Journal
of General Virology (1999), 80, 3199–3205. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Characterization of the DNA polymerase loci of the novel
porcine lymphotropic herpesviruses 1 and 2 in domestic and
feral pigs
Sven Ulrich, Michael Goltz and Bernhard Ehlers
Robert Koch-Institut, Nordufer 20, 13353 Berlin, Germany
Two novel porcine gammaherpesviruses, porcine lymphotropic herpesviruses 1 and 2 (PLHV-1
and -2), have been detected by amplification of short DNA polymerase (DPOL) sequences from
blood and spleen of domestic pigs while searching for unknown herpesviruses in pigs as possible
risk factors in xenotransplantation. In the present study, the DPOL genes of the two viruses and the
open reading frames (ORFs) that follow in the downstream direction were amplified by PCR-based
genome walking from adaptor-ligated restriction fragment libraries of porcine spleen samples. The
sequences determined for the two PLHVs exhibited a very low GMC content (37 mol%) and a
marked suppression of the CpG dinucleotide frequency. The DPOL proteins encoded were 95 %
identical and showed a close relationship (60 % identity) to the DPOL protein of a ruminant
gammaherpesvirus, alcelaphine herpesvirus 1 (AlHV-1). This was confirmed by phylogenetic
analyses of the conserved regions of the two PLHV DPOL proteins. The PLHV ORFs downstream of
DPOL exhibited 83 % identity to each other and 50 % similarity to ORF A5, the position
equivalent of AlHV-1. From these data, the PLHVs can be firmly classified to the subfamily
Gammaherpesvirinae. To find a natural reservoir for the PLHVs, organs of feral pigs were screened
with five different PCR assays, targetting either the DPOL gene or 3h-flanking sequences. In all
samples, PLHV sequences were detected that originated predominantly from PLHV-2, suggesting
the possibility of virus transfer between feral and domestic pig populations.
Introduction
Xenotransplantation, the transplantation of animal organs
into humans, is proposed as a potential solution for the
constantly increasing organ shortage in allotransplantation,
and domestic pigs are currently favoured as the donor animals
(Ye et al., 1994 ; Fishman, 1994). However, xenotransplantation
involves the risk of inadvertently transferring animal pathogens to the immunocompromised organ recipient (Michaels,
1997 ; Fishman, 1997). This risk is not merely hypothetical,
since several viruses have been reported to cross barriers
between animals and humans (Breman et al., 1980 ; Holmes et
al., 1995 ; Gao et al., 1992, 1999). Most recently, a previously
Author for correspondence : Bernhard Ehlers.
Fax j49 30 4547 2598. e-mail ehlersb!rki.de
The GenBank accession numbers of the sequences determined in this
study are AF191042 (PLHV-1), AF191043 (PLHV-2) and AF191044
(PCMV).
0001-6521 # 1999 SGM
unknown porcine paramyxovirus caused the deaths of more
than 100 people in Malaysia (Enserink, 1999). Furthermore,
porcine endogenous retroviruses were reported to grow on
cells of human origin (Patience et al., 1997 ; Martin et al., 1998)
and simian retroviral sequences were detected in human
recipients of baboon liver transplants (Allan et al., 1998).
Therefore, recipients of xenotransplants have to be carefully
monitored for transmission of animal viruses. However, viruses
so far unknown would be excluded from this monitoring
process for the lack of detection methods and would therefore
be even more difficult to control. For this reason, we have
previously begun a search for unknown herpesviruses in
domestic pigs, because herpesviruses are frequently transmitted or reactivated in allotransplantation with resulting
clinical complications (Britt & Alford, 1996 ; Feranchak et al.,
1998 ; Hudnall et al., 1998 ; Kadakia, 1998). We have analysed
porcine blood and tissues samples with a PCR assay that
detects herpesvirus DNA polymerase (DPOL) sequences
universally (Ehlers et al., 1999 a). With this technique, short
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DBJJ
S. Ulrich, M. Goltz and B. Ehlers
sequences of two novel porcine herpesviruses with high
similarity to gammaherpesviruses have been identified.
They have been named porcine lymphotropic herpesvirus 1
(PLHV-1) and 2 (PLHV-2) (Ehlers et al., 1999 b).
The goal of the present study was to characterize the
genomes of the PLHVs further and to base their phylogenetic
relationship and classification on analyses of complete genes.
Furthermore, feral pigs (Sus scrofa) were analysed for the
presence of PLHVs to find a natural reservoir.
Methods
Collection of porcine blood and organ samples and
preparation of DNA. Blood and spleen samples were collected from
commercial pig herds in Brandenburg, Germany. Bone marrow samples
of feral pigs were collected from hunted animals in Germany. Total DNA
was prepared by the QIAamp Blood and Tissue kits (Qiagen).
