Variable expression of endothelial NO synthase
in three forms of rat pulmonary hypertension
ROBERT C. TYLER,1 MASASHI MURAMATSU,1 STEVEN H. ABMAN,2
THOMAS J. STELZNER,1 DAVID M. RODMAN,1 KENNETH D. BLOCH,3
AND IVAN F. MCMURTRY1
1Cardiovascular Pulmonary Research Laboratory and 2Department of Pediatrics, University
of Colorado Health Sciences Center, Denver, Colorado 80262; and 3Cardiovascular Research Center,
Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts 02129
hypoxia; pulmonary circulation; fawn-hooded rat; monocrotaline; nitric oxide
THE PULMONARY VASCULAR ENDOTHELIUM is uniquely
positioned to produce a variety of vasoactive mediators
in response to changes in blood O2 and CO2 tensions,
pressure, and flow. One such mediator, nitric oxide
(NO), is synthesized by endothelial NO synthase (eNOS)
and relaxes smooth muscle, inhibits neutrophil and
platelet activation and adhesion, and attenuates smooth
muscle cell proliferation (1). In the normotensive adult
pulmonary circulation, NO mediates vasodilation to
some stimuli and moderates vasoconstriction to others, but
its overall importance in maintaining low basal vascular
tone is unclear (1, 6, 8, 26). Similarly, there are conflicting
reports of what happens to pulmonary vascular NO activity during development of pulmonary hypertension.
Some investigators have found increased NO production (10, 25), enhanced NO-dependent vasodilation (7,
25), and an NO-mediated attenuation of resting vascular tone in hypoxia-induced hypertensive rat lungs (5,
10, 26). Increased lung tissue and pulmonary vascular
expression of eNOS mRNA and protein have also been
observed (18, 29, 32, 38). However, others (2) have
reported decreases in endothelium-dependent vasodilation in isolated hypertensive rat lungs and pulmonary
arteries. In two other forms of rat pulmonary hypertension, i.e., monocrotaline induced and fawn-hooded idiopathic, isolated extralobar pulmonary arteries have
blunted responses to endothelium-dependent vasodilators (4, 21), but intralobar arteries and perfused lungs
showed NO-mediated attenuation of resting vascular
tone (21, 40). A recent report (29) indicated that pulmonary arterial eNOS gene expression and NO activity
are also increased in monocrotaline-induced hypertensive lungs, but similar measurements have not been
reported for fawn-hooded rat lungs. Thus it remains
unclear how the relationship between eNOS gene expression and NO production and activity is altered in
different forms of pulmonary hypertension.
To further investigate the effects of pulmonary hypertension on eNOS gene expression, tissue localization,
and NO production, we compared eNOS mRNA and
protein levels and basal NO activity in the hypertensive lungs of chronically hypoxic, monocrotalinetreated, and fawn-hooded rats. Although these three
different forms of pulmonary hypertension show similar characteristics of increases in resting pulmonary
vascular tone, medial thickening of muscular pulmonary arteries, and neomuscularization of pulmonary
arterioles (23, 24, 31), there are dissimilarities that
may influence eNOS expression and NO activity. For
example, in the hypoxic model, the pulmonary vascular
endothelium is exposed to low O2 tensions and polycythemia, whereas these factors are not major components of the development of hypertension in the other
two models (9, 29, 31). Also, although monocrotalineinduced pulmonary hypertension is preceded and accompanied by severe pulmonary microvascular endothelial
injury and perivascular inflammation, these disorders
do not generally occur in either hypoxic or fawn-hooded
rats (2, 14, 31). Finally, fawn-hooded rats, which have a
platelet storage pool disorder, spontaneously develop
1040-0605/99 $5.00 Copyright r 1999 the American Physiological Society
L297
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
Tyler, Robert C., Masashi Muramatsu, Steven H.
Abman, Thomas J. Stelzner, David M. Rodman, Kenneth D. Bloch, and Ivan F. McMurtry. Variable expression
of endothelial NO synthase in three forms of rat pulmonary
hypertension. Am. J. Physiol. 276 (Lung Cell. Mol. Physiol.
20): L297–L303, 1999.—Endothelial nitric oxide (NO) synthase (eNOS) mRNA and protein and NO production are
increased in hypoxia-induced hypertensive rat lungs, but it is
uncertain whether eNOS gene expression and activity are
increased in other forms of rat pulmonary hypertension. To
investigate these questions, we measured eNOS mRNA and
protein, eNOS immunohistochemical localization, perfusate
NO product levels, and NO-mediated suppression of resting
vascular tone in chronically hypoxic (3–4 wk at barometric
pressure of 410 mmHg), monocrotaline-treated (4 wk after 60
mg/kg), and fawn-hooded (6–9 mo old) rats. eNOS mRNA
levels (Northern blot) were greater in hypoxic and monocrotaline-treated lungs (130 and 125% of control lungs, respectively; P , 0.05) but not in fawn-hooded lungs. Western
blotting indicated that eNOS protein levels increased to
300 6 46% of control levels in hypoxic lungs (P , 0.05) but
were decreased by 50 6 5 and 60 6 11%, respectively, in
monocrotaline-treated and fawn-hooded lungs (P , 0.05).
