FEMS Microbiology Letters 240 (2004) 21–30
www.fems-microbiology.org
Identification of oligopeptide permease (opp) gene cluster in
Vibrio fluvialis and characterization of biofilm production by
oppA knockout mutation
Eun-Mi Lee a, Sun-Hee Ahn a, Je-Hyun Park a, Jong-Hee Lee a,
Soon-Cheol Ahn b, In-Soo Kong a,*
a
Department of Biotechnology and Bioengineering, Pukyong National University, Busan 608-737, Republic of Korea
Department of Microbiology, Pusan National University College of Medicine, Busan 602-739, Republic of Korea
b
Received 9 June 2004; received in revised form 13 August 2004; accepted 8 September 2004
First published online 22 September 2004
Edited by R.Y.C. Lo
Abstract
Oligopeptides play important roles in bacterial nutrition and signaling. The oligopeptide permease (opp) gene cluster was cloned
from Vibrio fluvialis. The V. fluvialis opp operon encodes five proteins: OppA, B, C, D and F. The deduced amino acid sequence of
these proteins showed high similarity with those from other Gram-negative bacteria. To investigate whether OppA is involved in
biofilm production, an oppA knockout mutant was constructed by homologous recombination. The oppA mutant produced more
abundant biofilm than the wild type in BHI medium. When both strains were grown in minimal medium, we could not detect biofilm
formation. However, it was found that the biofilm productivity of the oppA mutant was two folds greater than that of the wild type
in minimal medium containing peptone or tryptone. This variation in biofilm production was demonstrated by scanning electron
microscopy (SEM). In minimal medium containing C-sources, both strains produced some biofilm without significant difference
in the biofilm productivity. Complementation of oppA gene with the plasmid pOAC2, which contains oppA ORF plus promoter
regions, was sufficient to restore growth rate and biofilm to the wild type. These results suggest that the OppA protein is involved
in uptake of peptides and affects biofilm productivity.
2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Vibrio fluvialis; Oligopeptide permease (Opp) system; OppA mutation; Biofilm
1. Introduction
Vibrio fluvialis is a halophilic human pathogen frequently found in marine environments or marine products. However, relatively little is known about this
organism. V. fluvialis produces several toxins that may
be important in pathogenesis including enterotoxin-like
*
Corresponding author. Tel.: +82 51 620 6185; fax: +82 51 620
6180.
E-mail address: [email protected] (I.-S. Kong).
substance, protease, cytotoxin and hemolysin [1,2]. Usually, Vibrio sp. grow in low nutritive medium environments containing some inorganic salts, such as sea
water. Therefore, the study about the nutrient transport
system is very meaningful in understanding the mechanisms which bacteria survive under nutrient limited
conditions.
Peptides in the medium serve specific biological functions in most bacterial species [3]. When their concentration is sufficiently high, they are then actively
transported into the cell by several transport systems.
0378-1097/$22.00 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2004.09.007
22
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
Peptide transport systems play important roles not only
in the nutrition of a cell but also in various signaling
processes, such as regulation of gene expression, chemotaxis, conjugation and competence development [4]. The
most common transport systems are composed of multicomponent systems including two transmembrane
permease proteins and two ATP-binding proteins.
Moreover, a peptide uptake system utilizes a specific ligand binding protein or receptor to capture the peptide
[5].
The best documented peptide transporters are the
dipeptide permease (Dpp), tripeptide permease (Tpp)
and the oligopeptide permease (Opp) systems from Escherichia coli [6] and Salmonella typhimurium [7,8].
Whereas the di- and tripeptide transport systems are
thought to serve alternative roles such as regulation of
genes involved in nitrogen metabolism, the Opp system
is considered to be essential for nutrition [3]. Among
these transport systems, the Opp system was classified
as belonging to the family of ATP-binding cassette
(ABC) transporters, which hydrolyze ATP to drive
transport [9]. The Opp system is comprised of 5 subunits: a periplasmic binding protein (OppA), two transmembrane proteins (OppB and OppC) believed to form
a channel for passage of the substrate, and two membrane-associated cytoplasmic ATPases (OppD and
OppF). Experiments with amino acid auxotropic strains
of E. coli have shown that the Opp system is able to
transport peptides from 2 to 5 amino acid residues, composed of a variety of natural and/or modified residues
[3]. However, a biochemical study of peptide transport
system in Vibrio sp. was not reported.