Genome walking and cloning procedures. PLHV sequences
extending from the published PLHV sequences (Ehlers et al., 1999 b) into
unknown flanking regions were amplified by Genexpress GmbH (Berlin)
on the basis of the Universal GenomeWalker kit from Clontech (Siebert
et al., 1995). Briefly, separate aliquots of PLHV-1- and PLHV-2-infected
pig samples as well as two samples of non-infected pigs were digested
with six restriction enzymes. Each batch of digested genomic DNA was
then ligated separately to an adaptor. With these adaptor-ligated libraries,
nested PCR was performed by using an outer adaptor primer (AP1) and
an outer gene-specific primer (GSP1) in first-round PCR and the inner
primers AP2 and GSP2 in second-round PCR. The amplicons obtained
were ligated into the plasmid pCR-Script Amp SK(j) (Stratagene) and
transformed into Epicurian Coli XL10-Gold Kan ultracompetent cells
(Stratagene). Specific clones were identified by PCR with the primers AP2
and GSP2.
PCR applications and nucleotide sequence determination.
In PCR analyses of PLHV-containing feral pig samples, both PLHVs were
amplified with the primer pair 170-S\170-AS. PLHV-1 was amplified
selectively with the primer pairs 170-S\160-AS or 213-S\215-AS and
PLHV-2 with the primer pair 208-S\212-AS. All amplified regions are
located inside the DPOL gene (Ehlers et al., 1999 b). Primer pair 278-S\
276-AS amplified a region of both PLHVs outside the DPOL gene
(483 bp), with primer 278-S (5h GGAAATGATGCCCTTTAGGGTTTTG 3h) binding to the intergenic region between DPOL and ORF A5
and primer 276-AS (5h ATGGGGCCATTCCACCTCTACTT 3h) binding
to the 5h part of ORF A5. The locations of all amplified regions are
depicted in Fig. 2 (a).
For the PCR analyses of PLHV-containing domestic pig samples
shown in Fig. 1, the PLHV-1-specific primer pair 170-S\160-AS and the
PLHV-2-specific primer pair 280-S (5h CTCTATCATCCTACCATATGATGGC 3h) and 280-AS (5h GGCTATGTTGTATCCCGTAATAATC
3h) were used.
For amplification of porcine cytomegalovirus (PCMV) sequences, the
primers 199-S (5h ACGAGAAAGATATTCTGACGGTGCA 3h) and
199-AS (5h TCTAGACGAAAGGACATTGTTGATA 3h) were selected
on the basis of the unpublished partial DPOL sequence of PCMV, strain
B6, deposited in GenBank by F. B. Widen, M. Banks & P. J. Lowings
(accession number AJ222640). With these primers, an amplicon of 340 bp
was obtained from PCMV strain B6 (kindly provided by M. Banks,
Addlestone, UK). Amplicons of identical size were obtained from several
German spleen samples. Their sequences were 99 % identical to the B6
sequence and the data were deposited in GenBank (accession no.
AF191044).
DCAA
Fig. 1. Differential detection of PLHV-1 and PLHV-2 in blood and spleen
samples. The PLHV-1-containing samples F56 (spleen), F471 (spleen)
and F68 (blood) (lanes 1–3) and the PLHV-2-containing samples F489
(spleen), F725 (spleen) and F616 (blood) (lanes 5–7) were analysed by
PCR with the PLHV-1-specific primers 170-S/160-AS (A) or the PLHV-2specific primers 280-S/280-AS (B). A 100 bp ladder (Boehringer ; size of
prominent band, 0n5 kbp) was used as a size marker (lanes 8). Water
without template served as a control (lanes 4).
The absence of PCR inhibitors in samples was tested by PCR with
specificity for a conserved region of the vertebrate cytochrome B gene
(Kocher et al., 1989).
The reactions were set up as described previously (Ehlers et al.,
1999 b). Amplifications were performed after complete activation of the
DNA polymerase AmpliTaq Gold (Moretti et al., 1998) for 12 min at
95 mC and then cycled 40 times through 30 s denaturation at 95 mC, 30 s
annealing at 55 mC (primers 170, 170\160, 190, 213\215, 278\276 and
280) or 58 mC (primers 208\212) and 30 s extension at 72 mC, followed
by a final extension step at 72 mC for 10 min. PCR products were
sequenced directly as described previously (Ehlers et al., 1999 b).
Nucleotide and protein sequence analysis. Multiple sequence
alignments were performed with the clustalW module of MacVector
(version 6.01, Oxford Molecular Group). Protein pair distances were
calculated with the MegAlign module of DNA* (version 3.17,
DNASTAR). Phylogenetic analysis was based on a multiple amino acid
alignment from which gaps or insertions unique to a particular species
had been removed. The remaining conserved regions were concatenated
(McGeoch et al., 1995) and subjected to phylogenetic tree construction
by using the programs Protpars or Protdist and Neighbor from the
PHYLIP program package (Felsenstein, 1985, 1993). The trees were
evaluated statistically by using 1000 bootstrap samples.