Immunostaining showed prominent eNOS expression in small
neomuscularized arterioles in all groups, whereas perfusate
NO product levels increased in chronically hypoxic lungs (3.4
6 1.4 µM; P , 0.05) but not in either monocrotaline-treated
(0.7 6 0.3 µM) or fawn-hooded (0.45 6 0.1 µM) lungs vs.
normotensive lungs (0.12 6 0.07 µM). All hypertensive lungs
had increased baseline perfusion pressure in response to
nitro-L-arginine but not to the inducible NOS inhibitor aminoguanidine. These results indicate that even though NO activity
suppresses resting vascular tone in pulmonary hypertension,
there are differences among the groups regarding eNOS gene
expression and NO production. A better understanding of eNOS
gene expression and activity in these models may provide
insights into the regulation of this vasodilator system in
various forms of human pulmonary hypertension.
L298
ENOS
GENE EXPRESSION IN PULMONARY HYPERTENSION
pulmonary hypertension of unknown etiology at sea
level and an increased severity of the disease at the
altitude of Denver (14, 31). Our experiments show that
although NO activity apparently suppresses resting
vascular tone in all three forms of pulmonary hypertension, there are significant differences among the groups
in lung tissue eNOS gene expression and NO production.
METHODS
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
Animals. Adult male Sprague-Dawley rats (250–350 g)
were exposed to either hypobaric hypoxia (17,000 ft, barometric pressure 410 mmHg) for 3–4 wk, a single subcutaneous
injection of monocrotaline (60 mg/kg) and allowed 4 wk to
develop pulmonary hypertension, or control conditions (altitude of Denver 5,280 ft, barometric pressure 630 mmHg).
Adult male fawn-hooded rats, which are genetically predisposed to spontaneously develop pulmonary hypertension,
were studied at 6–9 mo of age (250–300 g) when they had
severe pulmonary hypertension at the altitude of Denver (31).
All rats were exposed to a 12:12-h light-dark cycle and
allowed free access to standard rat chow and water.
RNA blot hybridization. Control, chronically hypoxic, monocrotaline-treated, and fawn-hooded rats (n 5 5 for each) were
anesthetized with 30 mg of intraperitoneal pentobarbital
sodium, the chest was opened, and a lateral peripheral
sample of lung tissue (,100 mg) was removed and immediately homogenized in 1 ml of guanidine isothiocyanate.
Homogenates were then frozen and stored at 270°C until
assayed. RNA was extracted by ultracentrifugation through
cesium chloride and measured by ultraviolet light absorbance
at 260 nm. Five micrograms of total cellular RNA were
fractionated in 1.3% agarose-formaldehyde gels containing
ethidium bromide, transferred to MagnaCharge membranes
(Micron Separations), and cross-linked by ultraviolet light.
Membranes were hybridized overnight at 42°C with a 32Plabeled BamH I-EcoR I restriction fragment of the rat eNOS
cDNA (12), washed for 45 min at 65°C in 0.23 saline-sodium
citrate (SSC; 13 SSC is 15 mM sodium citrate and 150 mM
sodium chloride) plus 0.1% sodium dodecyl sulfate (SDS), and
then exposed to X-ray film. The membranes were subsequently hybridized with a 10 M excess of 32P-labeled oligonucleotide (ACGGTATCTGATCGTCTTCGAAC) complementary to rat 18S RNA, and the autoradiograms were scanned
and analyzed with a LaCie SilverScanner II and the National
Institutes of Health Image 1.44 software. The eNOS mRNA
concentrations are expressed as eNOS-to-18S absorbance
ratios.
Western blotting. Samples of lung tissue were isolated from
the four groups of rats as described in RNA blot hydridization
and homogenized in an ice-cold extraction solution that
contained 50 mM Tris · HCl (pH 7.3), 0.1 mM EDTA, 0.1 mM
EGTA, 1 M KCl, 20 mM 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, 10% glycerol, 0.1% b-mercaptoethanol, 100 µM phenylmethylsulfonyl fluoride, 2 µM leupeptin,
1 µM pepstatin A, and 5 µg/ml of aprotinin. The homogenates
were centrifuged at 14,000 g for 30 min at 4°C to remove cell
debris. Protein was measured with a Bio-Rad dye reagent and
loaded at 10 µg/lane in the minigel or 75 µg/lane in the large
gel (SDS-polyacrylamide, 7.5% wt /vol) (17). Proteins were
transferred electrophoretically to nitrocellulose membranes
(Optitran, Schleicher and Schuell) and stained with Ponceau
S (Sigma) to visualize loading. The blot was incubated
overnight at 4°C in blocking solution [2% bovine serum
albumin (BSA; Sigma) in Tris-buffered saline-0.1% Tween 20
(TBS-T; pH 7.6)] and then for 2 h at room temperature with
primary antibody to eNOS (dilution 1:500 in 2% BSA-TBS-T;
mouse monoclonal IgG1; Transduction Laboratories). After
the blot was washed in TBS-T at room temperature, the blot
was incubated with horseradish peroxidase labeled with
donkey anti-mouse secondary antibody (diluted 1:17,000 in
2% BSA-TBS-T; Jackson Immunochemicals) for 45 min at
room temperature. The blot was then washed in TBS with
and without Tween 20. Positive protein bands were visualized
by chemiluminescence (enhanced chemiluminescence kit, Amersham) and measured by densitometry (Silverscanner II,
National Institutes of Health Photoshop).
