Regular Paper
Cryptogein-Induced Cell Cycle Arrest at G2 Phase is
Associated with Inhibition of Cyclin-Dependent Kinases,
Suppression of Expression of Cell Cycle-Related Genes and
Protein Degradation in Synchronized Tobacco BY-2 Cells
Ryoko Ohno1,4, Yasuhiro Kadota1,5, Shinsuke Fujii1, Masami Sekine2, Masaaki Umeda3 and
Kazuyuki Kuchitsu1,*
1
Department of Applied Biological Science, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba, 278-8510 Japan
Department of Bioproduction Science, Ishikawa Prefectural University, Suematsu, Nonoichi, Ishikawa, 921-8836 Japan
3
Graduate School of Biological Sciences, Nara Institute of Science and Technology, Takayama, Ikoma, Nara, 630-0101 Japan
4
Present address: Okayama Prefectural Technology Center for Agriculture, Forestry, and Fisheries, Research Institute for Biological
Sciences, Yoshikawa, Kibichuo-cho, Okayama, 716-1241 Japan
5
Present address: RIKEN Plant Science Center, Tsurumi-ku, Yokohama, 230-0045 Japan; The Sainsbury Laboratory, Norwich NR4 7UH, UK
*Corresponding author: E-mail, [email protected]; Fax: +81-4-7123-9767
(Received May 21, 2010; Accepted March 29, 2011)
2
Induction of defense responses by pathogens or elicitors is
often accompanied by growth inhibition in planta, but its
molecular mechanisms are poorly understood. In this report,
we characterized the molecular events that occur during
cryptogein-induced cell cycle arrest at G2 phase in synchronously cultured tobacco Bright Yellow-2 (BY-2) cells.
Concomitant with the proteinaceous elicitor-induced G2
arrest, we observed inhibition of the histone H1 kinase activity of cyclin-dependent kinases (CDKs), which correlated
with a decrease in mRNA and protein levels of CDKB1. In
contrast, the amount of CDKA was almost unaffected by
cryptogein even at M phase. Cryptogein rapidly inhibited
the expression not only of positive, e.g. A- and B-type cyclins
and NtCAK, but also of negative cell cycle regulators such as
WEE1, suggesting that cryptogein affects multiple targets to
inactivate CDKA to induce G2 arrest by mechanisms distinct
from known checkpoint regulation. Moreover, we show that
CDKB1 and cyclin proteins are also rapidly degraded by
cryptogein and that the proteasome-dependent protein
degradation has a crucial role in the control of cryptogeininduced hypersensitive cell death.
Keywords: Cell cycle arrest Cyclin-dependent kinase Elicitor Proteasome Synchronous culture.
Abbreviations: BSA, bovine serum albumin; BY-2, Bright
Yellow-2; CAK, CDK-activating kinase; CDK, cyclin-dependent
kinase; GFP, green fluorescent protein; MSA, M-specific activator; PCD, programmed cell death; RACE, rapid amplification of cDNA ends; TBS, Tris-buffered saline
The nucleotide sequence reported in this paper has been submitted to DDBJ under accession number: NtCAK (AB293452).
Introduction
One important feature distinguishing plants from other multicellular organisms is that plants are sessile and thus have to
endure environmental challenges. One of the adaptive responses is the reduction of growth by repression of cell division
(May et al. 1998) to preserve the limited energy of the mother
cell and to avoid heritable damage. Such growth inhibition is
also seen during defense responses against pathogens.
Treatment with pathogen-derived elicitors or pathogen/
microbe-associated molecular patterns (PAMP/MAMPs) in
plants induces both defense responses and growth inhibition
(Gómez-Gómez et al. 1999). Elicitor treatment induces
down-regulation of some cell cycle-related genes along with
the induction of defense-related genes (Longmann et al. 1995,
Suzuki et al. 2006), suggesting that the down-regulation of cell
cycle-related genes may be involved in the growth inhibition.
However, the molecular mechanisms for elicitor-induced
growth inhibition are largely unknown.
A 10 kDa proteinaceous elicitor, cryptogein, from a pathogenic oomycete, Phytophthora cryptogea, induces hypersensitive cell death in tobacco in planta (Ricci et al. 1989) as well as
in cultured cells (Binet et al. 2001) including Bright Yellow-2
(BY-2) cells (Kadota et al. 2004a, Higaki et al. 2007). To analyze
the interrelationship between elicitor-induced defense responses including programmed cell death (PCD) and the cell
cycle, we developed a model system using synchronous culture
of BY-2 cells (Kadota and Kuchitsu 2006). Cryptogein induces
not only expression of defense-related genes and the PCD but
also growth inhibition and cell cycle arrest in the G1 or G2
phases (Kadota et al. 2004b). Cryptogein-induced defense signaling pathways depend on the cell cycle phases, indicating a
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042, available online at www.pcp.oxfordjournals.org
! The Author 2011. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
All rights reserved. For permissions, please email: [email protected]
922
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
Mechanism for cryptogein-induced cell cycle arrest
close relationship between the induction of defense responses
and the cell cycle (Kadota et al. 2005). The cell cycle arrest is
induced prior to the expression of defense-related genes and
the PCD, suggesting that the cell cycle arrest is a prerequisite for
the induction of the PCD and defense responses (Kadota et al.
2004b).
Progression and arrest of the eukaryotic cell cycle are orchestrated by cyclin-dependent Ser/Thr protein kinases (CDKs).
Their activity depends not only on the availability and binding
of cyclin partners such as CDK inhibitors and/or other regulatory factors but also importantly on the phosphorylation/
dephosphorylation status of the kinases themselves (Morgan,
1997). Phosphorylation of conserved residues (Thr161 or
equivalent) within the T-loops is necessary to activate CDKs
via a conformational change allowing the proper recognition of
the substrates for the kinase reaction. This activating phosphorylation of CDKs is catalyzed by CDK-activating kinases (CAKs;
Kaldis, 1999). Following the CAK-mediated activation, the CDK
activity is further regulated by the inhibitory phosphorylation of
Tyr15 and Thr14 of the catalytic subunit of CDKs by WEE1
family kinases (Berry and Gould, 1996). At the G2–M boundary,
CDK1 must be dephosphorylated on the Tyr15 residue within
the CDK–cyclin complex in order to drive the cell through
mitosis. This activating dephosphorylation is mediated by a
CDC25 phosphatase (Nurse 1990, Featherstone and Russell
1991, Kumagai and Dunphy 1991).
In animal and yeast cells, stress-induced cell cycle arrest is
controlled by specific genes, and mutations in these genes often
result in increased sensitivity to damaging reagents, i.e. oxygen
radicals. Moreover, these genes are commonly mutated in various kinds of cancers, highlighting their importance in the maintenance of the cell cycle (for a review, see van Vugt et al. 2005).
One of these genes, encoding p53 protein, harbors mutations in
more than half of human cancers (Vousden and Lu 2002). p53
takes part in the G1 arrest in response to DNA damage. The
DNA damage-induced cell cycle arrest in the G1 and S phases
may partly involve inhibition of the activity of G1 CDKs by the
specific CDK inhibitor, p21 (Xiong et al. 1993). Furthermore,
the mechanism underlying the DNA damage-induced G2
arrest was shown to involve a specific inhibitory phosphorylation of the mitotic kinase, CDK1, in human cells (O’Connor
et al. 1993, Jin et al. 1996).