Nucleotide sequence accession numbers. The sequences from
PLHV-1 (4643 bp), PLHV-2 (4642 bp) and PCMV (290 bp) determined
in this study were deposited in the GenBank nucleotide sequence
database under accession numbers AF191042 (PLHV-1), AF191043
(PLHV-2) and AF191044 (PCMV).
Results
The porcine gammaherpesviruses PLHV-1 and PLHV-2
have been detected previously by amplification of short viral
DPOL sequences (466 and 423 bp, respectively) from blood
and spleen samples of commercial domestic pigs (Ehlers et al.,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DNA polymerase loci of PLHV-1 and -2
Fig. 2. ORF and nucleotide composition analyses of the 4n6 kbp sequences of PLHV-1 and PLHV-2. (A) The results of the ORF
analyses of the PLHV-1 sequence from F56 (spleen) and the PLHV-2 sequence from F489 (spleen) are shown as a schematic
diagram. ORFs are represented by arrows with the direction of transcription indicated. The glycoprotein gB ORF is incomplete in
both sequences. The ORFs downstream of PLHV-1 and PLHV-2 DPOL are most closely related to the A5 ORF of AlHV-1 and
therefore designated as A5 homologue. Regions amplified by PCR with primer pairs 170/170, 213/215, 208/212, 170/160
and 278/276 for comparison of PLHV sequences from domestic and feral pig are represented by lines : the primer numbers
are indicated. (B) The dinucleotide frequencies of the PLHV sequences are listed as ratios between the observed and expected
frequencies (Obs./Exp.). The reduced CpG frequency and the increased TpG and CpA frequencies are indicated by shading.
1999 b). We now characterized the PLHV genomes to a larger
extent by using a PCR-based genome walking technique on
PLHV-containing porcine DNA.
Selection of PLHV-infected pig organs for PCR-based
genome walking
To select the template material for the walking approach,
we tested 27 spleen and 95 blood samples for the presence of
PLHV-1 and PLHV-2 with the primer pairs 213-S\215-AS and
208-S\212-AS, respectively. Samples with strong PCR reactions for one of the PLHV species were re-examined by
template dilution and subsequent PCR to estimate the PLHV
copy number per ng total DNA. Additionally, we attempted to
exclude samples containing PCMV by the use of the PCMVspecific primer pair 199-S\199-AS. Since we had previously
found PCMV [but not pseudorabies virus (PRV)] in porcine
spleen samples with degenerate primers (Ehlers et al., 1999 b),
we wanted to avoid a possible mixing of PLHV sequences with
PCMV sequences generated in the genome walking process.
In this screening, no samples with a sufficient copy number
of either PLHV-1 or PLHV-2 but negative for PCMV could be
found. The reason for this was primarily the high prevalence of
PCMV in the spleen samples (" 90 %). Blood samples had a
low prevalence of PCMV (" 15 %) but also mostly had
insufficient copy numbers of the two PLHVs. Therefore, a
PLHV-1-positive spleen sample (F56) was selected that
contained 100 PLHV-1 genomes per ng total DNA ( 1
genome per cell) and was negative for PLHV-2. Likewise, a
PLHV-2-positive spleen sample (F489) was selected that
contained 10 PLHV-2 genomes per ng total DNA ( 0n1
genomes per cell) and was negative for PLHV-1.
PLHV genome walking with adaptor-ligated restriction
fragment libraries
The genome walking was based on a nested PCR approach,
with adaptor-ligated genomic DNA fragments from the
selected pig spleens F56 and F489, as described in Methods.