Immunohistochemical staining for eNOS and von Willebrand factor proteins. Lungs were perfusion fixed with buffered 1% paraformaldehyde, cut into 2- to 6-mm sections,
placed in 10% buffered Formalin, and embedded in paraffin.
Paraffin sections 5 µm thick were serially mounted onto
Superfrost Plus slides (Fisher Scientific, Fair Lawn, NJ) and
dewaxed in 100% xylene. Sections were rehydrated by immersion in 100% ethanol, 95% ethanol-5% water, 70% ethanol30% water, and then 100% water. Antigen retrieval was
performed by boiling the slides in 0.01 M citric acid, pH 6.0.
Slides were washed in PBS (13 PBS is 2.7 mM KCl, 1.2 mM
KH2PO4, 138 mM NaCl, and 8.1 mM NaHPO4 ). Endogenous
biotin in the tissue sections was blocked by glucose-glucose
oxidase treatment [0.2 M glucose and 1.5 U/ml glucose
oxidase (Boehringer Mannheim) in 13 PBS]. The slides were
washed in 13 PBS. Sections were blocked with Super Block
(Sky Tek, Logan, UT) diluted 1:10 (vol/vol) in 13 PBS and
were then incubated with anti-eNOS monoclonal antibody
(Transduction Laboratories) diluted 1:10,000, anti-von Willebrand factor polyclonal antibody (DAKO) diluted 1:10,000, or
an IgG1 negative control (Jackson Laboratories) diluted
1:10,000 in 13 PBS-2% NaN3 (wt /vol). The slides were
washed again in 13 PBS and incubated in streptavidin-biotinhorseradish peroxide solution. They were then developed
with diaminobenzidine and hydrogen peroxide with NiCl for
enhancement (Vector). The NiCl enhancement-diaminobenzidine color development reaction was stopped by washing with
water; the slides were dehydrated in 70% ethanol-30% water,
95% ethanol-5% water, and 100% ethanol; and dehydration
was completed with 100% xylene before a coverslip was
put on.
Isolated lungs. Lungs were isolated from the control pulmonary normotensive rats and from three groups of pulmonary
hypertensive rats after intraperitoneal administration of 30
mg of pentobarbital sodium and an intracardiac injection of
200 IU of heparin. After cannulation of the pulmonary artery
and left ventricle, the lungs were flushed of blood with 20 ml
of physiological salt solution (PSS) and placed in a heated,
humidified chamber. They were ventilated at an inspiratory
pressure of 9 cmH2O and end-expiratory pressure of 2.5
cmH2O with a humid mixture of 21% O2-5% CO2-74% N2 at 60
breaths/min. Perfusion was at a constant peristaltic pump
flow of 0.04 ml · g body wt21 · min21. The PSS perfusate
contained (in mM) 116.3 NaCl, 5.4 KCl, 0.83 MgSO4, 19.0
NaHCO3, 1.04 NaH2PO4, 1.8 CaCl2 · H2O, and 5.5 D-glucose
(Earle’s balanced salt solution; Sigma). Ficoll (4 g/100 ml,
type 70; Sigma) was included as a colloid, and meclofenamate
(3.1 µM) was added to inhibit prostaglandin synthesis. Effluent perfusate was drained from the left ventricular cannula
into a reservoir and was recirculated (total volume 30 ml).
Lung and perfusate temperatures were maintained at 38°C,
and perfusate pH was kept between 7.35 and 7.45. Mean
perfusion pressure was measured continuously with a transducer and pen recorder, and changes in pressure were considered to reflect changes in vascular resistance. The lungs were
equilibrated for 20 min before experiments were begun. To
ENOS
GENE EXPRESSION IN PULMONARY HYPERTENSION
RESULTS
Right ventricular hypertrophy. The existence of pulmonary hypertension in the chronically hypoxic, monocrotaline-treated, and fawn-hooded rats was reflected
in the increased right ventricular-to-left ventricular
plus septal weight ratios that were, respectively, 0.55 6
0.03 (n 5 6), 0.53 6 0.04 (n 5 9), and 0.76 6 0.08 (n 5
13) vs. 0.30 6 0.01 (n 5 6; P , 0.05) in normotensive
control animals. Although pulmonary arterial pressures were not measured, these results suggested that
the fawn-hooded rats had more severe pulmonary
hypertension than the other two hypertensive groups.
eNOS mRNA. Northern blot analysis of peripheral
lung tissue showed similar increases in eNOS mRNA in
chronically hypoxic and monocrotaline-treated hypertensive lungs (130 and 125% of normotensive control
lungs, respectively; P , 0.05) but not in fawn-hooded
hypertensive lungs (Fig. 1). Northern blot probing for
expression of inducible NOS (iNOS) mRNA with a rat
cDNA (genomic fragment containing exon 23 of the
iNOS gene) in the above groups was negative (data not
shown).
eNOS protein. Western blot analysis of lung homogenates showed increased eNOS protein levels in chronically hypoxic hypertensive lungs but decreased levels
in monocrotaline-treated and fawn-hooded hypertensive lungs (Fig. 2).