In this study, we identified the opp gene cluster of V.
fluvialis and constructed an oppA mutant. The role of
the oligopeptide transport system from V. fluvialis was
investigated by comparing growth rates and biofilm production between the wild-type strain and the oppA mutant under various physiological conditions. Also, we
observed a significant variation of biofilm production
in the strains by scanning electron microscopy (SEM).
2. Materials and methods
2.1. Bacterial strains and growth conditions
V. fluvialis KCTC2473, corresponding to ATCC33809, was acquired from the Korean Collection for
Type Cultures and used as the parent strain for the derivation of the oppA mutant. For construction of the
genomic DNA library, E. coli XLI Blue (Stratagene,
La Jolla, CA) was used as a host, and E. coli SM10 kpir
was used as the donor cell for construction of the oppA
mutant [10]. Unless otherwise indicated, V. fluvialis
wild-type strain and mutant strain were grown in brain
heart infusion (BHI), and all E. coli strains were grown
in Luria–Bertani (LB) at 37 C with shaking. The media
components were purchased from Difco (Detroit, MI).
Artificial sea water (ASW) was used as the defined medium containing 423 mM NaCl, 9 mM KCl, 9.3 mM CaCl2 Æ 2H2O, 22.9 mM MgCl Æ 6H2O, 25.5 mM
MgSO4 Æ 7H2O and 2.1 mM NaHCO3. Where appropriate, chloramphenicol (20 lg ml1), ampicillin (100 lg
ml1), tetracycline (5 lg ml1) and kanamycin (10 lg
ml1) were added to the medium. Chemical reagents
and antibiotics were, if not otherwise specified, purchased from Sigma (St. Louis, MO).
2.2. DNA manipulation
The cloning vector pGEM4Z and pUC19 (Promega,
Madison, WI) were used to generate a genomic DNA library from V. fluvialis. To construct the DNA library,
chromosomal DNA was isolated from V. fluvialis and
completely or partially digested with each restriction enzyme. The resulting fragments were inserted into the
multiple cloning site of pUC19 or pGEM4Z. Ligation
was performed by T4 DNA ligase at 16 C for overnight
and introduced into competent E. coli XLI Blue cells
prepared with 100 mM CaCl2. Correct insertion into
the recombinant plasmid was confirmed by restriction
mapping and PCR analysis. To screen for the opp gene
cluster, colony hybridization and Southern hybridization were performed as described previously [11]. Colonies or enzymatically digested DNA fractions were
transferred to a nitrocellulose membrane by capillary
transfer (MSI, Westborough, MA), and hybridized for
overnight with each gene specific probe at 68 C in 15
ml final volume. The probes used for hybridization were
labeled using the DIG DNA labeling system, according
to the instructions of the manufacturer (Roche Molecular Biochemicals, Indianapolis, IN). Blots were visualized using Anti-Dig-AP-Fab fragments (Roche) and
NBT/BCIP in detection buffer (100 mM NaCl and 100
mM Tris–HCl, pH 9.5). Plasmid, chromosomal DNA
and PCR products were isolated using the appropriate
purification kit (Nucleogen, Inc., Ansan, Korea). DNA
ligation, transformation, electrophoresis, and PCR
amplification were carried out by using standard techniques. Restriction enzymes, T4 DNA ligase and Taq
polymerase were purchased from Promega.
2.3. Primer extension
Primer extension analysis was performed as described
previously [12]. Total cellular RNA from V. fluvialis was
isolated by using Trizol (Gibco-BRL, Gaithersburg,
MD) in accordance with the manufacturers protocol.
To determine the transcriptional start site, rapid amplification of 5 0 cDNA ends (RACE: Invitrogen, San
Diego, CA) was performed. Briefly after reverse transcription with the primer (5 0 -GCAAGGTGCTT-
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
CACGTTCGC-3 0 ), the cDNA was 3 0 dC tailed and
PCR amplification was performed with the universal
amplification primer (5 0 -CUACUACUACUAGGCCAGGCGTCGACTAGTAC-3 0 ) and the gene specific
nested primer (5 0 -GCAAATCGCGGATAACG-3 0 ).
The resulting products were subsequently sequenced.