Overlapping amplicons of 0n4–2 kbp were obtained, spanning
a total of 5n5 kbp of PLHV-1 and 2n8 kbp of PLHV-2. The
amplicons were cloned in E. coli by using the vector pCR-Script
and then sequenced. Cloning and sequencing were repeated
once or twice for identification of polymerase errors in
individual clones. PCR was performed on the spleen samples
F56 and F489 with specific primers derived from these
sequences. The resulting amplicons were sequenced and
compared with the walking-derived sequences. Upstream of
the walking-derived region of PLHV-2, the walking process
failed. Therefore, additional sequences of PLHV-2 were
amplified by PCR only, by using sense primers derived from
the PLHV-1 sequence and antisense primers from the PLHV-2
sequence. This approach was successful with some of the
PLHV-1 primers because of the similarity of PLHV-1 and -2,
shown in detail below. Consensus sequences of 4643 and
4642 bp, with 4- to 10-fold redundancy, were determined for
PLHV-1 and PLHV-2, respectively, and used for further
analyses. In a first step, the sequences were compared with the
complete DPOL gene and adjacent downstream sequences of
PCMV, since samples F56 and F489 contained not only PLHV
but also PCMV. No significant stretches of identity were found
in comparison with the PCMV sequences obtained from
sample F489 and from the British PCMV strain B6 (M. Goltz
& B. Ehlers, unpublished data) (not shown). Secondly, we
analysed several regions of the DPOL genes of PLHV-1 and
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DCAB
S. Ulrich, M. Goltz and B. Ehlers
Analysis of the DPOL genes
Fig. 3. Multiple amino acid alignment of the DPOLs of PLHV-1, PLHV-2
and AlHV-1. The two PLHV DPOLs are compared with their closest
relative, the DPOL of AlHV-1. Dots indicate identical amino acids and
dashes indicate gaps. The exonuclease domains (EXO I–III) and
polymerization domains (Motif A–C) of the DPOL proteins are indicated by
shading. The AlHV-1 DPOL was derived from the complete AlHV-1
genome sequence (accession no. AF005370 ; start of the DPOL ORF at
nucleotide 19 428).
-2 in additional blood and spleen samples. Identical amplicons
and sequences were obtained for each PLHV species, which
revealed the absence of PLHV sequence variation in samples of
different origin. This is demonstrated by PCR results obtained
with primer pairs that detect PLHV-1 or PLHV-2 differentially
(Fig. 1).
PLHV open reading frame (ORF) and nucleotide
composition analyses
In an ORF analysis, the 4643 bp PLHV-1 sequence was
found to span the 3h end of the glycoprotein B gene (184 bp),
the complete ORF of DPOL (3012 bp) and an additional ORF
(975 bp). The 4642 bp PLHV-2 sequence contained 184 bp of
the 3h end of the glycoprotein B gene, the complete DPOL
ORF (3003 bp) and an additional ORF of 912 bp (Fig. 2 a). Both
sequences exhibited very low GjC contents of 37 mol% and
a marked suppression of the CpG dinucleotide frequency with
a concomitant increase of TpG and CpA (Fig. 2 b). These
characteristic dinucleotide frequencies have been found in
several AjT-rich lymphotropic herpesviruses (Albrecht et al.,
1992 ; Ensser et al., 1997 ; Virgin et al., 1997).
DCAC
The DPOL ORFs of PLHV-1 and PLHV-2 (3012 and
3003 bp, respectively) differed at 194 nucleotide positions,
corresponding to an identity of 93 %. The deduced amino acid
sequences showed 50 amino acid differences, corresponding to
an identity of 95 % (Fig. 3). These differences confirmed our
previous suggestion (Ehlers et al., 1999 b) that the PLHVs are
distinct, closely related species rather than strains of the same
species. The PLHV-1 and PLHV-2 DPOLs (1004 and 1001
amino acids, respectively) were found to be the shortest
herpesvirus DPOLs described so far, compared with those of
other herpesviruses (1009–1246 amino acids). Both polymerases contained the conserved exonuclease (EXO I–III) and
polymerization (motifs A–C) domains of DNA-dependent
DNA polymerases of eukaryotic viruses (Knopf, 1998 ; Blanco
et al., 1991) (Fig. 3).
Both PLHV DPOLs were closely related to the DNA
polymerases of other gammaherpesviruses, in particular that of
alcelaphine herpesvirus 1 (AlHV-1 ; Ensser et al., 1997). The
PLHV DPOL genes were 60 % identical to AlHV-1 DPOL.
This identity is 8 % lower than that reported previously (Ehlers
et al., 1999 b), since we analysed only a short, highly conserved
region of DPOL in that study. Phylogenetic analysis was used
to confirm the relationships observed. In the resulting
phylogenetic tree, the herpesvirus subfamilies were separated
with high bootstrap scores. In the cluster of the Gammaherpesvirinae, the PLHVs showed the shortest genetic distance
to AlHV-1 (Fig. 4). The use of parsimony analysis gave a
similar result (not shown).
Analysis of the ORFs downstream of the DPOL genes
The PLHV-1 and -2 proteins encoded by the ORFs
downstream of the DPOL gene spanned 325 and 304 amino
acids, respectively, and exhibited 87 % similarity (83 % identity). Both ORFs appeared to be homologues of the positional
equivalent in the AlHV-1 genome (ORF A5, 302 amino acids),
since the deduced proteins exhibited similarities of 50 %
(PLHV-1) and 53 % (PLHV-2) to A5. Less similarity was found
to the E6 protein of equine herpesvirus 2 (EHV-2) and the
BILF1 protein of Epstein–Barr virus (EBV). Like A5, E6 and
BILF1, the two PLHV proteins contained seven distinct
hydrophobic regions representing putative transmembrane
domains (not shown). They may function as G protein-coupled
receptors, as discussed previously for A5 of AlHV-1 (Ensser et
al., 1997).