eNOS localization. Immunohistochemical staining of
lung sections from all three forms of pulmonary hyper-
Fig. 1. Expression of endothelial nitric oxide synthase (eNOS) mRNA
in chronically hypoxic, monocrotaline-treated, and fawn-hooded hypertensive rat lungs (n 5 5/group). eNOS mRNA is shown as ratio of
18S mRNA (eNOS/18S) by densitometry of Northern blot autoradiograph. eNOS/18S was used to control for uneven loading. * P , 0.05
vs. control.
tension showed prominent expression of eNOS protein
in small, medium, and large arteries (Fig. 3). In contrast, there was little eNOS staining in the small
peripheral vessels of normotensive lungs (Fig. 3). There
was also eNOS staining of airway epithelial cells in
both normotensive and hypertensive lungs. Monocrotaline-treated lungs had thickened alveolar walls, whereas
the fawn-hooded lungs showed an emphysematous
Fig. 2. Expression of eNOS protein in chronically hypoxic, monocrotaline-treated, and fawn-hooded hypertensive rat lungs (n 5 4–6/
group). eNOS protein is shown as percent of levels expressed in
normotensive lungs. Hypoxia vs. control lungs and monocrotaline vs.
fawn-hooded vs. control lungs were run on separate gels. Faint bands
were observed for the monocrotaline-treated lungs that do not appear
on the scanned image. * P , 0.05 vs. control.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
test for NO-mediated suppression of resting normoxic vascular tone, the NOS inhibitors 100 µM nitro-L-arginine (26) and
300 µM aminoguanidine (11) or their respective vehicles
saline and DMSO were added to the perfusate, and the
changes in perfusion pressure were measured 30 min later.
Measurement of perfusate NO products. An NO chemiluminescence analyzer (Sievers Research) was used to measure
2
levels of NO products (NOx; NO, NO2
2 , NO3 , and nitrosothiols) in the normoxic PSS perfusates of control normotensive and chronically hypoxic, monocrotaline-treated, and
fawn-hooded hypertensive lungs. After 65 min of recirculating perfusion, 2-ml samples of effluent perfusate were drawn
into N2-flushed syringes and stored at 220°C for up to 2 wk.
The samples were then thawed, and a 10-µl aliquot was
injected into the vacuum chamber of the NO analyzer that
contained 2 ml of 0.1 M vanadium chloride (type III; Aldrich)
dissolved in 1 N HCl and heated to 90°C to convert back to NO
2
any NO2
2 , NO3 , and nitrosothiols that may have been formed.
The liberated NO was driven into the gas phase of the
vacuum chamber by bubbling the reaction mixture with
argon. Linear calibration curves were generated by measuring NO produced by 10–100 pM sodium nitrate solutions. A
small background signal produced by the PSS plus Ficoll
solution was subtracted from the lung perfusate signal.
Determination of right ventricular hypertrophy. After the
animals were killed for the above analyses, the hearts were
dissected and the wet weight ratio of right ventricle to left
ventricle plus septum was determined.
Statistics. The means (6SE) for each group were calculated, and differences among groups were determined by
one-way analysis of variance. Significant differences were
determined at P , 0.05.
L299
L300
ENOS
GENE EXPRESSION IN PULMONARY HYPERTENSION
DISCUSSION
pattern of alveolar wall breakdown and an apparent
rarification of small vessels as judged by the paucity of
von Willebrand immunostaining (Fig. 4).
Vasoreactivity. Addition of the nonselective NOS inhibitor nitro-L-arginine to the perfusate of chronically
hypoxic, monocrotaline-treated, and fawn-hooded hypertensive lungs during normoxic (21% O2 ) ventilation
caused marked increases in baseline vascular tone in
each group (Fig. 5). In contrast, aminoguanidine, a
preferential inhibitor of iNOS, did not cause vasoconstriction in any group of hypertensive lungs. Previous
studies (5, 10, 26) have shown that NOS inhibitors
elicit little or no vasoconstriction in normoxic normotensive rat lungs.
NOx levels. NOx accumulation in perfusate of isolated
lungs was significantly elevated only in the chronically
hypoxic hypertensive lungs (Fig. 6).
Fig. 4. Immunohistochemical localization of von Willebrand factor in
normotensive and chronically hypoxic and monocrotaline-treated
hypertensive rat lungs shows a similar density of precapillary
vessels, whereas fawn-hooded hypertensive rat lungs show fewer
vessels and enlarged alveoli. Staining was absent in IgG control
lungs (data not shown). Magnification, 34.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
Fig. 3. Immunohistochemical localization of von Willebrand factor
(left) and eNOS protein (right) in lungs of normotensive, chronically
hypoxic, monocrotaline-treated, and fawn-hooded hypertensive rat
lungs. In all lung groups, von Willebrand staining in endothelial cells
is present in large, medium, and precapillary vessels (solid arrows)
but is not observed in airway epithelium. In normotensive lungs,
eNOS staining was predominantly in endothelium of large- and
medium-sized pulmonary vessels (solid arrows), with precapillary
vessels showing either faint staining or no staining (open arrows). In
contrast, each of the pulmonary hypertensive lungs showed eNOS
staining in large, medium, and precapillary vessels, as well as in
airway epithelium. Staining was absent in IgG control (data not
shown). Magnification, 310.