2.4. Analysis of DNA and amino acid sequence
The nucleotide sequences of the opp operon were
determined using the Dye terminator reaction, and samples were analyzed on Base Station (MJ research, Inc.,
Waltham, MA). The GENETYX-WIN DNA sequence
analysis software system (Software Development Co.,
Tokyo, Japan) and BLAST network server of the National Center for Biotechnology Information (National
Institutes of Health, Bethesda, MD), GeneDoc (Free
Software Foundation, Inc., USA) and Clustal W program were used to analyze the nucleotide sequence
and deduce the amino acid sequences in determining
similarities with previously reported sequences in GenBank. The primary sequence motifs were identified using
the PROSITE network server at EMBL. The average
hydrophobicity profiles of OppB and OppC were obtained by the method of Kyte and Doolittle [13].
2.5. Construction of knockout mutant
The oppA mutation was constructed by using the
homologous recombination method as previously described [11]. A 0.5 kb fragment of oppA was amplified
by PCR using upstream primer (5 0 -GGCCGTCGACGACTTACCTGCCGATTG-3 0 ; the underlined
bases encode a SalI site) and reverse primer (5 0 -GGCCthe
GAGCTCCTCTTGGTTTTCTAGCGCTAC-3 0 ;
underlined bases encode a SacI site) and inserted into
pNQ705. This recombinant plasmid, named pOA1,
was introduced to conjugal donor E. coli SM10 kpir.
Conjugation was carried out between the recipient V.
fluvialis and donor strain E. coli containing the pOA1
plasmid. A conjugant carrying a single-crossover mutation of oppA was obtained by selection on thiosulfate citrate bile salts (TCBS) agar containing chloramphenicol,
and confirmed by PCR analysis and Southern
hybridization.
23
digested by BamHI and EcoRI and ligated into the
broad host range vector pRK415 restricted by same enzyme [14]. This recombinant plasmid, pOAC2, was
transformed into E. coli SM10 kpir, and introduced into
the oppA mutant by conjugation. The oppA complemented strain was selected by TCBS agar containing
chloramphenicol and tetracycline, and confirmed by
PCR analysis.
2.7. Biofilm assay
The biofilm formation assay used is based on the
modified method of Bomchil et al. [15]. Cells from overnight colonies grown on BHI agar plates at room temperature were resuspended in BHI broth at 600 nm
(OD600) of 0.4. Three microliters of the cell suspension
was added to 300 ll of BHI broth in 75 mm borosilicate
glass tubes (Chase Scientific Glass, Rockwood, TE).
Cultures were incubated at 37 C without shaking for
the required times. At the desired end-point, tubes were
rinsed with distilled water for removing the non-adherent cells. Biofilms were stained by the addition of 350
ll of 1% crystal violet for 25 min followed by rinsing
with distilled water. The cell-associated dye was solubilized in 400 ll of dimethyl sulfoxide (DMSO) and quantified by measuring the OD570 of the resulting solution.
Each assay was performed in triplicate.
2.8. Scanning electron microscopy (SEM)
The V. fluvialis wild-type strain and the oppA mutant
were incubated in borosilicate glass tubes in BHI broth
at 37 C for 24 h. The planktonic cells were removed and
the tubes were rinsed with sterile water. The resulting
biofilms were fixed with 2.5% glutaraldehyde in 0.1 M
phosphate-buffered saline (PBS) for 1 h, rinsed with
0.1 M PBS, and dehydrated with 90%, 95%, and 100%
ethanol for 10 min each and isoamyl acetate for 1 h.
The glass tubes were cut and coated with gold ion. Samples were examined with an electron microscope DSM
640 (Carl Zeiss, Oberkochen, Germany).
2.9. Accession number
The nucleotide sequence of the opp operon has been
deposited in GenBank under Accession No. AY566268.
2.6. Complementation of oppA
To confirm the effect on biofilm productivity caused
by the oppA mutation, complementation of oppA gene
was performed. An oppA gene, including the oppA promoter based on primer extension result, was amplified
with primer oppA up-c2 (GGCCGGATCCTGTCATCTGACG, BamHI site is underlined) and oppA
rp-c2 (GGCCGAATCCAGGAATTACTGAGCTTT,
EcoRI site is underlined). The resulting products were
3. Results
3.1. Cloning of opp gene cluster
A 0.4-kb BamHI fragment containing a partial oppF
gene was previously cloned from a V. fluvialis DNA
library in our laboratory. To isolate the complete opp
operon, chromosomal DNA of V. fluvialis was digested
24
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
with HindIII and ligated with pUC19. After construction of the DNA library, colony hybridization was carried out using the 0.4-kb BamHI fragment of oppF as a
probe (Probe1). Plasmid pVFH195 purified from a positive clone contained a 15.7-kb insert which bears a partial oppA and complete oppB, oppC, oppD and oppF
genes. To clone the complete oppA ORF sequence,
Southern hybridization was performed using Probe2.