Analysis of feral pigs for the presence of PLHV
sequences
We next investigated whether a natural reservoir for the
PLHVs exists in feral pigs. For this purpose, bone marrow
samples from 19 feral pigs were analysed with different PCR
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DNA polymerase loci of PLHV-1 and -2
Fig. 4. Phylogenetic analysis of the DPOLs of PLHV-1 and -2. A
phylogenetic tree was constructed with the programs Protdist and
Neighbor of the PHYLIP program package (see Methods) by using a
multiple sequence alignment of DPOL sequences of PLHV-1, PLHV-2 (Fig.
3) and other herpesviruses, obtained from GenBank. Gammaherpesvirinae :
AlHV-1 (accession no. AF005370) ; EBV (X00784) ; EHV-2 (U20824) ;
HHV-8 (U75698) ; HVS (X64346) ; MHV-68 (U97553) ; RRV
(AF029302) ; Betaherpesvirinae : CMV (cytomegalovirus l HHV-5,
X17403) ; HHV-7 (U43400) ; MCMV (murine cytomegalovirus, U68299) ;
Alphaherpesvirinae : BoHV-1 (bovine herpesvirus-1, Z78205) ; EHV-1
(M86664) ; HSV-1 (herpes simplex virus type 1 l HHV-1, X04771) ;
PRV (l SuHV-1, L24487) ; VZV (varicella-zoster virus, X04370). The
herpesvirus subfamilies are indicated.
Table 1. PCR analysis of feral pigs for the presence of
PLHV-1 and -2
PCR results were obtained from 19 bone marrow samples.
PCR specificity
Primers*
PHLV-1\PHLV-2
PHLV-1\PHLV-2
PLHV-1
PLHV-1
PLHV-2
170\170
278\276
213\215
170\160
208\212
PCR-positive PCR-negative
19
19
1
2
18
0
0
18
17
1
* Sense and antisense primers are listed before and after the slash,
respectively.
assays (Table 1). All bone marrow samples gave positive
reactions after PCR with primers specific for both PLHVs (pair
170). Differential PCR was performed with the primer pairs
213-S\215-AS or 170-S\160-AS (PLHV-1-specific) and 208-S\
212-AS (PLHV-2-specific). PLHV-2 PCR was strongly positive
in 18 of 19 animals. However, PLHV-1 PCR was only
positive with both primer pairs in the case of the PLHV-2negative animal (F555). In addition, one of the PLHV-2containing samples (F562) reacted weakly with the primer pair
170\160 (but not with the probably less-sensitive pair
213\215). Therefore, sample F562 appeared to be doubly
infected (Table 1). These results were confirmed by sequence
analysis. The sequences obtained from the 18 PLHV-2- and the
two PLHV-1-containing samples showed 100 % identity to the
DPOL genes of PLHV-2 and PLHV-1, respectively, from
domestic pigs. These data suggest that the same virus species
infect domestic as well as feral pigs.
To provide more evidence for this hypothesis, we also
compared the feral and the domestic PLHVs in a region of
lower conservation outside the DPOL gene, by using the
primer pair 278-S\276-AS (Fig. 2 a). All bone marrow samples
gave positive reactions (Table 1). Sequence analysis confirmed
the presence of PLHV-2 in 18\19 samples and of PLHV-1 in
sample F555, without any differences from the PLHV
sequences found in domestic pigs. Only the PLHV-2 sequence
was obtained from the doubly infected sample F562, indicating
the particular presence of PLHV-2.
From the sequence analysis of 700 bp of all feral PLHV
isolates, we concluded that the PLHVs are infectious for
domestic as well as feral pigs, with a particularly high
prevalence of PLHV-2 in feral pigs.
Discussion
The genetic data reported in this study provided compelling evidence for the existence of the novel porcine
lymphotropic gammaherpesviruses PLHV-1 and PLHV-2.
Contiguous sequences spanning approximately 4n6 kbp of
each genome could be successfully amplified by genome
walking from spleen samples that contained less than one viral
genome per cell. The sequences were shown to contain the 3h
end of the glycoprotein B gene, the complete DPOL gene and
an ORF with homology to the A5 gene of AlHV-1.