This study compared levels of eNOS mRNA and
protein, localization of eNOS protein, NO-mediated
suppression of resting (normoxic) vascular tone, and
basal NO production in the hypertensive lungs of
chronically hypoxic, monocrotaline-treated, and fawnhooded rats. Measurement of right ventricular hypertrophy showed that all three groups of rats had developed
pulmonary hypertension. The fawn-hooded rats apparently had the most severe hypertension, which may
have been due to the longer duration of the disease
process (28 vs. 3–4 wk) (31), elevated endothelin (ET)-1
levels (34), or other unidentified vasoactive factors.
Northern and Western blot analyses of lung tissue and
chemiluminescence assay of perfusate NOx showed
significant differences among the hypertensive groups
in lung eNOS gene expression and normoxic NO production. The chronically hypoxic and monocrotalinetreated groups had increased eNOS mRNA, whereas
the fawn-hooded rat lungs were similar to control
lungs. Total eNOS protein levels were elevated in the
chronically hypoxic but reduced in the monocrotalinetreated and fawn-hooded hypertensive lungs compared
with normotensive lungs. In contrast, a similar pattern
of prominent eNOS protein expression was observed in
small pulmonary arteries of all three hypertensive
groups, which would appear to be linked to the NOdependent attenuation of resting vascular tone in the
perfused hypertensive lungs. However, only the hypoxiainduced hypertensive lungs had elevated NOx levels in
the lung perfusate.
Our observations agree with previous reports (18, 29,
32, 38) that eNOS mRNA and protein are increased in
hypoxia-induced hypertensive rat lungs. Le Cras et al.
(18) found that at least part of the increase in lung
tissue eNOS is due to increased expression of the
enzyme in the endothelium of hypertensive muscular
pulmonary arteries and de novo expression in small
ENOS
GENE EXPRESSION IN PULMONARY HYPERTENSION
L301
Fig. 5. Effects of 100 mM nitro-L-arginine (L-NNA; a
nonselective NOS inhibitor) or 300 mM aminoguanidine
(AG; a preferential iNOS inhibitor) on baseline (normoxic) perfusion pressure in hypoxia-induced, monocrotaline-treated, and fawn-hooded hypertensive rat lungs
(n 5 4–6/group). Increase in perfusion pressure (Dpressure) was measured 30 min after addition of either
vehicle (C) or inhibitor. Normotensive lungs do not show
an increase in baseline (normoxic) perfusion pressure
(data not shown). L-NNA response was not significantly
different among 3 groups. * P , 0.05 vs. C.
Fig. 6. Concentrations of perfusate NO-containing compounds (NOx )
in normotensive control and chronically hypoxic, monocrotalinetreated, and fawn-hooded hypertensive rat lungs (n 5 4–6/group).
Samples were collected after 65 min of normoxic ventilation and
perfusion. * P , 0.05 vs. control.
ulation in the hypoxic but hypoperfused and hypotensive left lung. This suggests that nonhemodynamic
effects of the hypoxic exposure play a significant role in
increasing eNOS gene expression.
In contrast to the observations of Xue et al. (38) and
Le Cras et al. (18) in chronically hypoxic hypertensive
rat lungs, we detected no lung tissue expression of
iNOS in either chronically hypoxic, monocrotalinetreated, or fawn-hooded hypertensive rat lungs. In
addition, the lack of effect of the iNOS inhibitor aminoguanidine on resting vascular tone of the perfused
lungs indicated that even if iNOS was being expressed
at some low level that was not detected by Northern
blot analysis, it was not producing enough NO to affect
pulmonary vascular resistance.
Although eNOS mRNA levels in the monocrotalinetreated hypertensive lungs were increased similarly to
those in the chronically hypoxic lungs, there was a
marked decrease in levels of eNOS protein as measured
by Western blotting. This disparity raises the possibility that even though there was stimulation of eNOS
transcription in this inflammatory model of pulmonary
hypertension, there were also factors that interfered
with translation of the eNOS message and/or augmented degradation of the enzyme. However, our immunostaining results agreed with those of Resta et al. (29),
which showed increased eNOS levels in the hypertensive pulmonary arteries of monocrotaline-treated rats.
Thus the decreased eNOS protein in monocrotalinetreated lung homogenates might be related to a localized upregulation of eNOS in the hypertensive arteries
combined with decreased expression in other cells, e.g.,
in airway epithelial cells (37). Although this possibility
is supported by prominent eNOS immunostaining in
small arterioles and the increased NO-mediated suppression of resting vascular tone that was not accompanied by increased perfusate accumulation of NOx, there
was no obvious difference in the eNOS immunostaining
of airway epithelium between the monocrotalinetreated and hypoxic hypertensive lungs. An alternative
explanation of decreased eNOS protein in Western
blots of monocrotaline-treated lungs is that a marked
increase in other lung proteins (15) diluted the eNOS
signal.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
resistance vessels. Resta et al. (29) reported that eNOS
immunostaining is increased in the endothelium of
hypertensive medium-sized pulmonary arteries but not
in veins of chronically hypoxic rats. These increases in
hypertensive pulmonary arterial eNOS levels coincide
with pharmacological evidence of increased responsiveness to endothelium-dependent vasodilators (5, 10, 26,
30), increased NO-mediated suppression of resting
vascular tone (5, 10, 26), and increased capacity for
normoxic NO production as measured by an accumulation of NOx in the lung perfusate (10, 25).