Probe2 containing a 0.6 kb fragment of the 5 0 end of
the pVFH195 insert was prepared by PCR amplification
using Primer1 (5 0 -CAACAGCTCAAACGACCAG-3 0 )
and Primer2 (5 0 -GTCACCCTGCAGGATGTTGG-3 0 ).
We detected a 4.3-kb SalI fragment by Southern hybridization. SalI-treated DNA was separated by agarose gel
electrophoresis, and DNA in the range 4–6 kb was purified and ligated to SalI-treated pGEM4Z. The ligation
products were transformed into E. coli XLI Blue and
colony hybridization was performed using Probe2. Plasmid pVFOPA3 containing the complete oppA ORF and
a partial oppB gene was isolated. From these clones, we
determined the nucleotide sequence of opp operon from
V. fluvialis. Fig. 1 shows the gene organization and the
restriction map of opp operon.
3.2. Analysis of DNA and amino acid sequence
The V. fluvialis opp operon consists of five ORFs:
OppA, OppB, OppC, OppD and OppF. The amino acid
sequences and the gene order are highly similar to previously characterized Opp proteins of other bacteria especially those of Gram-negative bacteria (Table 1). The
intercistronic regions of between oppA and oppB, oppB
and oppC, oppC and oppD were 100, 15 and 27 bp,
respectively. The 3 0 end of oppD and the 5 0 end of oppF
overlapped. This gene organization is common in opp
operon of other bacteria such as S. typhimurium and
Lactococcus lactis [8,16].
OppA, the substrate-binding proteins or receptors of
ABC transporters, generally determine the substrate
specificity of the system. In Gram-negative bacteria,
the binding proteins are located in the periplasm, while
in Gram-positive bacteria, they are anchored to the cell
membrane via a N-terminal lipid moiety or fusion of the
binding protein to the translocator domain [5]. V. fluvialis OppA protein is composed of 543 amino acid residues with molecular mass of 61 kDa. V. fluvialis
OppA has 85% identity with OppA protein of V. cholerae and 53–55% identities with OppA proteins of E.
coli, S. typhimurium and Yersinia pestis [6,8,17]. The
amino acid sequences of OppA proteins showed relatively lower homology in the N-terminal and C-terminal
ends.
OppB and OppC are permease proteins and consist
of 306 and 302 amino acids, respectively. These proteins
are composed of 65% and 64% hydrophobic amino acid
residues. The hydrophobic amino acid residues are concentrated in specific regions in these proteins. These regions were reported as membrane spanning regions of
OppB and OppC [18], and were similar to several integral inner membrane proteins of transporter systems
involving periplasmic binding proteins in E. coli such
as HisQ, HisM, MalG, MalF, PstC and PstA. In addition, short hydrophilic sequences were at a distance of
80–90 amino acid residues from the C-terminus [8,18].
There is about 37% homology between OppD and
OppF which are ATP-binding proteins. These proteins
are composed of 324 and 335 amino acid residues,
respectively. These proteins have Walker A ([AG]-X4G-K-[ST]) and Walker B (hhhD) ATP-binding motifs.
These motifs are found not only in ATP-binding proteins of the Opp system, but also in adenine and guanine
nucleotide binding proteins such as guanylate kinase,
protein kinase, protein Ras, adenylate kinase and elongation factor EF-Tu [19]. There is an intervening section
between the Walker boxes called the C-motif or LSGGQ
motif, consists of 12 residues usually starting with
LSGGQ. Because it is present in all ABC subunits,
but usually not in other ATPases, it also called the signature motif [20].
To identify the transcriptional start site of the opp operon, 5 0 -RACE PCR was performed. A single band was
observed after primer extension (Fig. 2). The transcriptional start site is located 331 bp upstream from the
translational start codon of oppA. There are TAAATT
and TAGACG sequences at positions 10 and 35
from the transcriptional start site, respectively, sepa-
Fig. 1. Genetic organization of the opp ORFs from V. fluvialis. Restriction map of opp region. S, SalI; C, SacI; P, PstI; B, BamHI; H, HindIII; V,
PvuII. Bars show the recombinant plasmid DNAs for the cloningstrategy of the opp genes.