In plant cells, in addition to the elicitor, cryptogein, cell cycle
arrest is induced by various kinds of stress such as oxidative
stress mediated by menadion (Reichheld et al. 1999) or KMnO4,
hypo-osmotic stress (Sano et al. 2006) and DNA damage (De
Schutter et al. 2007). However, no homologs of p53 have been
found in plants (Arabidopsis Genome Initiative 2000,
Yoshiyama et al. 2009), and the molecular mechanisms of
stress-induced cell cycle arrest are mostly unknown.
In the present study, to analyze the molecular mechanisms
for the elicitor-induced cell cycle arrest, we have characterized
mRNA and protein levels as well as activities of various cell cycle
regulators including cyclins and CDKs during cryptogeininduced cell cycle arrest at G2 phase in synchronously cultured
tobacco BY-2 cells. The cell cycle arrest is shown to be associated with inactivation of CDKA and CDKB1. In addition to the
suppressed expression of various cell cycle-related genes,
proteasome-dependent protein degradation of cell cycle regulators is induced by the elicitor. Possible molecular events
during the elicitor-induced cell cycle arrest are discussed.
Results
Cryptogein negatively regulates the activity of
CDKs
The cell cycle was synchronized at S phase with aphidicolin, and
cryptogein was added at 0.5 h after aphidicolin release
(S phase). The cell cycle progression was monitored by both
the mitotic index and flow cytometry (Fig. 1A, B). Cryptogein
treatment during S phase induced cell cycle arrest at G2 phase
prior to the hypersensitive cell death (Fig. 1A).
We affinity purified the CDK complexes with p13suc1 beads
and assayed CDK activity using histone H1 as a substrate in the
control and cryptogein-treated cells (Fig. 1C, left panel). In the
control cells, the level of phosphorylated histone H1 peaked at
the G2–M transition boundary (6.5–8.5 h, control) and declined
to the basal level in G1 phase (12.5–14.5 h, control). In contrast,
cryptogein inhibited the activation of the p13suc1-associated
kinase activity during the G2–M transition boundary
(6.5–10.5 h, cryptogein).
p13suc1 beads can bind to both CDKA and CDKB protein,
although CDKA had a higher affinity for p13suc1 beads than did
CDKB (Harashima et al. 2007). We also monitored CDKB1
activity by immunoprecipitation with anti-CDKB1-specific antibody (Fig. 1C, right panel). In the control cells, the CDKB1
kinase activity increased at the G2–M transition (6.5–8.5 h, control), while this activation was abolished by cryptogein treatment. These results suggest that cryptogein inhibits the activity
of both CDKA and CDKB1 during G2 to M phase.
Cryptogein inhibits the accumulation of CDKB1;1
but not CDKA;3
To reveal the mechanisms for down-regulation of activities of
CDKs, the effects of cryptogein on the mRNA and protein levels
of A- and B-type CDKs were investigated under the same conditions as in Fig. 1C. The mRNA and protein levels of CDKA
remained almost constant throughout the cell cycle, and were
unaffected even at 8 h (M phase) after cryptogein application
(Fig. 1D).
CDKB1;1 mRNA levels started to increase at the S phase and
reached a maximum at the G2 to early M phase in the control
cells (Fig. 1D, left panel). Cryptogein treatment suppressed the
CDKB1;1 mRNA levels from 4.5 h after aphidicolin release,
which corresponds to the start of the G2 phase. The specific
antibody against CDKB1 detected two bands in the control cells
(Fig. 1D, right panel). Cryptogein treatment reduced the level
of the major (lower) band and suppressed the increase in the
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
923
R. Ohno et al.
A
B
Time after aphidicolin release (h)
30
1.5
3.5
8.5
13.5
15.5
Control
Cryptogein
20
Control
Counts
Mitotic index (%)
25
300
300
300
300
300
200
200
200
200
200
100
100
100
100
100
15
0
0
Cryptogein
5
0
10
15
Time after aphidicolin release (h)
Counts
5
0.5
G1 G2
G1 G2
300
300
300
300
200
200
200
200
200
100
100
100
100
100
0
0
0
0
G1 G2
G1 G2
0
G1 G2
G1 G2
CDKB1-associated kinase
G2
S
G1 G2
300
G1 G2
C p13suc1-associated kinase
G1 G2
0
0
0
0
G1 G2
10
M
S
0.5
2.5 4.5 6.5 8.5 10.5 12.5 14.5 (h)
Histone H1
Histone H1
G1
G2
G1
M
2.5 4.5 6.5 8.5 10.5 12.5 14.5 (h)
Control
Histone H1
Cryptogein
Histone H1
Control
CBB
CBB
Cryptogein
D
G2
S
G2
G1
S
M
G1
M
0.5 2.5 4.5 6.5 8.5 10.5 12.5 14.5 (h)
0.5 2.5 4.5 6.5 8.5 10.5 12.5 14.5 (h)
Control
CDKA;3
CDKA
Cryptogein
Control
CDKB1;1
CDKB1
Cryptogein
Loading
control
Control
CBB
Cryptogein
Fig. 1 Application of cryptogein in the S phase induces cell cycle arrest at the G2 phase and down-regulates CDK activity. (A) The change in the
mitotic index of non-treated cells (filled squares) and cells treated with cryptogein at 0.5 h after aphidicolin release (S phase; filled circles) after
release from aphidicolin treatment. Arrows indicate the time when the cryptogein was added. (B) Flow cytometric analysis was performed on
8,200 nuclei of non-treated cells (control) and cells treated with cryptogein in S phase. (C) Histone H1 kinase activity in non-treated cells
(control) and cells treated with cryptogein in S phase (cryptogein). Histone H1 loading was controlled by Coomassie Brilliant Blue (CBB) staining.
(D) Northern blot (left panel) and Western blot (right panel) analysis of CDKA and CDKB1 in non-treated cells (control) and cells treated with
cryptogein in S phase (cryptogein). rRNA (loading control) visualized with ethidium bromide is shown as a control of the Northern blot. Crude
extracts stained with CBB are shown in the lower panels for loading comparison.
upper band at G2 phase (Fig. 1A, 4.5 h). Treatment of the cell
extract with calf intestine alkaline phosphatase prior to SDS–
PAGE did not affect the levels of the two bands (data not
shown), suggesting that the two bands do not represent the
different phosphorylation status of CDKB1, but represent two
different isoforms or other types of modification of CDKB1.
924
These results suggest that CDKB1 is down-regulated at a
transcriptional level in response to cryptogein. In contrast,
the cryptogein-induced inhibition of CDKA activity seems
not to be attributed to transcriptional or translational regulation but to post-translational modification of the CDKA protein. To address this possibility, we next examined the effect of
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
Mechanism for cryptogein-induced cell cycle arrest
G2
cryptogein on the accumulation of various transcripts of cyclins
and other cell cycle-related factors.
S
G1
M
0.5 2.5 4.5 6.5 8.5 10.5 12.5 14.5 (h)
Control
Cryptogein down-regulates gene expression of
A- and B-type cyclins and G2/M phase-specific
transcription factors
CYCA;1
Cryptogein
Control
Cyclins are crucial components of the cell cycle machinery as
they bind to and activate CDKs in eukaryotes including plants.