Although hypoxic pulmonary hypertension in rats is
clearly associated with upregulation of lung and pulmonary arterial eNOS, it is unclear whether the upregulation is caused by the hypertension or some other,
nonhemodynamic effect of the hypoxic exposure. Because eNOS upregulation is limited to the hypertensive
arteries, Resta et al. (29) suggested that hemodynamic
factors rather than hypoxia are responsible, and studies (28, 35) of cultured endothelial cells showed that
eNOS gene expression is increased by shear stress. The
direct effect of hypoxia on eNOS mRNA levels in
cultured endothelial cells is variable, with several
reports (16, 20, 22, 27) showing a decrease and one
showing an increase (3). However, Le Cras et al. (17)
recently found that left pulmonary arterial stenosis in
chronically hypoxic rats does not prevent eNOS upreg-
L302
ENOS
GENE EXPRESSION IN PULMONARY HYPERTENSION
This study was supported by National Heart, Lung, and Blood
Institute (NHLBI) Program Project Grant HL-14985.
R. C. Tyler was supported by NHLBI National Research Service
Award HL-07670. M. Muramatsu was supported partly by Juntendo
University School of Medicine (Tokyo, Japan), and D. M. Rodman was
supported by a Clinical Scientist Award from the American Heart
Association.
Address for reprint requests: R. C. Tyler, CVP Research Laboratory, B-133, Univ. of Colorado Health Sciences Center, 4200 East
Ninth Ave., Denver, CO 80262.
Received 24 June 1997; accepted in final form 3 November 1998.
REFERENCES
1. Adnot, S., B. Raffestin, and S. Eddahibi. NO in the lung.
Respir. Physiol. 101: 109–120, 1995.
2. Adnot, S., B. Raffestin, S. Eddahibi, P. Braquet, and P.-E.
Chabrier. Loss of endothelium-dependent relaxant activity in
the pulmonary circulation of rats exposed to chronic hypoxia. J.
Clin. Invest. 87: 155–162, 1991.
3. Arnet, U. A., A. McMillan, J. L. Dinerman, B. Ballermann,
and C. J. Lowenstein. Regulation of endothelial nitric oxide
synthase during hypoxia. J. Biol. Chem. 271: 15069–15073,
1996.
4. Ashmore, R. C., D. M. Rodman, K. Sato, S. A. Webb, R. F.
O’Brien, I. F. McMurtry, and T. J. Stelzner. Paradoxical
constriction to platelets by arteries from rats with pulmonary
hypertension. Am. J. Physiol. 260 (Heart Circ. Physiol. 29):
H1929–H1934, 1991.
5. Barer, G., C. Emery, A. Stewart, D. Bee, and P. Howard.
Endothelial control of the pulmonary circulation in normal and
chronically hypoxic rats. J. Physiol. (Lond.) 463: 1–16, 1993.
6. Cremona, G., A. M. Wood, L. W. Hall, E. A. Bower, and T.
Higenbottam. Effect of inhibitors of nitric oxide release and
action on vascular tone in isolated lungs of pig, sheep, dog and
man. J. Physiol. (Lond.) 481: 185–195, 1994.
7. Eichinger, M. R., and B. R. Walker. Enhanced pulmonary
arterial dilation to arginine vasopressin in chronically hypoxic
rats. Am. J. Physiol. 267 (Heart Circ. Physiol. 36): H2413–
H2419, 1994.
8. Hasunuma, K., T. Yamaguchi, D. M. Rodman, R. F. O’Brien,
and I. F. McMurtry. Effects of inhibitors of EDRF and EDHF on
vasoreactivity of perfused rat lungs. Am. J. Physiol. 260 (Lung
Cell. Mol. Physiol. 4): L97–L104, 1991.
9. Hilliker, K. S., and R. A. Roth. Increased vascular responsiveness in lungs of rats with pulmonary hypertension induced by
monocrotaline pyrrole. Am. Rev. Respir. Dis. 131: 46–50, 1985.
10. Isaacson, T. C., V. Hampl, E. K. Weir, D. P. Nelson, and S. L.
Archer. Increased endothelium-derived NO in hypertensive
pulmonary circulation of chronically hypoxic rats. J. Appl. Physiol.
76: 933–940, 1994.
11. Joshi, P. C., J. B. Grogan, and K. R. Thomae. Effect of
aminoguanidine on in vivo expression of cytokines and inducible
nitric oxide synthase in the lungs of endotoxemic rats. Res.
Commun. Mol. Pathol. Pharmacol. 91: 339–346, 1996.
12. Kawai, N., D. B. Bloch, G. Filippov, D. Rabkina, H. C. Suen,
P. D. Losty, S. P. Janssens, W. M. Zapol, S. De La Monte, and
K. D. Bloch. Constitutive endothelial nitric oxide synthase gene
expression is regulated during lung development. Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12): L589–L595, 1995.
13. Kay, J. M., K. L. Suyama, and P. M. Keane. Failure to show
decrease in small pulmonary blood vessels in rats with experimental pulmonary hypertension. Thorax 37: 927–930, 1982.
14. Kentera, D., D. Susic, V. Veljkovic, G. Tucakovic, and V.
Koko. Pulmonary artery pressure in rats with hereditary platelet function defect. Respiration 54: 110–114, 1988.