Comparison of the PLHV DPOLs with those of other
herpesviruses confirmed our previous observation (Ehlers et al.,
1999 b) that the PLHVs are closely related to gammaherpesviruses, in particular to AlHV-1. Furthermore, counterparts of
the PLHV homologue of AlHV-1 A5 could be found in only
two other gammaherpesviruses, EHV-2 and EBV. Therefore,
PLHV-1 and PLHV-2 can be classified as members of the
subfamily Gammaherpesvirinae. In addition, the low GjC
content and the markedly reduced CpG frequency of the PLHV
genomes group the PLHVs with several members of the genus
Rhadinovirus such as herpesvirus saimiri (HVS or SaHV-2),
murine gammaherpesvisus-68 (MHV-68) and AlHV-1, which
exhibit low GjC contents of 35 (HVS) and 46 mol% (AlHV-1,
MHV-68) as well as global CpG suppression (Albrecht et al.,
1992 ; Ensser et al., 1997 ; Virgin et al., 1997). This characteristic
dinucleotide frequency was suggested to be an indicator of the
state of latency of AjT-rich lymphotropic herpesviruses
(Honess et al., 1989).
As proposed previously (Ehlers et al., 1999 b), PLHV-1 and
PLHV-2 are different species rather than merely strains of the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DCAD
S. Ulrich, M. Goltz and B. Ehlers
same species, since the two viruses exhibited 50 amino acid
differences in the DPOL genes. In contrast, strains of the same
gammaherpesvirus species appear to contain no mutations or
only a few, mostly silent, mutations in their DPOL genes, as
shown for the complete DPOL genes of different strains of
human herpesvirus-8 (HHV-8) (Neipel et al., 1998), Tupaia
herpesvirus (Springfeld et al., 1998) and the recently discovered
rhesus monkey rhadinovirus (RRV) (Searles et al., 1999). The
same observation was made with partial DPOL sequences of
strains of several other herpesvirus species from different
subfamilies (VanDevanter et al., 1996 ; Ehlers et al., 1999 a). We
therefore propose the taxonomic names suid herpesvirus-3
(SuHV-3) and suid herpesvirus-4 (SuHV-4) for PLHV-1 and
PLHV-2.
Both PLHVs were found in organs of 19 feral pigs, with an
exceptionally high prevalence of PLHV-2. No differences were
found between the domestic and feral pig sequences, suggesting the presence of the same virus species in domestic and
feral pigs. Therefore, transfer of these viruses between feral and
domestic pig populations might be possible, as has been
reported for PRV (Capua et al., 1997) and classical swine fever
virus (Stadejek et al., 1997). This underlines the need for the
isolated breeding of pigs intended for use as organ donors in
xenotransplantation.
The discovery of the porcine lymphotropic gammaherpesviruses PLHV-1 and PLHV-2 was the result of a search for
unknown herpesviruses in order to unravel risk factors in
xenotransplantation. Therefore, the possible pathogenic potential of the PLHVs, not only for pigs but especially for
immunocompromised humans, is of concern and should be
analysed further. An initial step in this direction was the
comparative analysis of the genetic data acquired so far. It
revealed a close relationship of the PLHVs to the ruminant
gammaherpesviruses AlHV-1, on the basis of analysis of the
complete DPOL gene and the A5 ORF (this study), and ovine
herpesvirus-2 (OvHV-2) and bovine lymphotropic herpesvirus
(BLHV), on the basis of analysis of partial DPOL sequences
(Ehlers et al., 1999 b). AlHV-1 and OvHV-2 cause malignant
catarrhal fever, a lymphoproliferative disease of cattle with
high mortality (Reid & Buxton, 1989), and BLHV has been
discussed as a cofactor in bovine leukaemia (Rovnak et al.,
1998). This suggests possible pathogenicity of the PLHVs.
However, no link has yet been discovered between the PLHVs
and lymphoproliferative or neoplastic diseases. Growth of the
PLHVs in cell culture is a prerequisite for such studies, and such
culture experiments are currently in progress.
A common feature of gammaherpesviruses is the presence
of homologues of cellular genes. They have been found or
predicted to modulate the cell cycle, to regulate apoptosis, to
interfere with immune functions or to function in cytokine
signal transduction. These genes are probably part of the virus
defence mechanisms against elimination by the host and
therefore are likely to contribute to virus virulence (reviewed
by Neipel et al., 1997 ; Simas & Efstathiou, 1998). For this
DCAE
reason, walking on the PLHV-1 genome is continuing to find
such virus virulence genes that may contribute to the
pathogenicity of the PLHVs for human organ recipients in
xenotransplantation.
We thank T. Franz and S. Pociuli for excellent technical assistance, U.
Erikli for help with the manuscript and H. Ellerbrok, Robert Koch-Institut,
and G. Letchworth, University of Wisconsin-Madison, for critical reading.
Organ samples of feral pigs were kindly provided by S. Burckhard
(Institut fu$ r Lebensmittel, Arzneimittel und Tierseuchen, Berlin). The
provision of the PCMV strain B6 by M. Banks (Addlestone, UK) is
gratefully acknowledged.
References
Albrecht, J. C., Nicholas, J., Biller, D., Cameron, K. R., Biesinger, B.,
Newman, C., Wittmann, S., Craxton, M. A., Coleman, H., Fleckenstein,
B. & Honess, R. W. (1992). Primary structure of the herpesvirus saimiri
genome. Journal of Virology 66, 5047–5058.