The effects of cryptogein on the accumulation of transcripts of
cyclin genes (A-type; CYCA1;1; and B-type; CYCB1;1, CYCB1;2,
and CYCB1;3) were investigated under the same conditions as
in Fig. 1C. CYCA1;1 mRNA gradually accumulated throughout
G2/M and deceased at G1 phase (Fig. 2). Cryptogein treatment
at S phase suppressed induction of CYCA1;1 mRNA prior to the
cell cycle arrest at G2 phase. Accumulation of all B-type cyclin
genes, CYCB1;1, CYCB1;2 and CYCB1;3, peaked during late G2/M,
followed by a decrease during G1 phase (12.5 h). Cryptogein
completely inhibited induction of these B-type cyclin genes
(Fig. 2), while it induced defense-related genes, such as
Hsr203J, Hin1 and ACHN, as shown previously (Kadota et al.
2004b), and did not affect the expression of EF1- (Fig. 2).
Since cryptogein treatment abolished the induction of
B-type cyclin genes during G2/M phase, we next investigated
the effect of cryptogein on the expression level of G2/M
phase-specific transcription factors regulating the expression
of B-type cyclins. A cis-acting element, MSA (M-specific activator), is essential for G2/M phase-specific transcription in tobacco cells (Ito et al. 1998). Three Myb-family transcription
factors (two activators, NtmybA1 and NtmybA2, and a repressor, NtmybB) are involved in the MSA-mediated transcription.
Among them, NtmybA2 has been shown to play a predominant
role in G2/M-specific transcriptional regulation (Ito et al. 2001).
The effects of cryptogein on the expression patterns of both
types of Ntmyb genes, NtmybA1and NtmybA2, were investigated. Expression of NtmybA2 mRNA increased from S phase
and reached a maximum at late G2 phase in the control.
Cryptogein treatment strongly reduced the NtmybA2 mRNA
levels especially at late G2/M phases (6.5–8.5 h, cryptogein).
NtmybB mRNA levels remained constant throughout the cell
cycle, which was also suppressed by cryptogein (Fig. 2). These
results suggest that cryptogein-induced transcriptional
down-regulation of the B-type cyclin genes is not due to
up-regulation of a negative regulator but may predominantly
be due to down-regulation of transcript levels of a positive
regulator.
Effects of cryptogein on the expression of
CAK and WEE1
Plant CDK–cyclin complexes are regulated by phosphorylation/
dephosphorylation and the interaction with regulatory proteins
as in yeasts and animals (Dewitte and Murray 2003). A CAK
homolog, NtCAK (accession No. AB293452), has been identified,
which was similar to those in rice (Hata 1991) and Arabidopsis
CYCB1;1
Cryptogein
Control
CYCB1;2
Cryptogein
Control
CYCB1;3
Cryptogein
Control
NtmybA2
Cryptogein
Control
NtmybB
Cryptogein
Control
Cryptogein
NtCAK
Control
Wee1
Cryptogein
Control
EF1-a
Cryptogein
Control
Cryptogein
Loading
control
Fig. 2 Effects of treatment with cryptogein on the amount of mRNA
in synchronized BY-2 cells. RNA gel blot analysis of cell cycle-related
gene expression (Nicta; CYCA1;1, Nicta; CYCB1;1, Nicta; CYCB1;2, Nicta;
CYCB1;3, NtmybA2, NtmybB, NtCAK, NtWEE1 and EF1-) in
non-treated cells (control) and cells treated with cryptogein in S
phase (cryptogein). rRNA (loading control) is the same as Fig. 1D.
(Umeda et al. 1998, Shimotohno et al. 2003, Umeda et al.
2005). In order to reveal whether the cryptogein-induced
down-regulation of activity of CDKs is attributed to the transcriptional regulation of the CDK regulators CAK and WEE1
kinase, we examined the effect of cryptogein on the transcript
levels of NtCAK and NtWEE1 (accession No. AJ715532; Gonzalez
et al. 2004) using a full-length NtCAK fragment and a 329 bp
cDNA probe for NtWEE1. In the control cells, the levels of
NtCAK and NtWEE1 transcripts were shown to fluctuate differently during the cell cycle (Fig. 2). The level of NtCAK mRNA
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
925
R. Ohno et al.
A
100
0
Time (h) 0.5 4.5 8.5 12.5 16.5
Cryptogein induced proteasome-dependent
degradation of CYCB2;2–GFP in the nucleus
We attempted to test whether ectopic overexpression of cyclin
B2 could overcome cryptogein-induced G2 arrest. We synchronized the BY-2 cell line expressing the rice CYCB2;2–green
fluorescent protein (GFP) fusion protein under the control of
an estrogen-regulated promoter, in which various features
including the subcellular localization of CYCB2;2–GFP during mitosis have already been well characterized (Lee et al.
2003).
As shown in Fig. 4A, the mitotic index of the CycB2;2–
GFP-expressing cells reached a maximum 7 h after the removal
of aphidicolin, and then declined as shown with the wild-type
cells. Cryptogein treatment at S phase (0.5 h after aphidicolin
release) completely abolished the cell cycle progression to mitosis similar to the wild-type cells irrespective of application of
926
4.5 8.5 12.5 16.5
DW+DMSO
B
Effects of a proteasome inhibitor on
cryptogein-induced degradation of CDKB1
and hypersensitive cell death
As described above, the level of CDKB1 protein started to decrease 4 h after cryptogein application (Fig. 1D). To determine
whether the decrease in CDKB1 protein is due to the degradation by proteasome-dependent proteolysis, we applied
100 mM MG132 (carbobenzoxyl-leucinyl-leucinyl-leucinal), a
specific inhibitor of proteasome activity (Genschick et al.
1998). Although MG132 treatment itself inhibited the accumulation of the upper band of CDKB1, MG132 clearly suppressed
the cryptogein-induced decrease of the lower band of CDKB1
(Fig. 3A), suggesting that cryptogein induces degradation of
CDKB1 by the proteasome-dependent pathway.
We further tested the effect of MG132 on cryptogeininduced hypersensitive cell death. Cryptogein-induced cell
death was greatly suppressed by pre-treatment with MG132
(Fig. 3C), suggesting that proteasome-dependent protein degradation is a prerequisite for the induction of cryptogeininduced hypersensitive cell death. Since application of MG132
at S phase (at 0.5 h after aphidicolin release) itself induced cell
cycle arrest (Fig. 3B), we could not test the effect of MG132 on
the cryptogein-induced cell cycle arrest.
200
25
Mitotic index (%)
started to increase at the S phase and reached a maximum at G2
to early M phase, while the expression of NtWEE1 peaked at the
S phase, decreased during G2 and M phase and then increased
again at the late G1 phase.
The accumulation of transcripts of NtCAK started to
decrease 4 h after cryptogein application (4.5–14.5 h, cryptogein). Since CAK is an important activator for CDK, cryptogein-induced inhibition of CAK expression may be involved
in the inactivation of CDK to induce the G2 arrest.
Cryptogein treatment also induced reduction in transcripts of
NtWEE1 along with those of NtMybB, suggesting that cryptogein also inhibited the expression of not only positive regulators
but also negative regulators of cell cycle progression.