15. Lafranconi, W. M., and R. J. Huxtable. Changes in angiotensin-converting enzyme activity in lungs damaged by the pyrrolizidine alkaloid monocrotaline. Thorax 38: 307–309, 1983.
16. Laufs, U., V. L. Fata, and J. K. Liao. Inhibition of 3-hydroxy-3methylglutaryl (HMG)-CoA reductase blocks hypoxia-mediated
down-regulation of endothelial nitric oxide synthase. J. Biol.
Chem. 272: 31725–31729, 1997.
17. Le Cras, T. D., R. C. Tyler, M. P. Horan, K. G. Morris, R. M.
Tuder, I. F. McMurtry, R. A. Johns, and S. H. Abman. Effects
of chronic hypoxia and altered hemodynamics on endothelial
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
Hypertensive fawn-hooded rat lungs show NOmediated suppression of resting vascular tone and
increased responsiveness to endothelium-dependent
vasodilators (36, 40), and we observed prominent immunostaining of eNOS in the hypertensive pulmonary
resistance arteries. However, similar to the situation in
the monocrotaline-treated rat lungs, there was a decrease in lung tissue expression of eNOS and low levels
of NOx in the lung perfusate. In contrast to the chronically hypoxic and monocrotaline-treated hypertensive
lungs, which appear to have a normal number of blood
vessels (13), the von Willebrand immunostaining and
emphysematous appearance of the fawn-hooded lungs
suggest that there may be a decrease in vessel density
in this model. Whether this or some other factor
accounts for the decreased levels in lung tissue eNOS
protein is unclear.
One feature common to all three forms of rat pulmonary hypertension is neomuscularization of the peripheral pulmonary arterioles (23, 24, 31). Because these
muscularized arterioles are likely the primary site of
increased vascular resistance in hypertensive lungs (5,
23) and because there appears to be increased expression of eNOS in these vessels in chronically hypoxic
(18), monocrotaline-treated (29), and fawn-hooded lungs,
it is possible that a localized increase in NO production
in this vascular segment accounts for the NO-mediated
suppression of resting vascular tone in all three forms
of pulmonary hypertension. Alternatively, there may
not be an increase in NO production in the muscularized arterioles of the monocrotaline-treated and fawnhooded lungs but, instead, an increased sensitivity of
the vascular smooth muscle to NO vasodilation. We
have recently found that the high normoxic NOx production in hypoxia-induced hypertensive lungs is due to
inherent ETB-receptor activation; i.e., the high NOx
production is prevented by the ETB-receptor antagonist
BQ-788 (McMurtry, unpublished data), and it may be
that ETB receptors are not upregulated in monocrotaline-treated and fawn-hooded hypertensive lungs as
they are in chronically hypoxic hypertensive lungs (19,
33). In fact, one report (39) suggested that ETB receptors may be downregulated in monocrotaline-treated
rat lungs.
In summary, this study indicates that although there
is increased eNOS in the neomuscularized resistance
arterioles and basal NO activity attenuates resting
pulmonary vascular tone in each of three different
forms of rat pulmonary hypertension, there are marked
differences in total lung tissue expression of eNOS
mRNA and protein and in release of NOx into the lung
perfusate. The factors accounting for these differences
among chronically hypoxic, monocrotaline-treated, and
fawn-hooded hypertensive rat lungs are unknown. A
better understanding of the factors regulating eNOS
gene expression and NO production in these animal
models may provide insights into the regulation of this
vasodilator system in various forms of human pulmonary hypertension.
ENOS
18.
19.
20.
21.
22.
24.
25.
26.
27.
28.
29.
nitric oxide synthse expression in the adult rat lung. J. Clin.
Invest. 101: 795–801, 1998.
Le Cras, T. D., C. Xue, A. Rengasamy, and R. A. Johns.
Chronic hypoxia upregulates endothelial and inducible NO synthase gene and protein expression in rat lung. Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14): L164–L170, 1996.
Li, H., S.-J. Chen, Y.-F. Chen, Q. C. Meng, J. Durand, S.
Oparil, and T. S. Elton. Enhanced endothelin-1 and endothelin
receptor gene expression in chronic hypoxia. J. Appl. Physiol. 77:
1451–1459, 1994.
Liao, J. K., J. J. Zulueta, F., S. Yu, H. B. Peng, C. G. Cote,
and P. M. Hassoun. Regulation of bovine endothelial constitutive nitric oxide synthase by oxygen. J. Clin. Invest. 96: 2661–
2666, 1995.
Madden, J. A., P. A. Keller, J. S. Choy, T. A. Alvarez, and
A. D. Hacker. L-Arginine-related responses to pressure and
vasoactive agents in monocrotaline-treated rat pulmonary arteries. J. Appl. Physiol. 79: 589–593, 1995.
McQuillan, L. P., G. K. Leung, P. A. Marsden, S. K. Kostyk,
and S. Kourembanas. Hypoxia inhibits expression of eNOS via
transcriptional and posttranscriptional mechanisms. Am. J.
Physiol. 267 (Heart Circ. Physiol. 36): H1921–H1927, 1994.
Meyrick, B., W. Gamble, and L. Reid. Development of Crotalaria pulmonary hypertension: hemodynamic and structural
study. Am. J. Physiol. 239 (Heart Circ. Physiol. 8): H692–H702,
1980.