Allan, J. S., Broussard, S. R., Michaels, M. G., Starzl, T. E., Leighton,
K. L., Whitehead, E. M., Comuzzie, A. G., Lanford, R. E., Leland, M. M.,
Switzer, W. M. & Heneine, W. (1998). Amplification of simian retroviral
sequences from human recipients of baboon liver transplants. AIDS
Research and Human Retroviruses 14, 821–824.
Blanco, L., Bernad, A., Blasco, M. A. & Salas, M. (1991). A general
structure for DNA-dependent DNA polymerases. Gene 100, 27–38.
Breman, J. G., Kalisa-Ruti, Steniowski, M. V., Zanotto, E., Gromyko,
A. I. & Arita, I. (1980). Human monkeypox, 1970–79. Bulletin of the
World Health Organization 58, 165–182.
Britt, W. J. & Alford, C. A. (1996). Cytomegalovirus. In Fields Virology,
3rd edn, vol. 2, pp. 2493–2523. Edited by B. N. Fields, D. M. Knipe &
P. M. Howley. Philadelphia : Lippincott–Raven.
Capua, I., Casaccia, C., Calzetta, G. & Caporale, V. (1997). Characterization of Aujeszky’s disease viruses isolated from domestic animals and
from a wild boar (Sus scrofa) in Italy between 1972 and 1995. Veterinary
Microbiology 57, 143–149.
Ehlers, B., Borchers, K., Grund, C., Fro$ lich, K., Ludwig, H. & Buhk,
H.-J. (1999 a). Detection of new DNA polymerase genes of known and
potentially novel herpesviruses by PCR with degenerate and deoxyinosine-substituted primers. Virus Genes 18, 211–220.
Ehlers, B., Ulrich, S. & Goltz, M. (1999 b). Detection of two novel
porcine herpesviruses with high similarity to gammaherpesviruses.
Journal of General Virology 80, 971–978.
Enserink, M. (1999). New virus fingered in Malaysian epidemic. Science
284, 407–410.
Ensser, A., Pflanz, R. & Fleckenstein, B. (1997). Primary structure of
the alcelaphine herpesvirus 1 genome. Journal of Virology 71, 6517–6525.
Felsenstein, J. (1985). Confidence limits on phylogenies : an approach
using the bootstrap. Evolution 39, 783–791.
Felsenstein, J. (1993). PHYLIP (phylogeny inference package) version
3.5c. Distributed by the author. Department of Genetics, University of
Washington, Seattle, WA, USA.
Feranchak, A. P., Tyson, R. W., Narkewicz, M. R., Karrer, F. M. & Sokol,
R. J. (1998). Fulminant Epstein–Barr viral hepatitis : orthotopic liver
transplantation and review of the literature. Liver Transplantation and
Surgery 4, 469–476.
Fishman, J. A. (1994). Miniature swine as organ donors for man :
strategies for prevention of xenotransplant-associated infections. Xenotransplantation 1, 47–57.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DNA polymerase loci of PLHV-1 and -2
Fishman, J. A. (1997). Xenosis and xenotransplantation : addressing the
infectious risks posed by an emerging technology. Kidney International
Supplementum 58, S41–S45.
Pan troglodytes troglodytes. Nature 397, 436–441.
Neipel, F., Albrecht, J.-C. & Fleckenstein, B. (1997). Cell-homologous
genes in the Kaposi’s sarcoma-associated rhadinovirus human herpesvirus
8 : determinants of its pathogenicity ? Journal of Virology 71, 4187–4192.
Neipel, F., Albrecht, J.-C. & Fleckenstein, B. (1998). Human herpesvirus
8 – the first human Rhadinovirus. Journal of the National Cancer Institute
Monographs 23, 73–77.
Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human
cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282–286.
Reid, H. W. & Buxton, D. (1989). Malignant catarrhal fever and the
Gammaherpesvirinae of Bovidae. In Herpesvirus Diseases of Cattle, Horses
and Pigs, pp. 116–162. Edited by G. Wittmann. Boston : Kluwer.
Holmes, G. P., Chapman, L. E., Stewart, J. A., Straus, S. E., Hilliard,
J. K. & Davenport, D. S. (1995). Guidelines for the prevention and
Rovnak, J., Quackenbush, S. L., Reyes, R. A., Baines, J. D., Parrish,
C. R. & Casey, J. W. (1998). Detection of a novel bovine lymphotropic
Gao, F., Yue, L., White, A. T., Pappas, P. G., Barchue, J., Hanson, A. P.,
Greene, B. M., Sharp, P. M., Shaw, G. M. & Hahn, B. H. (1992). Human
infection by genetically diverse SIVSM-related HIV-2 in west Africa.