MG132
4.5 8.512.5 16.5
4.5 8.5 12.5 16.5
Cryptogein
Cryptogein
+MG132
DW+DMSO
MG132
Cryptogein
Cryptogein+MG132
20
15
10
5
0
0
5
*
10
15
*
*
*
*
Time after aphidicolin release (h)
C
DW+DMSO
MG132
Cryptogein
Cryptogein
+MG132
0
20
40
60
80
100
120
Abs 595/g
Fig. 3 Cryptogein-induced CDKB1 degradation and cell death were
suppressed by an inhibitor of proteasome activity. (A) Effect of treatment with MG132 on the stability of CDKB1 protein. Western blots
were performed with the antibody against CDKB1. We repeated these
experiments three times and representative data are shown.
(B) Percentage of mitotic cells in distilled water (DW)-, dimethylsulfoxide (DMSO)-, MG132- and cryptogein-treated BY-2 cell cultures. As
a control for DW, DMSO was used. Arrow indicate the time (0.5 h after
aphidicolin release) when the DW, DMSO, 100 mM MG132 and 1 mM
cryptogein were added. Samples were taken at several time points
after aphidicolin release for Western blot analysis of A. The asterisks
indicate the time chosen to assay. (C) The cell death induced by
application of cryptogein at the S phase was suppressed by MG132
treatment. Cell death was analyzed 30 h after aphidicolin release. The
data represent the average of three independent experiments. Error
bars indicate the SEM (n = 3).
b-estradiol, indicating that overexpression of CYCB2;2–GFP did
not affect the cryptogein-induced cell cycle arrest. Expression of
OsCYCB2;2 alone did not override the cryptogein-induced cell
cycle block in G2 phase.
We also monitored the fluorescence of CYCB2;2–GFP expressed in the cells. Without cryptogein treatment, CYCB2;2–
GFP was constantly expressed in the nuclei of interphase cells.
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
Mechanism for cryptogein-induced cell cycle arrest
C
Normarized fluorescence intensity
A
30
Cryptogein
b - estradiol
Mitotic index (%)
25
20
15
10
5
0
0
2
4
6
8
10
12
Time after aphidicolin release (h)
B
50
40
30
20
Control
MG132
10
Cryptogein
Cryptogein+MG132
0
3
5
Time after application of cryptogein (h)
Cryptogein
Control
BF
4
GFP
fluorescence
BF
GFP
fluorescence
Time after application of cryptogein (h)
1
2
3
4
5
Cryptogein + MG132
BF
MG132
GFP
fluorescence
BF
GFP
fluorescence
4
Fig. 4 Cryptogein induced rapid CYCB2;2 degradation by the proteasome-dependent pathway. (A) BY-2 cells were synchronized at S phase using
aphidicolin. After removal of aphidicolin, progression of the cell cycle was monitored by counting the mitotic index. Cultures of transgenic plants
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
927
R. Ohno et al.
In contrast, the CYCB2;2–GFP fluorescence rapidly vanished
within 3 h by cryptogein treatment (Fig. 4B, C, cryptogein
3–5 h). To test whether this phenomenon is due to the degradation of CYCB2;2–GFP by a specific proteolysis, we analyzed
the effect of 100 mM MG132 on the fluorescence of CYCB2;2–
GFP. MG132 counteracted the cryptogein-induced reduction of
the CYCB2;2–GFP fluorescence (Fig. 4B, lower panel and C). As
a control, the fluorescence of GFP in the GFP-expressing cells
was not affected by cryptogein treatment (data not shown).
Discussion
Cryptogein, a proteinaceous elicitor from a pathogenic oomycete, induced growth inhibition and cell cycle arrest at G1 or G2
phase before the induction of cell death in tobacco BY-2 cells
(Kadota et al. 2004b). We here characterized molecular events
during cryptogein-induced G2 arrest to determine possible effectors of the elicitor-induced cell cycle block. Cryptogein inhibited the kinase activity of both CDKA and CDKB1 from the
start of the G2 phase. The relative amount of CDKB1 mRNA and
proteins (Fig. 1D) correlated with the decrease in CDKB1 activity (Fig. 1C), suggesting that the level of CDKB1 is transcriptionally inactivated in response to cryptogein. In contrast,
mRNA and protein levels of CDKA were almost unaffected
even at 8 h (M phase) after cryptogein application, but the
activity of p13suc1-associated CDKA was inactivated at 4.5 h
(G2 phase), suggesting that CDKA activity is down-regulated
by cryptogein at a post-translational level. Their activities
depend largely on several other factors: the phosphorylation
of conserved residues, the presence or absence of inhibitor proteins from the KRP family, and the availability of their activating
cyclin partner, which have a cell cycle-dependent expression
pattern and are degraded in a strictly regulated fashion
(Mironov et al. 1999).
The cyclins A1 and B1 have been suggested to be involved in
the progression from G2 to M phase in plants (Mironov et al.
1999, John et al. 2001). Cryptogein down-regulated the expression of cyclin A and cyclin B, suggesting that the inhibition of
CDKA activity is in part attributed to the decrease in these
cyclins. It has indeed been shown that the overexpression of
positive regulators such as B-type cyclins can override various
checkpoint controls at G2 phase, including the topoisomerase II
checkpoint (Gimenez-Abian et al. 2002). However, overexpression of CYCB2;2–GFP did not override the cryptogein-induced
cell cycle block in G2 (Fig. 4A). Surprisingly, the CYCB2;2–GFP
signal disappeared 3 h after cryptogein application even during
the interphase, which was severely suppressed by a proteasome
inhibitor, MG132 (Fig. 4B, C). These results suggest that overexpression
of
CYCB2;2
could
not
override
the cryptogein-induced cell cycle arrest because cryptogein
induced proteasome-dependent degradation of CYCB2;2
during the cell cycle arrest.
A recent study indicated that MSA in the promoters of plant
B-type cyclin genes is responsible for the G2/M phase-specific
transcription in tobacco cells (Ito et al. 1998). Since the CYCB1
gene itself is a target of transcriptional activation by NtmybA2, a
positive feedback loop has been postulated, in which transcription of the cyclin B gene is activated by NtmybA2, which is, in
turn, activated by a CDK in a complex with cyclin B (Araki et al.
2004). Cryptogein negatively regulates CDK activity, leading to
the cell cycle arrest and a decrease in the activity of NtmybA2,
yet also causes the decrease in cyclin B mRNA levels. A possible
involvement of an increase in the production of a repressor
protein, NtmybB, in the down-regulation of the B-type cyclin
genes can be excluded, because the transcript level of the
NtmybB gene rapidly and markedly decreased concurrently
with the decrease in the NtCYCB1;3 and NtmybA2 mRNA
levels after the addition of the elicitor.
In multicellular eukaryotes, phosphorylation and dephosphorylation of Thr14 and Thy15 of the catalytic subunit of
CDKs regulate their activity and determine the timing of G2
and mitosis (Dunphy 1994). In fission yeast, WEE1 is involved in
the cell cycle arrest at G2 phase induced by UV-mediated DNA
damage. DNA damage induces activation of Chk1 kinase, which
phosphorylates WEE1. Activated Wee1 leads to the maintenance of phosphorylation of the Tyr15 of Cdc2 kinase and hence
the G2 delay (O’Connell et al. 1997). Arabidopsis WEE1 inactivates CDKA;1 through its phosphorylation at the conserved
Tyr15 residue (Shimotohno et al. 2006). Expression of the
Arabidopsis WEE1 gene was recently shown to be transcriptionally up-regulated by DNA damage or replication inhibitors (De
Schutter et al. 2007). In contrast, cryptogein inhibited the accumulation of transcripts of NtWEE1 (Fig. 2), suggesting that
WEE1-dependent tyrosine phosphorylation of CDKA is not directly involved in the elicitor-induced cell cycle arrest at G2
phase. Therefore, the mechanism for cryptogein-induced cell
cycle arrest is different from the DNA damage-induced
pathway.