Meyrick, B., and L. Reid. Hypoxia-induced structural changes
in the media and adventitia of rat hilar pulmonary artery and
their regression. Am. J. Pathol. 100: 151–169, 1980.
Muramatsu, M., R. C. Tyler, D. M. Rodman, and I. F.
McMurtry. Thapsigargin stimulates increased NO activity in
hypoxic hypertensive rat lungs and pulmonary arteries. J. Appl.
Physiol. 80: 1336–1344, 1996.
Oka, M., K. Hasunuma, S. A. Webb, T. J. Stelzner, D. M.
Rodman, and I. F. McMurtry. EDRF suppresses an unidentified vasoconstrictor mechanism in hypertensive rat lungs. Am. J.
Physiol. 264 (Lung Cell. Mol. Physiol. 8): L587–L597, 1993.
Phelan, M. W., and D. V. Faller. Hypoxia decreases constitutive
nitric oxide synthase transcript and protein in cultured endothelial cells. J. Cell. Physiol. 167: 469–476, 1996.
Ranjan, V., Z. Xiao, and S. L. Diamond. Constitutive NOS
expression in cultured endothelial cells is elevated by fluid shear
stress. Am. J. Physiol. 269 (Heart Circ. Physiol. 38): H550–H555,
1995.
Resta, T. C., R. J. Gonzales, W. G. Dail, T. C. Sanders, and
B. R. Walker. Selective upregulation of arterial endothelial
nitric oxide synthase in pulmonary hypertension. Am. J. Physiol.
272 (Heart Circ. Physiol. 41): H806–H813, 1997.
L303
30. Resta, T. C., and B. R. Walker. Chronic hypoxia selectively
augments endothelium-dependent pulmonary arterial vasodilation. Am. J. Physiol. 270 (Heart Circ. Physiol. 39): H888–H896,
1996.
31. Sato, K., S. Webb, A. Tucker, M. Rabinovitch, R. F. O’Brien,
I. F. McMurtry, and T. J. Stelzner. Factors influencing the
idiopathic development of pulmonary hypertension in the fawnhooded rat. Am. Rev. Respir. Dis. 145: 793–797, 1992.
32. Shaul, P. W., A. J. North, T. S. Brannon, K. Ujiie, L. B. Wells,
P. A. Nisen, C. J. Lowenstein, S. H. Snyder, and R. A. Star.
Prolonged in vivo hypoxia enhances nitric oxide synthase type I
and type III gene expression in adult rat lung. Am. J. Respir. Cell
Mol. Biol. 13: 167–174, 1995.
33. Soma, S., H. Takahashi, M. Muramatsu, M. Oka, and Y.
Fukuchi. Localization and distribution of ETA and ETB receptors in rat pulmonary vasculature, and change of their expression after exposure to hypobaric hypoxia (Abstract). Am. J.
Respir. Crit. Care Med. 157: A725, 1998.
34. Stelzner, T. J., R. F. O’Brien, M. Yanagisawa, T. Sakurai, K.
Sato, S. Webb, M. Zamora, I. F. McMurtry, and J. H. Fisher.
Increased lung endothelin-1 production in rats with idiopathic
pulmonary hypertension. Am. J. Physiol. 262 (Lung Cell. Mol.
Physiol. 6): L614–L620, 1992.
35. Uematsu, M., Y. Ohara, J. P. Navas, K. Nishida, T. J.
Murphy, R. W. Alexander, R. M. Nerem, and D. G. Harrison.
Regulation of endothelial cell nitric oxide synthase mRNA expression by shear stress. Am. J. Physiol. 269 (Cell Physiol. 38):
C1371–C1378, 1995.
36. Webb, S., R. Ashmore, I. F. McMurtry, and T. J. Stelzner.
Perfused lung responses to platelets, ADP and serotonin (5-HT) in
pulmonary hypertensive rats (Abstract). FASEB J. 5: A1429, 1991.
37. Xue, C., S. J. Botkin, and J. A. Johns. Localization of
endothelial NOS at the basal microtubule membrane in ciliated
epithelium of rat lung. J. Histochem. Cytochem. 44: 463–471,
1996.
38. Xue, C., A. Rengasamy, T. D. Le Cras, P. A. Koberna, G. C.
Dailey, and R. A. Johns. Distribution of NOS in normoxic vs.
hypoxic rat lung: upregulation of NOS by chronic hypoxia. Am. J.
Physiol. 267 (Lung Cell. Mol. Physiol. 11): L667–L678, 1994.
39. Yorikane, R., T. Miyauchi, S. Sakai, T. Sakurai, I. Yamaguchi, Y. Sugishita, and K. Goto. Altered expression of ETBreceptor mRNA in the lung of rats with pulmonary hypertension.
J. Cardiovasc. Pharmacol. 22, Suppl. 8: S336–S338, 1993.
40. Zamora, M. R., M. Oka, R. C. Tyler, K. G. Morris, I. F.
McMurtry, and T. J. Stelzner. Inhibition of endotheliumderived relaxing factor exacerbates pulmonary hypertension in
fawn-hooded rats (Abstract). Am. J. Crit. Care Med. 149: A22,
1994.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.5 on June 16, 2017
23.
GENE EXPRESSION IN PULMONARY HYPERTENSION