on SOCS-3 promoter.
(Fig. 9), which suggests that after cloprostenol treatment, the
corpus luteum is resistant to PRL. Supershift with antiSTAT5 and anti-STAT3 confirmed that neither STAT3 nor
STAT5 binding was affected by PRL treatment.
Resistance to PRL signaling is not due to down-regulation
of PRL receptor
The very rapid loss of nuclear STAT5 translocation from
0.5– 4 h after cloprostenol and the absence of a STAT5 response to PRL stimulation at 4 h could be due to a rapid loss
of PRL receptor from luteal cells. We therefore quantified
PRL receptor in cytosolic extracts from ovaries by Western
blot with a well validated polyclonal antiserum (21). An
immunoreactive band of the appropriate size for the PRL
receptor was present in the ovary (Fig. 10), and at 2 and 4 h
after injection there was no difference between vehicle- and
cloprostenol-treated animals. However, 8 h after cloprostenol there was a significant (P ⬍ 0.01) reduction in the intensity of the immunoreactive band.
Discussion
PRL and PL are thought to play a central role in maintaining the rodent corpus luteum through generation of active STAT5a/b. In this study we have shown that cloprostenol treatment of d 19 pregnant rats reduces active STAT5
in the corpus luteum for at least 8 h. This indicates that the
Janus kinase 2 (JAK2)/STAT5 signaling pathway, which is
normally activated by PL binding to the PRL receptor at this
FIG. 10. Resistance to PRL signaling at 4 h is not due to downregulation of PRL receptor. Total protein lysates from cloprostenol- or
vehicle-treated ovaries were immunoblotted for PRL receptor as described in Materials and Methods. PRL receptor was down-regulated
only at 8 h after cloprostenol treatment. The bottom panel shows mean
induction relative to vehicle-treated controls (⫾SEM; n ⫽ 3 rats).
**, P ⬍ 0.01 compared with vehicle-treated rats at the same time.
Curlewis et al. • SOCS3 and Luteolysis
Endocrinology, October 2002, 143(10):3984 –3993 3991
FIG. 11. Proposed mechanism for the inhibition of PRL receptor signaling by PGF2␣ at
the onset of luteolysis. Throughout pregnancy, PRL receptor signaling through the
JAK2/STAT5 pathway maintains progesterone synthesis and inhibits its conversion to
the inactive 20␣-hydroxyprogesterone (20␣OHP). Activation of the PG FP receptor at
luteolysis rapidly up-regulates SOCS-3,
which then inhibits the PRL receptor signaling pathway.
stage of pregnancy, is inhibited by cloprostenol. Further,
cloprostenol, presumably acting through the PGF2␣ receptor
(FP receptor), also causes a rapid and substantial increase in
SOCS-3 mRNA, which is evident from 0.5– 4 h after treatment. At the time of maximum SOCS-3 protein expression as
detected by Western blot (4 h after cloprostenol treatment),
almost all of the SOCS-3 immunoreactivity within the ovary
was confined to the corpora lutea. As SOCS-3 is able to inhibit
the generation of active STAT5 (18, 26, 27), we propose that
SOCS-3 induction is a major element in the luteolytic actions
of PGF2␣, through blockade of tropic support by activated
PRL receptor. The involvement of SOCS-3 as an inhibitory
protein parallels its postulated role in decreasing the sensitivity of the mammary gland to PRL during lactational involution (18) and its role in the induction of refractoriness of
the hepatocyte to GH by inflammatory cytokines such as
IL-1␤ (28). This differs from the role played by SOCS-1 in
blocking production of ␣2-macroglobulin in the antimesometrial decidual cells of the rat uterus (29). Although we did find
a weak induction of SOCS-1 by cloprostenol, we believe that
the greater magnitude and duration of SOCS-3 induction
favor it as the major inhibitory SOCS in the rat corpus
luteum.