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
25
Table 1
The comparison of amino acid sequence of Opp system. Sequences are from V. cholerae (OppA, AAF94250; OppB, AAF94251; OppC, AAF94252;
OppD, AAF94253; OppF, AAF94254), E. coli (OppA, AAC74325; OppB, AAC74326; OppC, AAC74327; OppD, AAC74328; OppF, AAC74329),
S. typhimurium (OppA, CAA29039; OppB, CAA29040; OppC, CAA29041; OppD, CAA29042; OppF, CAA29043), and Y. pestis (OppA,
CAC90989; OppB, CAC90990; OppC, CAC90991; OppD, CAC90992; OppF, CAC90993)
Amino acids
Strains
Identity (%)
OppA
OppB
OppC
OppD
OppF
V. fluvialis
543 aa
306 aa
300 aa
324 aa
330 aa
V. cholerae
543 aa
85
306 aa
92
300 aa
94
324aa
95
336 aa
91
E. coli
543 aa
55
306 aa
67
302 aa
69
337 aa
76
334 aa
73
S. typhymurium
542 aa
54
306 aa
66
302 aa
69
335 aa
76
334 aa
73
Y. pestis
545 aa
53
306 aa
67
301 aa
69
333 aa
76
333 aa
73
Fig. 2. Primer extension analysis of oppA. Agarose gel electrophoresis of 5 0 -RACE PCR product (left) and sequence of oppA upstream region (right).
Transcriptional start site was indicated by arrows. Possible promoters (10 and 35) was shown underlined. Deduced ribosome site on the
transcribed mRNA was in squared and the ATG translational initiation codon was indicated in bold type.
rated by 17 bp. This profile closely resembles the consensus promoter sequence of E. coli.
3.3. Construction of an oppA knockout mutant of
V. fluvialis
A standard suicide vector method was used to insertionally inactivate the oppA gene of the wild-type V. fluvialis strain. The insertional disruption of oppA in the
mutant was confirmed by PCR and Southern blot analysis. When the PvuII digested genomic DNA of wildtype strain was hybridized with the internal coding
sequence probe which has SalI and SacI fragment of
the oppA gene, a 1.3-kb fragment was observed. The
oppA mutant showed 2.8 and 1.0 kb hybridizing fragments, which can be followed by loss of the original
chromosomal fragment carrying the oppA ORF with
its replacement by two new fragments (Fig. 3(a)). To
confirm the Southern hybridization result, PCR analysis
was performed with upstream primer (5 0 -CGTAAGATGCGAAATGGTC-3 0 ) based on the chromosomal
DNA sequence and reverse primer (5 0 -GTGGACAACAAGCCAGGG-3 0 ) based on the downstream
sequence of suicide vector pNQ705. In Fig. 3(b), the
1.0-kb fragment was present in the oppA mutant
(lane 2), while the wild type (lane 1) did not amplify a
product.
3.4. Growth in rich medium and minimal medium
To investigate whether the oppA mutation in V. fluvialis influences growth, the wild-type and the oppA mutant strain were cultured in BHI medium. As shown in
Fig. 4, the wild-type and the oppA mutant reached
26
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
thought that the oligopeptide limitation may be complemented by another transport system for nitrogen
uptake. We have identified several amino acid ABCtransporter genes, putative peptide transporter genes,
and the oligopeptide transporter gene in theV. cholerae
genome [21]. The opp gene of V. fluvialis showed a high
homology with that of V. cholerae. Therefore, it is possible that V. fluvialis has another peptide transport system besides Opp like as transport system in V. cholerae.