Fig. 4 Continued
were treated (+) or not () with 1 mM b-estradiol. Additionally, cells were treated (+) or not () with 1 mM cryptogein. The arrow indicates the time
when the cryptogein was added. (B) Fluorescence microscopic images of the GFP fusion proteins and the corresponding bright field (BF) images are
shown. Bar = 40 mm. Cells were treated in S phase (0.5 h after aphidicolin release) with 1 mM cryptogein and samples were taken at several time points
after cryptogein application. The 1, 2, 3, 4 and 5 h correspond, respectively, to 1.5, 2.5, 3.5, 4.5 and 5.5 h after aphidicolin release. To reveal whether the
cryptogein-induced disappearance of CYCB2;2–GFP-derived fluorescence was inhibited by the proteasome inhibitor MG132 treatment, cultures of
transgenic plants were treated with 100 mM MG132 with or without 1 mM cryptogein. We repeated these experiments a minimum of three times and
representative data are shown. (C) The average nuclear fluorescence intensity was quantified at the time points indicated above after cryptogein and/or
MG132 application. Error bars indicate the SEM (n = 30).
928
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
Mechanism for cryptogein-induced cell cycle arrest
Cryptogein rapidly decreased the CDKB1 protein level in a
proteasome-dependent manner (Figs. 1D, 3A). This finding is
consistent with the recent report that the amount of CDKB2
protein is regulated not only at the transcriptional level, but
also through proteasome-mediated protein degradation in
Arabidopsis (Adachi et al. 2006). Cryptogein may accelerate
the degradation of CDKB1 protein.
During the past several years, many ubiquitination-related
components have been identified that are involved in plant–
pathogen or plant–insect interactions (Zeng et al. 2006).
Several kinds of proteasome subunits are up-regulated by cryptogein in tobacco (Petitot et al. 1997, Etienne et al. 2000, Dahan
et al. 2001). However, the molecular machinery that links
the ubiquitin–proteasome system and defense responses is
mostly unknown in plants. The present results provide evidence for the participation of proteasome-dependent protein
degradation in processes by which the pathogen defense signaling pathway becomes established. Cryptogein-induced
hypersensitive cell death also appears to require a
proteasome-dependent pathway (Fig. 3D) in addition to the
cell cycle arrest. It remains to be elucidated whether protein
degradation of cell cycle-related factors also plays a pivotal role
in induction of cell death.
Other CDK-interacting molecules such as KRPs may also
play a role in the cell cycle arrest process. Overexpression of
the tobacco CDK inhibitor, NtKIS1a, led to reduction in both
CDK activity and the cell division rate in Arabidopsis leaves
(Jasinski at al. 2002). Another CDK inhibitor, rice EL2,
has been shown to be induced by a fungal elicitor (Minami
et al. 1996) as well as biotic and abiotic stresses (Peres et al.
2007).
In conclusion, we have shown that in the process of cell cycle
arrest at G2 phase, cryptogein inactivated A- and B-type CDKs
by not only the down-regulation expression of various cell
cycle-related genes, but also by protein degradation of
CDKB1 and cyclin via the proteasome-dependent pathway.
Cell cycle arrest triggered during plant immune responses
may be mechanistically distinguished from known checkpoint
regulation. Moreover, the present results suggest that
proteasome-dependent protein degradation has crucial roles
in the control of cryptogein-induced hypersensitive cell
death. This experimental system should be a suitable model
to elucidate further the molecular links between early signaling
events and cell cycle regulation during stress responses in
plants.
Materials and Methods
Plant material
The tobacco BY-2 (Nicotiana tabacum L. cv. Bright Yellow 2)
cell suspension was maintained by weekly dilution (1/100) of
cells in modified Linsmaier and Skoog (LS) medium as described
in Nagata et al. (1992). The cell suspension was agitated on a
rotary shaker at 100 r.p.m. at 28 C in darkness.
Cell cycle synchronization
Synchronization of the cell cycle at S phase was performed as
described in Nagata et al. (1992). In brief, a stationary culture of
the cells was diluted 1/10 in fresh modified LS medium supplemented with 5 mg ml1 aphidicolin (Wako Pure Chemical).
After 24 h of culture, the aphidicolin was removed by extensive
washing and the cells were resuspended in fresh medium.
Expression and purification of cryptogein
Pichia pastoris (strain GS115) bearing the plasmid pLEP3 was
used to produce cryptogein. Cryptogein was expressed according to O’Donohue et al. (1996) and was dissolved in distilled
water. The cryptogein concentration was determined using UV
spectroscopy with an extinction coefficient of 8,306 M1 cm1
at 277 nm (O’Donohue et al. 1995).
Monitoring of cell cycle progression by
determination of the mitotic index and
flow cytometric analysis
The cell cycle progression was monitored by determination of
the mitotic index. After staining of the cells with
40 ,6-diamidino-2-phenylindole (DAPI), cells were observed
under a epifluorescence microscope and dividing cells were
counted. Flow cytometric analysis was performed according
to the manufacturer’s protocol as follows. A sample of frozen
cell pellet was treated with the CyStain UV precise P kit (Partec)
to determine the DNA content. To release cell nuclei, the cells
were carefully chopped with a sharp razor blade in extraction
buffer and filtered prior to addition of staining buffer. The
fluorescence intensity was measured by a Ploidy Analyzer
(Partec).
Isolation of a cDNA encoding tobacco CAK
Oligonucleotides were designed to amplify a conserved plant
CDK7 sequence from the reverse-transcribed total RNA of tobacco BY-2 cell suspension. These oligonucleotides were as follows: 50 -GAAGGTGTCAATTTCACTGC-30 and 50 -TTCCGGTCT
CTTATGACAGCTTC-30 . A -ZAP cDNA library was constructed with cDNA from BY-2 cells (3 d after subculture).
The amplified library (approximately 1.8 105 plaques) was
screened with the fragment amplified as above. We obtained
one cDNA clone carrying the partial tobacco CAK sequence
(NtCAK). To determine the 50 and 30 end of the NtCAK transcript, 50 and 30 rapid amplification of cDNA ends (RACE)-PCR
were conducted using a Marathon cDNA amplification kit
(Clontech). Single-stranded cDNA was produced with total
RNA extracted from BY-2 cells (3 d after subculture) and
used for the RACE-PCR. The following two gene-specific primers were used for the 50 and 30 RACE-PCR based on the
isolated NtCAK sequence. 50 -ATGCTCCAATGCTTGCTG
TGC-30 and 50 -CATGGAGACAGATCTTGAGGC-30 . The
RACE-PCR products were amplified using Ex Taq polymerase
(Takara) and sequenced.