Evidence for loss of active STAT5 in response
to cloprostenol
In these experiments on the d 19 pregnant rat we have
confirmed that active STAT5 is present in the corpus luteum
of control animals, as demonstrated in previous studies of
rats on d 15 and 17 of pregnancy (24, 30). We used two
approaches to confirm the presence of active STAT5 in the
corpus luteum. First, immunohistochemistry with antiSTAT5 showed much stronger staining in the nucleus than
in the cytoplasm of luteal cells, and second, gel-shift analysis
of nuclear extracts from whole ovary confirmed the presence
of active STAT5 in all vehicle-treated animals. However,
when animals were treated with cloprostenol, both methods
showed a marked reduction in active or nuclear STAT5 at all
time points examined between 0.5 and 8 h by EMSA and at
2 and 4 h by immunohistochemistry. In late pregnancy (d 15)
PRL injection does induce a small increase in active STAT5,
even though there is sustained activation of STAT5 by the
persistently elevated plasma concentrations of PL (24). However, in our experiments we were unable to reinduce STAT5
activation in cloprostenol-treated animals by injection of a
large dose of PRL, indicating that the corpus luteum was
resistant to PRL signaling through the JAK/STAT5 pathway.
This resistance to PRL that we observed after cloprostenol
injection could well be due to the induction of SOCS-3, but
it is also possible that other factors, such as a reduction in PRL
receptor content on luteal cells, are involved. It is known that
PRL receptor mRNA expression declines over the period of
natural luteolysis (31), and PRL receptor expression itself is
dependent on active STAT5 (32). In the present study we
used Western blots to examine PRL receptor protein expression and could not detect a decrease in expression until after
4 h postinjection, although by 8 h postinjection PRL receptor
expression was significantly decreased. This is in agreement
with the study by Telleria et al. (31) and is to be expected
given the proposed role of STAT5 in promoting PRL receptor
expression (32). This subsequent down-regulation of PRL
receptor would therefore maintain resistance to the tropic
effects of PRL at this later time (8 h) when SOCS-3 expression
has declined.
Mechanism for induction of SOCS-3 expression
It is of interest to consider the pattern of induction of SOCS
transcripts examined here (SOCS-1 to -3 and CIS) in response
3992
Endocrinology, October 2002, 143(10):3984 –3993
to cloprostenol. In these late pregnant rats cloprostenol
strongly induced SOCS-3 and weakly induced SOCS-1, but
was without effect on CIS and SOCS-2. This is distinct from
the induction of all of these transcripts by PRL in nonpregnant, lactating rat ovary (18), with a shorter period of induction evident for PRL-induced SOCS-3 transcripts than
that seen here with cloprostenol. Given that PRL also
strongly induces CIS transcripts in rat adrenal gland and
mammary gland (18), it would appear that the stimulus for
SOCS gene induction differs between cloprostenol and PRL,
concordant with their differing mechanisms of action and the
fact that active STAT5 is markedly decreased by cloprostenol. STAT5 is considered to be a major inducing factor for CIS
(33), and the lack of CIS induction supports the view that
STAT5 is not instrumental here in terms of SOCS-3 induction.
EMSA supershifts with anti-STAT provide no evidence for
active STAT1, in agreement with previous studies reporting
that there is no active STAT1 in the ovary (30, 34). However,
in their analysis of control of the SOCS-3 promoter by leukemia inhibitory factor, Auernhammer et al. (20) identified
key STAT3-regulated cis elements, and we have shown here,
by gel-shift analysis and immunohistochemistry, that cloprostenol is able to rapidly activate STAT3. This is accompanied by rapid (10 min) tyrosine phosphorylation of STAT3,
which is maintained for at least 4 h. Moreover, increased
binding of STAT3 to the SOCS-3 regulatory element described by Auernhammer et al. (20) in response to addition
of cloprostenol was also shown in gel supershift experiments.
Ligand activation of the PRL receptor itself induces tyrosine and serine phosphorylation of STAT3 by a protein
kinase C␦-dependent mechanism (35), but it is difficult to
reconcile how such an effect could account for the difference
between vehicle- and cloprostenol-treated animals in the
present study. A more likely mechanism could involve a
direct interaction between the PG FP receptor and the JAK/
STAT3 pathway. Although there is no publication in support
of such an interaction for this receptor, there is substantial
evidence that other G protein-coupled receptor (GPCR) can
bind to and activate JAKs and hence also activate STATs.