3.5. Comparison of biofilm production in wild-type strain
and oppA mutant
Fig. 3. Construction of the V. fluvialis oppA mutant by insertional
mutagenesis. (a) Southern blot analysis of oppA mutant. Genomic
DNAs from V. fluvialis strain KCTC 2473 (lane 1) and oppA mutant
(lane 2) were digested with PvuII and hybridized to a DIG-labeled
DNA probe consisting of a SalI–SacI fragment internal to the oppA
coding sequence. (b) Agarose gel electrophoresis analysis of PCR
products. M, Molecular size marker (HindIII-digested kDNA); lane 1,
V. fluvialis KCTC 2473; lane 2, oppA mutant.
stationary phase in 4 and 6 h, and the specific growth
rates were 1.64 and 0.95 h1, respectively. The specific
growth rate of the oppA complemented strain was 1.31
h1, corresponding only 80% level of wild type. Growth
was also compared using a chemically defined medium,
ASW containing 0.5% glucose as a carbon source. In
ASW, the specific growth rate of the wild-type and oppA
mutant were 0.77 and 0.76 h1, respectively. Overall
growth of both strains in ASW was lower than in BHI
medium. However, there was no difference in growth between the wild-type strain and mutant in ASW, unlike
that in BHI. This result suggests that slow growth of
the oppA mutant may be caused by decreased ability
for oligopeptide uptake in BHI medium, because there
is no organic nitrogen source to use in ASW medium.
The cultures are in stationary phase after 6 h. It is
Fig. 4. Growth curve in BHI (solid line) and ASW (dotted line).
Closed circles represent the V. fluvialis wild-type, open circles represent
the oppA mutant.
We examined whether the oppA mutant exhibit a difference in biofilm productivity. Planktonic cell growth
and biofilm development by V. fluvialis wild-type and
the oppA mutant in BHI are shown in Fig. 5. Cell numbers of both strains reached a maximum after 2 h, and
then remained for 12 h, but planktonic cell number of
the wild-type was 10-fold higher than the oppA mutant.
In contrast, biofilm productivities of the wild-type and
the oppA mutant in BHI medium increased rapidly after
4 h, and reached a maximal optical density of 0.2 and
0.4 at 6 h, respectively. In addition, when both strains
were cultured in another rich medium, LB broth, biofilm
productivity of the oppA mutant was also higher than
that of wild-type. When the cells were grown in glass
tube without shaking, the cell number of oppA mutant
at the planktonic phase was lower than that of wild type,
while the biofilm productivity of oppA mutant was
higher than that of wild type. The oppA complemented
strain showed lower level of the biofilm production than
the oppA mutant, but revealed 13% higher than the biofilm productivities of wild type (data not shown). These
data suggested that the presence and absence of oppA
gene affect the biofilm productions.
Fig. 5. Planktonic cell growths and biofilm productions over time of
the V. fluvialis wild-type (closed circle) and the oppA mutant (open
circle) in BHI broth. The solid lines represent growth of the planktonic
populations and the dotted lines are biofilm formation on the
borosilicate glass tube.
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
27
Table 2
Biofilm production on different surfaces. Each value refers means ± SD
of three independent tests
Strains
Wild type
oppA mutant
Fig. 6. Biofilm productivities in defined medium (ASW) supplemented
by different nitrogen sources (a) and (b) different levels of NaCl
concentration (b) in BHI (P < 0.05). White bars represent the wild-type
and gray bars represent the oppA mutant strain (CA, casamino acid;
TR, tryptone; PE, peptone; YE, yeast extract; BE, beef extract).
Biofilm productivities of both strains were examined
in defined medium, ASW, containing 0.5% of glucose,
sucrose, galactose, mannose, or maltose. Biofilm productivity in ASW containing 0.5% glucose was the highest among the various carbon sources, although no
difference was shown between the wild-type and the
oppA mutant strain (data not shown). Likewise, there
was no difference between the wild-type and the mutant
in biofilm production in ASW supplemented with the
other carbon sources tested. This suggests that V. fluvialis can readily utilize these carbon sources. To examine
whether biofilm productivity is influenced by nitrogen
source in the oppA mutant, we tested biofilm productivity with ASW containing 2% of casamino acid, tryptone,
peptone, yeast extract, or beef extract. Biofilm productivities of the oppA mutant in ASW containing either
peptone or tryptone were higher than the wild-type
(Fig. 6(a)). Peptone is a major nitrogen component of
BHI broth. This could explain why biofilm productivity
was increased in the oppA mutant in BHI medium. We
also observed a relationship between biofilm productiv-
Surface
Glass
PP
PS
0.20 ± 0.05
0.4 ± 0.04
0.057 ± 0.03
0.15 ± 0.02
0.14 ± 0.05
0.21 ± 0.04
ity and NaCl concentration in BHI medium (Fig. 6(b)).
Biofilm productivities remained steady up to 2% NaCl.
However, biofilm productivity was reduced when
NaCl concentration was increased to 4%. Regardless
of NaCl concentration, the oppA mutant produced more
biofilm than the wild-type.