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
929
R. Ohno et al.
RNA extraction and Northern analysis
Total RNA was extracted from each frozen cell sample using
TRIzol reagent, according to the manufacturer’s instructions
(Invitrogen). Denatured total RNA (15 mg) was electrophoresed
in 2% agarose gels containing 5.5% formaldehyde and transferred to Hybond-N membrane (Amersham-Pharmacia
Biotech). Hybridization was performed at 65 C in phosphate
buffer [500 mM Na-phosphate, pH 7.2, 1 mM EDTA, 1% bovine
serum albumin (BSA), 7% SDS] with random-primed
[a-32P]cDNA probes from tobacco. The following probes
were used: NtCYCA;1 (Ito et al. 1997), NtmybA2 and NtmybB
(Ito et al. 2001), a fragment amplified from mRNA by reverse
transcription–PCR using primers ATGGATAACAATAGTGTTG
GTGTTCC and GAAAGTCCACAAGCAGCCTTG; NtCYCB1;1
(0.4 kb, accession No.Z37978), CAAGTGTGTTGTCGGAGC
AAG and GTATCATGTCAACAGATCTATTTGGC; NtCYCB1;2
(0.4 kb, accession No. D50737), GCTGATATTTTCTCTGTAAT
GGCTTC and GGCTTTGGTTTAACAGCAGC; NtCYCB1;3
(0.37 kb, accession No. D89635), TCTCATTTAGATGTAAAGC
CAGATA and CGATTCATCATTGCCTTGAG; NtWEE1 (0.33 kb,
accession No. AJ715532), complete cDNA coding lesion;
NtCDKA;3 (885 bp, accession No. D50738), NtCDKB1;1
(912 bp, accession No. AF289465) and NtCAK (1 kb, accession
No. AB293452). Hybridization signals were visualized with a
Typhoon 9210 (Amersham-Pharmacia Biotech).
Protein extraction and histone H1 kinase assays
Tobacco BY-2 cell pellets were ground in liquid nitrogen into a
fine powder in extraction buffer (25 mM Tris–HCl, pH 7.6,
75 mM NaCl, 15 mM MgCl2, 15 mM EGTA, 0.1% NP-40, 1 mM
phenylmethylsulfonyl
fluoride,
10 mg ml1
leupeptin,
1
50 mg ml
N-tosyl-L-phenylalanine chloromethyl ketone,
1 mg ml1 pepstatin A, 10 mg ml1 aprotinin, 5 mg ml1 antipain, 10 mg ml1 soybean trypsin inhibitor, 0.1 mM benzamidine, 1 mM NaF, 60 mM b-glycerophosphate and 0.1 mM
sodium orthovanadate) and cleared subsequently by centrifugation. Protein concentrations were determined with Bio-Rad
(USA) Protein Assay Dye Reagent using BSA as a standard.
For immunoprecipitation experiments, protein extracts
(100 mg) were pre-incubated for 1 h at 4 C on a rotating platform with 5 ml of 50% (v/v) protein A–Sepharose (Amersham
Biosciences). After centrifugation, the supernatants were incubated for 2 h at 4 C with 4 mg of Nicta; CDKB1-specific antibody
(Sorrell et al. 2001), and then for 2 h with 40 ml of 50% (v/v)
protein A–Sepharose beads. The immunoprecipitates were
washed three times with bead buffer [50 mM Tris–HCl, pH
7.5, 5 mM NaF, 250 mM NaCl, 0.1% (w/w) NP-40, 0.1 mM
Na3VO4, 5 mM EDTA and 5 mM EGTA, pH 8.0] containing
10 mg ml1 leupeptin, 0.1 mM benzamidine and 10 mg ml1 aprotinin, and once with kinase buffer (25 mM HEPES-NaOH, pH 7.5,
10 mM magnesium acetate). Binding of p13suc1 was achieved by
adding 20 ml of 50% (v/v) p13suc1–agarose beads (Upstate) to
the protein extracts for 2 h at 4 C. Kinase assays were performed on proteins immobilized on protein A–Sepharose
930
beads or p13suc1–agarose beads (Harashima et al. 2007). The
reaction was initiated by adding 10 ml of kinase buffer containing 2 mg of histone H1 (Calbiochem) as a substrate, 0.01 mM
ATP and 370 kBq of [g-32P]ATP (Amersham). After incubation
for 30 min at 30 C, the reaction was stopped by the addition of
sample buffer for SDS–PAGE, boiled for 5 min, and loaded onto
a 10% polyacrylamide gel. Phosphorylated proteins were detected with a Typhoon 9210 (Amersham-Pharmacia Biotech).
Western blotting
Proteins were separated by 10% SDS–PAGE and blotted onto
nitrocellulose membrane. Blots were blocked overnight in
Tris-buffered saline (TBS) with 5% milk at 4 C. CDKA- and
CDKB1-specific antibodies (Sorrell et al. 2001) were diluted
1 : 2,000 in TBS, Triton X (0.05%) and incubated for at least
1 h at room temperature. Antigen–antibody complexes were
detected using horseradish peroxidase-conjugated protein A
diluted 1 : 2,000 (Amersham) with a chemiluminescence
system (Amersham-Pharmacia Biotech).
Cell death assay
A 1 ml aliquot of the cell suspension was incubated with 0.05%
Evans blue (Sigma) for 15 min and then washed to remove
unabsorbed dye. The selective staining of dead cells with
Evans blue depends upon extrusion of the dye from living
cells via the intact plasma membrane. The dye passes through
the damaged membrane of dead cells and accumulates as a
blue protoplasmic stain (Turner and Novacky 1974). Dye that
had been absorbed by dead cells was extracted in 50% methanol with 1% SDS for 1 h at 60 C and quantified by absorbance at
595 nm. We also measured the fresh weight by using 10 ml of
the same culture, and the value measured by Evans blue was
divided by the fresh weight to average the cell volume.
Observation of CYCB2;2–GFP fusion protein
Transgenic BY-2 cells expressing CYCB2;2–GFP were generated
as described previously (Lee et al. 2003). In order to overexpress
CYCB2;2–GFP, b-estradiol (1 mM) was applied to activate the
inducible promoter during cell cycle synchronization with aphidicolin (Zuo et al. 2000). After release from the aphidicolin
block, b-estradiol was added to the culture again. A drop of
cell suspension was transferred on a slide, carefully covered with
a coverslip and observed with an upright fluorescence microscope (Zeiss). Fluorescent intensities were quantified from each
picture by using the measure function in the ‘analyze’ tool
palette in ImageJ (http://rsb.info.nih.gov/ij/). Intensity values
were collected from in focus cells using the polygon selection
tool.
Funding
This work was supported the Japan Society for the Promotion
of Science [Grant-in-Aid for the Research for the Future
Program and Scientific Research to K.K.]; Ministry of
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
Mechanism for cryptogein-induced cell cycle arrest
Education, Science, Culture, Sports, and Technology, Japan
[Grants-in-Aid for Scientific Research in Priority Areas (No.
13039015 and No. 17051027) to K.K.]; the Japan Society for
the Promotion of Science [Scientific Research Grant
(No. 06801) to Y.K.].
Acknowledgments
The authors thank Dr. Masaki Ito for generous gifts of cDNA
clones for NtmybA2 and NtmybB, Professor Jean-Claude
Pernollet for providing us with the cryptogein gene, and
Dr. Shinya Takahashi for critical reading of the manuscript.