Examples include the angiotensin II receptor, which couples
through Gq␣ (36) to JAK2, and the TSH receptor, which
couples through the Gs␣ (37). The bradykinin B2R (38), the
serotonin HT2A receptor (39), and the endothelin ETA receptor (40) are other GPCRs that activate JAK kinases and
hence STATs. In these cases and for others involving a range
of g protein-coupled receptor (GPCR), such as the bombesin,
vasopressin, and ␣2-adrenergic receptors, the ubiquitous Src
tyrosine kinase has also been shown to be rapidly activated
by ligand binding (41, 42), and this is a strong activator of
STAT3, the major inducer of SOCS-3 expression (20, 43).
Activation of Src by GPCRs can occur by direct association
with Gs␣ or Gi␣ (44), by trans-activation of tyrosine kinase
receptors such as the epidermal growth factor receptor (45),
or by other means, such as activation by Pyk2, a tyrosine
kinase activated by elevated intracellular Ca2⫹ (46). There is
evidence that the PG FP receptor can increase Src-like kinase
activity (47), although definitive identification of Src is lacking. In the MC3T3-E1 osteoblastic line, a range of proteins are
rapidly tyrosine phosphorylated in response to PGF2␣ (48).
It should be noted that Src would not be inhibited by
Curlewis et al. • SOCS3 and Luteolysis
elevated SOCS-3, whereas the generation of active STAT5
through binding to tyrosine-phosphorylated PRL receptor
and other cytokine receptors would be blocked (49). The
JAK inhibitor, SOCS-1, selectively inhibits cytokine-induced,
but not v-Src induced, JAK-STAT activation (49, 50). This is
unlikely to be the complete mechanism, however, because
Src can induce nuclear translocation (but not activation) of
STAT5b, although it cannot do this for STAT5a (51). There
may be an additional input through activation of the MAPK
(ERK1/2) pathway as a result of cloprostenol acting on the
FP receptor (52), as MAPKs are able to fully activate STAT3
through phosphorylation of Ser727 (53). Hence, the minimal
model here would be activation of Src or a Src kinase member
by cloprostenol, followed by activation of STAT3 by tyrosine
phosphorylation and serine phosphorylation, and thence induction of SOCS-3, which would block the actions of PRL to
maintain luteal function. This model could be generalized to
immune and inflammatory mechanisms involving PG-mediated actions in the presence of immune modulatory
cytokines.
In conclusion, we have identified a novel mechanism that
could be a major element in the initiation of luteolysis by PGF2␣
in rodents. Blockade of the luteotropic actions of PL by SOCS
proteins in late pregnancy (Fig. 11) would complement the
other actions of PGF2␣ that result from induction of Nur77 (54),
such as increased expression of 20␣-HSD, with the two actions
together resulting in rapid functional luteolysis.
Acknowledgments
The authors thank the NIDDK National Hormone and Peptide Program and Dr A. F. Parlow for the gift of purified PRL.
Received March 25, 2002. Accepted June 18, 2002.
Address all correspondence and requests for reprints to: J. D.
Curlewis, Ph.D., Department of Physiology and Pharmacology,
University of Queensland, Queensland 4072, Australia. E-mail:
[email protected].
This work was supported in part by a grant from the Queensland
Cancer Fund (to M.J.W.).