Nature 358, 495–499.
Gao, F., Bailes, E., Robertson, D. L., Chen, Y., Rodenburg, C. M.,
Michael, S. F., Cummins, L. B., Arthur, L. O., Peeters, M., Shaw, G. M.,
Sharp, P. M. & Hahn, B. H. (1999). Origin of HIV-1 in the chimpanzee
treatment of B-virus infections in exposed persons. The B virus Working
Group. Clinical Infectious Diseases 20, 421–439.
herpesvirus. Journal of Virology 72, 4237–4242.
Honess, R. W., Gompels, U. A., Barrell, B. G., Craxton, M., Cameron,
K. R., Staden, R., Chang, Y.-N. & Hayward, G. S. (1989). Deviations
Sequence and genomic analysis of a rhesus macaque rhadinovirus with
similarity to Kaposi’s sarcoma-associated herpesvirus\human herpesvirus
8. Journal of Virology 73, 3040–3053.
Siebert, P. D., Chenchik, A. & Kellogg, D. E. (1995). The Human
GenomeWalker DNA Walking Kit : an improved method for walking in
uncloned genomic DNA. CLONTECHniques X (II), 1–3.
Simas, J. P. & Efstathiou, S. (1998). Murine gammaherpesvirus 68 : a
model for the study of gammaherpesvirus pathogenesis. Trends in
Microbiology 6, 276–282.
from expected frequencies of CpG dinucleotides in herpesvirus DNAs
may be diagnostic of differences in the states of their latent genomes.
Journal of General Virology 70, 837–855.
Hudnall, S. D., Rady, P. L., Tyring, S. K. & Fish, J. C. (1998). Serologic
and molecular evidence of human herpesvirus 8 activation in renal
transplant recipients. Journal of Infectious Diseases 178, 1791–1794.
Kadakia, M. P. (1998). Human herpesvirus 6 infection and associated
pathogenesis following bone marrow transplantation. Leukemia &
Lymphoma 31, 251–266.
Knopf, C. W. (1998). Evolution of viral DNA-dependent DNA polymerases. Virus Genes 16, 47–58.
Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pææbo, S.,
Villablanca, F. X. & Wilson, A. C. (1989). Dynamics of mitochondrial
DNA evolution in animals : amplification and sequencing with conserved
primers. Proceedings of the National Academy of Sciences, USA 86,
6196–6200.
McGeoch, D. J., Cook, S., Dolan, A., Jamieson, F. E. & Telford, E. A. R.
(1995). Molecular phylogeny and evolutionary timescale for the family
of mammalian herpesviruses. Journal of Molecular Biology 247, 443–458.
Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K.,
Herden, T. & Steinhoff, G. (1998). Expression of pig endogenous
retrovirus by primary porcine endothelial cells and infection of human
cells. Lancet 352, 692–694.
Michaels, M. G. (1997). Infectious concerns of cross-species transplantation : xenozoonoses. World Journal of Surgery 21, 968–974.
Moretti, T., Koons, B. & Budowle, B. (1998). Enhancement of PCR
amplification yield and specificity using AmpliTaq Gold DNA polymerase. BioTechniques 25, 716–722.
Searles, R. P., Bergquam, E. P., Axthelm, M. K. & Wong, S. W. (1999).
Springfeld, C., Tidona, C. A., Kehm, R., Bahr, U. & Darai, G. (1998).
Identification and characterization of the Tupaia herpesvirus DNA
polymerase gene. Journal of General Virology 79, 3049–3053.
Stadejek, T., Vilcek, S., Lowings, J. P., Ballagi-Pordany, A., Paton,
D. J. & Belak, S. (1997). Genetic heterogeneity of classical swine fever
virus in Central Europe. Virus Research 52, 195–204.
VanDevanter, D. R., Warrener, P., Bennett, L., Schultz, E. R., Coulter,
S., Garber, R. L. & Rose, T. M. (1996). Detection and analysis of diverse
herpesviral species by consensus primer PCR. Journal of Clinical
Microbiology 34, 1666–1671.
Virgin, H. W., IV, Latreille, P., Wamsley, P., Hallsworth, K., Weck, K. E.,
Dal Canto, A. J. & Speck, S. H. (1997). Complete sequence and genomic
analysis of murine gammaherpesvirus 68. Journal of Virology 71,
5894–5904.
Ye, Y., Niekrasz, M., Kosanke, S., Welsh, R., Jordan, H. E., Fox, J. C.,
Edwards, W. C., Maxwell, C. & Cooper, D. K. C. (1994). The pig as a
potential organ donor for man. A study of potentially transferable disease
from donor pig to recipient man. Transplantation 57, 694–703.
Received 19 June 1999 ; Accepted 26 August 1999
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 18:34:31
DCAF