References
Adachi, S., Uchimiya, H. and Umeda, M. (2006) Expression of B2-type
cyclin-dependent kinase is controlled by protein degradation in
Arabidopsis thaliana. Plant Cell Physiol. 47: 1683–1686.
Arabidopsis Genome Initiative. (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:
796–815.
Araki, S., Ito, M., Soyano, T., Nishihama, R. and Machida, Y. (2004)
Mitotic cyclins stimulate the activity of c-Myb-like factors for transactivation of G2/M phase-specific genes in tobacco. J. Biol. Chem.
279: 32979–32988.
Berry, L. and Gould, K.L. (1996) Regulation of Cdc2 activity by phosphorylation at T14/Y15. In Progression in Cell Cycle Research, Vol. 2.
Edited by Meijer, L., Guidet, S. and Vogel, L. pp. 99–105. Plenum
Press, New York.
Binet, M., Humbert, C., Lecourieux, D., Vantard, M. and Pugin, A.
(2001) Disruption of microtubular cytoskeleton induced by cryptogein, an elicitor of hypersensitive response in tobacco cells. Plant
Physiol. 125: 564–572.
Dahan, J., Etienne, P., Petitot, A., Houot, V., Blein, J. and Suty, L. (2001)
Cryptogein affects expression of alpha3, alpha6 and beta1 20S proteasome subunits encoding genes in tobacco. J. Exp. Bot. 56:
1947–1948.
De Schutter, K., Joubes, J., Cools, T., Verkest, A., Corellou, F.,
Babiychuk, E. et al. (2007) Arabidopsis WEE1 kinase controls cell
cycle arrest in response to activation of the DNA integrity checkpoint. Plant Cell 19: 211–225.
Dewitte, W. and Murray, J. (2003) The plant cell cycle. Annu. Rev. Plant
Biol. 54: 235–264.
Dunphy, W.G. (1994) The decision to enter mitosis. Trends Cell Biol. 4:
202–207.
Etienne, P., Petitot, A., Houot, V., Blein, J. and Suty, L. (2000) Induction
of tcI 7, a gene encoding a beta-subunit of proteasome, in tobacco
plants treated with elicitins, salicylic acid or hydrogen peroxide.
FEBS Lett. 466: 213–218.
Featherstone, C. and Russell, P. (1991) Fission yeast p107 wee1 mitotic
inhibitor is a tyrosine/serine kinase. Nature 28: 808–811.
Genschik, P., Criqui, M., Parmentier, Y., Derevier, A. and Fleck, J. (1998)
Cell cycle-dependent proteolysis in plants. Identification of the destruction box pathway and metaphase arrest produced by the proteasome inhibitor MG132. Plant Cell 10: 2063–2076.
Giménez-Abián, J.F., Weingartner, M., Binarova, P., Clarke, D.J.,
Anthony, R.G., Calderini, O. et al. (2002) A topoisomerase
II-dependent checkpoint in G2-phase plant cells can be bypassed
by ectopic expression of mitotic cyclin B2. Cell Cycle 1: 187–192.
Gómez-Gómez, L., Felix, G. and Boller, T. (1999) A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant
J. 18: 277–284.
Gonzalez, N., Hernould, M., Delmas, F., Gevaudant, F., Duffe, P.,
Causse, M. et al. (2004) Molecular characterization of a WEE1
gene homologue in tomato (Lycopersicon esculentum Mill.).
Plant Mol. Biol. 56: 849–861.
Harashima, H., Shinmyo, A. and Sekine, M. (2007) Phosphorylation of
threonine 161 in plant cyclin-dependent kinase A is required for cell
division by activation of its associated kinase. Plant J. 52: 435–448.
Hata, S. (1991) cDNA cloning of a novel cdc2+/CDC28-related protein
kinase from rice. FEBS Lett. 279: 149–152.
Higaki, T., Goh, T., Hayashi, T., Kutsuna, N., Kadota, Y., Hasezawa, S.
et al. (2007) Elicitor-induced cytoskeletal rearrangement relates to
vacuolar dynamics and execution of cell death: in vivo imaging of
hypersensitive cell death in tobacco BY-2 cells. Plant Cell Physiol. 48:
1414–1425.
Ito, M., Araki, S., Matsunaga, S., Itoh, T., Nishihama, R., Machida, Y.
et al. (2001) G2/M-phase-specific transcription during the plant cell
cycle is mediated by c-Myb-like transcription factors. Plant Cell 13:
1891–1905.
Ito, M., Iwase, M., Kodama, H., Lavisse, P., Komamine, A., Nishihama, R.
et al. (1998) A novel cis-acting element in promoters of plant B-type
cyclin genes activates M phase-specific transcription. Plant Cell 10:
331–341.
Ito, M., Marie-Claire, C., Sakabe, M., Ohno, T., Hata, S., Kouchi, H. et al.
(1997) Cell-cycle-regulated transcription of A- and B-type plant
cyclin genes in synchronous cultures. Plant J. 11: 983–992.
Jasinski, S., Riou-Khamlichi, C., Roche, O., Perennes, C., Bergounioux, C.
and Glab, N. (2002) The CDK inhibitor NtKIS1a is involved in plant
development, endoreduplication and restores normal development
of cyclin D3; 1-overexpressing plants. J. Cell Sci. 115: 973–982.
Jin, P., Gu, Y. and Morgan, D.O. (1996) Role of inhibitory CDC2 phosphorylation in radiation induced G2 arrest in human cells. J. Cell
Biol. 134: 963–970.
John, P., Mews, M. and Moore, R. (2001) Cyclin/Cdk complexes: their
involvement in cell cycle progression and mitotic division.
Protoplasma 216: 119–142.
Kadota, Y., Furuichi, T., Ogasawara, Y., Goh, T., Higashi, K., Muto, S.
et al. (2004a) Identification of putative voltage-dependent Ca2+permeable channels involved in cryptogein-induced Ca2+ transients
and defense responses in tobacco BY-2 cells. Biochem. Biophys. Res.
Commun. 317: 823–830.
Kadota, Y. and Kuchitsu, K. (2006) Regulation of elicitor-induced defense responses by Ca2+ channels and cell cycle in tobacco BY-2
cells. In Tobacco BY-2 Cells: From Cellular Dynamics to Omics.
Biotechnology in Agriculture and Forestry, Vol. 58. Edited by
Nagata, T., Matsuoka, K. and Inze, D. pp. 207–221. Springer, Berlin.
Kadota, Y., Watanabe, T., Fujii, S., Higashi, K., Sano, T., Nagata, T. et al.
(2004b) Crosstalk between elicitor-induced cell death and cell cycle
regulation in tobacco BY-2 cells. Plant J. 40: 131–142.
Kadota, Y., Watanabe, T., Fujii, S., Maeda, Y., Ohno, R., Higashi, K. et al.
(2005) Cell cycle dependence of elicitor-induced signal transduction in tobacco BY-2 cells. Plant Cell Physiol. 46: 156–165.
Kaldis, P. (1999) The cdk-activating kinase (CAK): from yeast to mammals. Cell Mol. Life Sci. 55: 284–296.
Kumagai, A. and Dunphy, W.G. (1991) The cdc25 protein contains an
intrinsic phosphatase activity. Cell 67: 189–196.
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.