References
1. Risk M, Gibori G 2000 Mechanisms of luteal cell regulation by prolactin. In:
Horseman ND, ed. Prolactin. Boston: Kluwer Academic; 265–295
2. Yoshinaga K 1974 Ovarian progestin secretion in lactating rats: effect of intrabursal injection of prolactin antiserum, prolactin and LH. Endocrinology
94:829 – 834
3. Horseman ND, Zhao W, Montecino-Rodriguez E, Tanaka M, Nakashima K,
Engle SJ, Smith F, Markoff E, Dorshkind K 1997 Defective mammopoiesis,
but normal hematopoiesis, in mice with a targeted disruption of the prolactin
gene. EMBO J 16:6926 – 6935
4. Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, Edery M,
Brousse N, Babinet C, Binart N, Kelly PA 1997 Null mutation of the prolactin
receptor gene produces multiple reproductive defects in the mouse. Genes Dev
11:167–178
5. Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D,
Brown M, Bodner S, Grosveld G, Ihle JN 1998 Stat5a and Stat5b proteins have
essential and nonessential, or redundant, roles in cytokine responses. Cell
93:841– 850
6. Frasor J, Park K, Byers M, Telleria C, Kitamura T, Yu-Lee LY, Djiane J,
Park-Sarge OK, Gibori G 2001 Differential roles for signal transducers and
activators of transcription 5a and 5b in PRL stimulation of ER␣ and ER␤
transcription. Mol Endocrinol 15:2172–2181
7. Segaloff DL, Wang HY, Richards JS 1990 Hormonal regulation of luteinizing
hormone/chorionic gonadotropin receptor mRNA in rat ovarian cells during
follicular development and luteinization. Mol Endocrinol 4:1856 –1865
8. Gafvels M, Bjurulf E, Selstam G 1992 Prolactin stimulates the expression of
luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic
Curlewis et al. • SOCS3 and Luteolysis
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
acid in the rat corpus luteum and rescues early pregnancy from bromocriptineinduced abortion. Biol Reprod 47:534 –540
Murphy BD, Rajkumar K, McKibbin PE, Macdonald GJ, Buhr MM,
Grinwich DL 1985 The effects of hypophysectomy and administration of
pituitary hormones on luteal function and uptake of high density lipoproteins
by luteinized ovaries and adrenals of the rat. Endocrinology 116:1587–1597
Rajkumar K, Couture RL, Murphy BD 1985 Binding of high-density lipoproteins to luteal membranes: the role of prolactin, luteinizing hormone, and
circulating lipoproteins. Biol Reprod 32:546 –555
Aten RF, Kolodecik TR, Macdonald GJ, Behrman HR 1995 Modulation of
cholesteryl ester hydrolase messenger ribonucleic acid levels, protein levels,
and activity in the rat corpus luteum. Biol Reprod 53:1110 –1117
Hickey GJ, Oonk RB, Hall PF, Richards JS 1989 Aromatase cytochrome P450
and cholesterol side-chain cleavage cytochrome P450 in corpora lutea of pregnant rats: diverse regulation by peptide and steroid hormones. Endocrinology
125:1673–1682
Lamprecht SA, Lindner HR, Strauss 3rd JF 1969 Induction of 20␣-hydroxysteroid dehydrogenase in rat corpora lutea by pharmacological blockade of
pituitary prolactin secretion. Biochim Biophys Acta 187:133–143
Albarracin CT, Parmer TG, Duan WR, Nelson SE, Gibori G 1994 Identification of a major prolactin-regulated protein as 20␣-hydroxysteroid dehydrogenase: coordinate regulation of its activity, protein content, and messenger
ribonucleic acid expression. Endocrinology 134:2453–2460
Zhong L, Parmer TG, Robertson MC, Gibori G 1997 Prolactin-mediated
inhibition of 20␣-hydroxysteroid dehydrogenase gene expression and the tyrosine kinase system. Biochem Biophys Res Commun 235:587–592
Sugimoto Y, Segi E, Tsuboi K, Ichikawa A, Narumiya S 1998 Female reproduction in mice lacking the prostaglandin F receptor. Roles of prostaglandin
and oxytocin receptors in parturition. Adv Exp Med Biol 449:317–321
Stocco C, Callegari E, Gibori G 2001 Opposite effect of prolactin and prostaglandin F2␣ on the expression of luteal genes as revealed by rat cDNA
expression array. Endocrinology 142:4158 – 4161
Tam SP, Lau P, Djiane J, Hilton DJ, Waters MJ 2001 Tissue-specific induction
of SOCS gene expression by PRL. Endocrinology 142:5015–5026
Chapman RS, Lourenco P, Tonner E, Flint D, Selbert S, Takeda K, Akira S,
Clarke AR, Watson CJ 2000 The role of Stat3 in apoptosis and mammary gland
involution. Conditional deletion of Stat3. Adv Exp Med Biol 480:129 –138
Auernhammer CJ, Bousquet C, Melmed S 1999 Autoregulation of pituitary
corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci USA 96:6964 – 6969
Waters MJ, Daniel N, Bignon C, Djiane J 1995 The rabbit mammary gland
prolactin receptor is tyrosine-phosphorylated in response to prolactin in vivo
and in vitro. J Biol Chem 270:5136 –5143
Jahn GA, Daniel N, Jolivet G, Belair L, Bole-Feysot C, Kelly PA, Djiane J 1997
In vivo study of prolactin (PRL) intracellular signalling during lactogenesis in
the rat: JAK/STAT pathway is activated by PRL in the mammary gland but
not in the liver. Biol Reprod 57:894 –900
Wegenka UM, Lutticken C, Buschmann J, Yuan J, Lottspeich F, Muller-Esterl
W, Schindler C, Roeb E, Heinrich PC, Horn F 1994 The interleukin-6-activated
acute-phase response factor is antigenically and functionally related to members of the signal transducer and activator of transcription (STAT) family. Mol
Cell Biol 14:3186 –3196
Russell DL, Richards JS 1999 Differentiation-dependent prolactin responsiveness and stat (signal transducers and activators of transcription) signaling
in rat ovarian cells. Mol Endocrinol 13:2049 –2064
Emanuelli B, Peraldi P, Filloux C, Sawka-Verhelle D, Hilton D, Van Obberghen E 2000 SOCS-3 is an insulin-induced negative regulator of insulin
signaling. J Biol Chem 275:15985–15991
Pezet A, Favre H, Kelly PA, Edery M 1999 Inhibition and restoration of
prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem
274:24497–24502
Dif F, Saunier E, Demeneix B, Kelly PA, Edery M 2001 Cytokine-inducible
SH2-containing protein suppresses PRL signaling by binding the PRL receptor.
Endocrinology 142:5286 –5293
Boisclair YR, Wang J, Shi J, Hurst KR, Ooi GT 2000 Role of the suppressor
of cytokine signaling-3 in mediating the inhibitory effects of interleukin-1␤ on
the growth hormone-dependent transcription of the acid-labile subunit gene
in liver cells. J Biol Chem 275:3841–3847
Barkai U, Prigent-Tessier A, Tessier C, Gibori GB, Gibori G 2000 Involvement of SOCS-1, the suppressor of cytokine signaling, in the prevention of
prolactin-responsive gene expression in decidual cells. Mol Endocrinol 14:
554 –563
Russell DL, Norman RL, Dajee M, Liu X, Henninghausen L, Richards JS 1996
Prolactin-induced activation and binding of stat proteins to the IL-6RE of the
␣2-macroglobulin (␣2M) promoter: relation to the expression of ␣2M in the rat
ovary. Biol Reprod 55:1029 –2038
Telleria CM, Parmer TG, Zhong L, Clarke DL, Albarracin CT, Duan WR,
Linzer DI, Gibori G 1997 The different forms of the prolactin receptor in the
Endocrinology, October 2002, 143(10):3984 –3993 3993
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
rat corpus luteum: developmental expression and hormonal regulation in
pregnancy. Endocrinology 138:4812– 4820
Galsgaard ED, Nielsen JH, Moldrup A 1999 Regulation of prolactin receptor
(PRLR) gene expression in insulin-producing cells. Prolactin and growth hormone activate one of the rat prlr gene promoters via STAT5a and STAT5b. J Biol
Chem 274:18686 –28692
Matsumoto A, Masuhara M, Mitsui K, Yokouchi M, Ohtsubo M, Misawa H,
Miyajima A, Yoshimura A 1997 CIS, a cytokine inducible SH2 protein, is a
target of the JAK-STAT5 pathway and modulates STAT5 activation. Blood
89:3148 –3154
Dajee M, Fey GH, Richards JS 1998 Stat 5b and the orphan nuclear receptors
regulate expression of the ␣2-macroglobulin (␣2M) gene in rat ovarian granulosa cells. Mol Endocrinol 12:1393–1409
Peters CA, Maizels ET, Robertson MC, Shiu RP, Soloff MS, HunzickerDunn M 2000 Induction of relaxin messenger RNA expression in response to
prolactin receptor activation requires protein kinase C␦ signaling. Mol Endocrinol 14:576 –590
Ali MS, Sayeski PP, Dirksen LB, Hayzer DJ, Marrero MB, Bernstein KE 1997
Dependence on the motif YIPP for the physical association of Jak2 kinase with
the intracellular carboxyl tail of the angiotensin II AT1 receptor. J Biol Chem
272:23382–23388
Park ES, Kim H, Suh JM, Park SJ, You SH, Chung HK, Lee KW, Kwon OY,
Cho BY, Kim YK, Ro HK, Chung J, Shong M 2000 Involvement of JAK/STAT
(Janus kinase/signal transducer and activator of transcription) in the thyrotropin signaling pathway. Mol Endocrinol 14:662– 670
Ju H, Venema VJ, Liang H, Harris MB, Zou R, Venema RC 2000 Bradykinin
activates the Janus-activated kinase/signal transducers and activators of transcription (JAK/STAT) pathway in vascular endothelial cells: localization of
JAK/STAT signalling proteins in plasmalemmal caveolae. Biochem J 351:
257–264
Guillet-Deniau I, Burnol AF, Girard J 1997 Identification and localization of
a skeletal muscle secrotonin 5-HT2A receptor coupled to the Jak/STAT pathway. J Biol Chem 272:14825–14829
Peeler TC, Conrad KM, Baker KM 1996 Endothelin stimulates sis-inducing
factor-like DNA binding activity in CHO-K1 cells expressing ETA receptors.