931
R. Ohno et al.
Lee, J., Das, A., Yamaguchi, M., Hashimoto, J., Tsutsumi, N.,
Uchimiya, H. et al. (2003) Cell cycle function of a rice B2-type
cyclin interacting with a B-type cyclin-dependent kinase. Plant J.
34: 417–425.
Longmann, E., Wu, S.C., Schroder, E., Somssich, I.E. and Hahlbrock, K.
(1995) Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell
cycle related genes. Plant J. 8: 865–876.
May, M., Vernoux, T., Leaver, C., Van Montagu, M. and Inze, D. (1998)
Glutathione homeostasis in plants: implications for
environmental sensing and plant development. J. Exp. Bot. 49:
649–667.
Minami, E., Kuchitsu, K., He, D.-Y., Kouchi, H., Midoh, N., Ohtsuki, Y.
et al. (1996) Two novel genes rapidly and transiently activated in
suspension-cultured rice cells by treatment with N-acetylchitoheptaose, a biotic elicitor for phytoalexin production. Plant Cell Physiol.
37: 563–567.
Mironov, V., De Veylder, L., Van Montagu, M. and Inze, D. (1999)
Cyclin-dependent kinases and cell division in plants—the nexus.
Plant Cell 11: 509–522.
Morgan, D.O. (1997) Cyclin-dependent kinases: engines, clocks, and
microprocessors. Annu. Rev. Cell Dev. Biol. 13: 261–291.
Nagata, T., Nemoto, Y. and Hasezawa, S. (1992) Tobacco BY-2 cell line
as the ‘HeLa’ cell in the cell biology of higher plants. Int. Rev. Cytol.
132: 1–30.
Nurse, P. (1990) Universal control mechanism regulating onset of
M-phase. Nature 344: 503–508.
O’Connell, M., Raleigh, J., Verkade, H. and Nurse, P. (1997) Chk1 is a
wee1 kinase in the G2 DNA damage checkpoint inhibiting cdc2 by
Y15 phosphorylation. EMBO J. 16: 545–554.
O’Connor, P., Ferris, D., Pagano, M., Draetta, G., Pines, J., Hunter, T.
et al. (1993) G2 delay induced by nitrogen mustard in human cells
affects cyclin A/cdk2 and cyclin B1/cdc2 kinase complexes differently. J. Biol. Chem. 268: 8298–8308.
O’Donohue, M., Boissy, G., Huet, J., Nespoulous, C., Brunie, S. and
Pernollet, J. (1996) Overexpression in Pichia pastoris and
crystallization of an elicitor protein secreted by the phytopathogenic fungus, Phytophthora cryptogea. Protein Expr. Purif. 8:
254–261.
O’Donohue, M., Gousseau, H., Huet, J., Tepfer, D. and Pernollet, J.C.
(1995) Chemical synthesis, expression and mutagenesis of a gene
encoding beta-cryptogein, an elicitin produced by Phytophthora
cryptogea. Plant Mol. Biol. 27: 577–586.
Peres, A., Churchman, M.L., Hariharan, S., Himanen, K., Verkest, A.,
Vandepoele, K. et al. (2007) Novel plant-specific cyclin-dependent
kinase inhibitors induced by biotic and abiotic stresses. J. Biol. Chem.
282: 25588–25596.
Petitot, A., Blein, J., Pugin, A. and Suty, L. (1997) Cloning of two plant
cDNAs encoding a beta-type proteasome subunit and a
transformer-2-like SR-related protein: early induction of the corresponding genes in tobacco cells treated with cryptogein. Plant Mol.
Biol. 35: 261–269.
932
Reichheld, J.-P., Vernoux, T., Lardon, F., Montagu, M.V. and Inze, D.
(1999) Specific checkpoints regulate plant cell cycle progression in
response to oxidative stress. Plant J. 17: 647–656.
Ricci, P., Bonnet, P., Huet, J., Sallantin, M., Beauvais-Cante, F.,
Bruneteau, M. et al. (1989) Structure and activity of proteins
from pathogenic fungi Phytophthora eliciting necrosis and acquired
resistance in tobacco. Eur. J. Biochem. 183: 555–563.
Sano, T., Higaki, T., Handa, K., Kadota, Y., Kuchitsu, K., Hasezawa, S.
et al. (2006) Calcium ions are involved in the delay of plant cell cycle
progression by abiotic stresses. FEBS Lett. 580: 597–602.
Shimotohno, A., Matsubayashi, S., Yamaguchi, M., Uchimiya, H. and
Umeda, M. (2003) Differential phosphorylation activities of
CDK-activating kinases in Arabidopsis thaliana. FEBS Lett. 534:
69–74.
Shimotohno, A., Ohno, R., Bisova, K., Sakaguchi, N., Huang, J., Koncz, C.
et al. (2006) Diverse phosphoregulatory mechanisms controlling
cyclin-dependent kinase-activating kinases in Arabidopsis. Plant J.
47: 701–710.
Sorrell, D., Menges, M., Healy, J., Deveaux, Y., Amano, C., Su, Y. et al.
(2001) Cell cycle regulation of cyclin-dependent kinases in tobacco
cultivar Bright Yellow-2 cells. Plant Physiol. 126: 1214–1223.
Suzuki, K., Nishiuchi, T., Nakayama, Y., Ito, M. and Shinshi, H. (2006)
Elicitor-induced down-regulation of cell cycle-related genes in tobacco cells. Plant Cell Environ. 29: 183–191.
Turner, J. and Novacky, A. (1974) The quantitative relation between
plant and bacterial cells involved in the hypersensitive reaction.
Phytopathology 64: 885–890.
Umeda, M., Bhalerao, R.P., Schell, J., Uchimiya, H. and Koncz, C. (1998)
A distinct cyclin-dependent kinase-activating kinase of Arabidopsis
thaliana. Proc. Natl Acad. Sci. USA 95: 5021–5026.
Umeda, M., Shimotohno, A. and Yamaguchi, M. (2005) Control of cell
division and transcription by cyclin-dependent kinase-activating
kinases in plants. Plant Cell Physiol. 46: 1437–1442.
van Vugt, M., Bras, A. and Medema, R.H. (2005) Restarting the cell
cycle when the checkpoint comes to a halt. Cancer Res. 65:
7037–7040.
Vousden, K. and Lu, X. (2002) Live or let die: the cell’s response to p53.
Nat. Rev. Cancer 2: 594–604.
Xiong, Y., Hannon, G., Zhang, H., Casso, D., Kobayashi, R. and Beach, D.
(1993) p21 is a universal inhibitor of cyclin kinases. Nature 366:
701–704.
Yoshiyama, K., Conklin, P.A., Huefner, N.D and Britt, A.B. (2009)
Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage. Proc.
Natl Acad Sci. USA 106: 12843–12848.
Zeng, L.R., Vega-Sánchez, M.E., Zhu, T. and Wang, G.L. (2006)
Ubiquitination-mediated protein degradation and modification:
an emerging theme in plant–microbe interactions. Cell Res. 16:
413–426.
Zuo, J., Niu, Q. and Chua, N. (2000) Technical advance: an estrogen
receptor-based transactivator XVE mediates highly inducible gene
expression in transgenic plants. Plant J. 24: 265–273.
Plant Cell Physiol. 52(5): 922–932 (2011) doi:10.1093/pcp/pcr042 ! The Author 2011.