Biochem Biophys Res Commun 221:62– 66
Luttrell LM, Daaka Y, Lefkowitz RJ 1999 Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr Opin Cell Biol 11:177–183
Rodriguez-Fernandez JL, Rozengurt E 1996 Bombesin, bradykinin, vasopressin, and phorbol esters rapidly and transiently activate Src family tyrosine
kinases in Swiss 3T3 cells. Dissociation from tyrosine phosphorylation of p125
focal adhesion kinase. J Biol Chem 271:27895–27901
Cao X, Tay A, Guy GR, Tan YH 1996 Activation and association of Stat3 with
Src in v-Src-transformed cell lines. Mol Cell Biol 16:1595–1603
Ma YC, Huang J, Ali S, Lowry W, Huang XY 2000 Src tyrosine kinase is a novel
direct effector of G proteins. Cell 102:635– 646
Saito Y, Berk BC 2001 Transactivation: a novel signaling pathway from angiotensin II to tyrosine kinase receptors. J Mol Cell Cardiol 33:3–7
Eguchi S, Iwasaki H, Inagami T, Numaguchi K, Yamakawa T, Motley ED,
Owada KM, Marumo F, Hirata Y 1999 Involvement of PYK2 in angiotensin
II signaling of vascular smooth muscle cells. Hypertension 33:201–206
Caverzasio J, Palmer G, Suzuki A, Bonjour JP 2000 Evidence for the involvement of two pathways in activation of extracellular signal-regulated kinase
(Erk) and cell proliferation by Gi and Gq protein-coupled receptors in osteoblast-like cells. J Bone Miner Res 15:1697–1706
Hakeda Y, Shiokawa M, Mano H, Kameda T, Raisz LG, Kumegawa M 1997
Prostaglandin F2␣ stimulates tyrosine phosphorylation and mitogen-activated
protein kinase in osteoblastic MC3T3–E1 cells via protein kinase C activation.
Endocrinology 138:1821–1828
Iwamoto T, Senga T, Naito Y, Matsuda S, Miyake Y, Yoshimura A, Hamaguchi
M 2000 The JAK-inhibitor, JAB/SOCS-1 selectively inhibits cytokine-induced, but
not v-Src induced JAK-STAT activation. Oncogene 19:4795– 4801
Krebs DL, Hilton DJ 2000 SOCS: physiological suppressors of cytokine signaling. J Cell Sci 113:2813–2819
Kazansky AV, Kabotyanski EB, Wyszomierski SL, Mancini MA, Rosen JM
1999 Differential effects of prolactin and src/abl kinases on the nuclear translocation of STAT5B and STAT5A. J Biol Chem 274:22484 –22492
Stocco CO, Lau LF, Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and
20␣-hsd genes by prostaglandin F2␣ in ovarian cells. J Biol Chem 277:3293–3302
Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal activation of transcription by
Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:
241–250
Stocco CO, Zhong L, Sugimoto Y, Ichikawa A, Lau LF, Gibori G 2000 Prostaglandin F2␣-induced expression of 20␣-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:37202–37211
Chen C, Clarkson RW, Xie Y, Hume DA, Waters MJ 1995 Growth hormone
and colony-stimulating factor 1 share multiple response elements in the c-Fos
promoter. Endocrinology 136:4505– 4516