To investigate whether the biofilm formation from V.
fluvialis is limited in the glass surfaces, we tested the ability of both strains for biofilm formation on other surface
materials using polypropylene (PP) microcentrifuge tube
and U-bottom polystyrene (PS) 96-well plate. In both
case, PP and PS, the biofilm productivities of the oppA
mutant were higher than that of the wild-type strain like
the pattern of biofilm formation on glass surface of both
strains (Table 2). And the biofilm formations on the relatively hydrophobic (PP, PS) surfaces were decreased
than that on the relatively hydrophilic surfaces (borosilicate glass) and the biofilm productivity of the oppA mutant was higher than the wild-type in each case.
To compare the cell morphology and extracellular
matrix, SEM analysis was used. The wild-type biofilm
consisted of aggregated V. fluvialis cells and a small
amount of that material was detected on the cell surfaces
(Fig. 7(a)). In contrast, biofilm of the oppA mutant was
composed of more accumulated cells and covered with
the materials seemed to be segments of the exopolymeric
biomaterials. Also, the oppA mutant increased co-aggregation as compared with the wild-type strain (Fig. 7(b)).
These data suggest that knockout of the oppA gene results in the overproduction of some extracellular polymeric substance that accumulates within the matrix of
mutant biofilm.
4. Discussion
The Opp system is important for the uptake of oligopeptides from growth medium [3] and for supplying a
nitrogen source by recycling the cell wall peptides for
synthesis of new peptidoglycan [22]. Recently, it was reported that the Opp systems in a variety of bacteria have
different functions. The Opp system is involved in competence stimulation and sporulation in Bacillus subtilis
[23,24], induction of intracellular aggregation in Enterococcus faecalis [25], and the signaling process of peptide
taxis in E. coli and S. typhymurium [4]. Inactivation of
the Opp system in Streptococcus pneumoniae affects
adherence to human lung cell [26].
28
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
Fig. 7. SEM micrographs of biofilm produced from V. fluvialis wildtype (a) and oppA mutant (b) on borosilicate glass tubes after 24 h of
inoculation. Magnification is shown by the bar (1 lm, ·1000 and insets
are 2 lm, ·5000).
In this study, we showed that the opp gene cluster of
V. fluvialis contains five genes: oppA, oppB, oppC, oppD
and oppF. The overall homology of the Opp amino acid
sequence is most similar to the V. cholerae Opp system.
In V. fluvialis, OppB, OppC, OppD and OppF displayed
high homologies >70% with several bacterial Opp proteins, while the OppA protein had relatively low homology to other OppA proteins. This suggests that OppA, a
peptide binding protein, may exhibit substrate specificity. It has been reported that OppA proteins in various
bacteria have not only substrate-binding ability but
other biochemical functions as well.
To investigate the role of oppA in V. fluvialis, we performed mutation in oppA of V. fluviails by homologous
recombination, and then biofilm productivity of oppA
mutant was compared to wild-type strain. When each
strain was cultured on BHI medium, biofilm formation
of the wild-type strain and the oppA mutant began in
stationary phase. During from 6 to 60 h, biofilm production in the two strains remained at a constant level but
the oppA mutant had higher productivity than the
wild-type strain. Since the main nitrogen source in
BHI medium is 1% peptone, we suspected that V. fluvialis utilizes peptone as the essential nitrogen source and
alters biofilm production by Opp the system. To clarify
these observations, the wild-type strain and the oppA
mutant were cultured in ASW defined medium supplemented with peptone. As with BHI medium, biofilm
productivity of the oppA mutant was higher than the
wild-type (Fig. 5). On the other hand, planktonic cell
growth of the oppA mutant was slower than the wildtype strain. These results were similar to those of E. coli
O157:H7 in biofilm formation and growth rate [27]. And
as shown in Fig. 7, it was observed that V. fluvialis oppA
mutant increased co-aggregation using electronic
microscopy.
The same growth results were observed in LB medium, which contains tryptone as the main nitrogen
source (data not shown). However, when both strains
were cultured in ASW supplemented with casamino
acid, yeast extract, or beef extract instead of peptone
or tryptone, biofilm productivities were identical in the
wild-type and mutant strains. The biofilm productivities
in ASW containing 0.5% glucose were the highest
among the various carbon sources, but there was no difference in biofilm production of both strains unlike that
in medium containing peptone or tryptone as a nitrogen
source (data not shown). Therefore this suggests that the
OppA of V. fluvialis utilizes oligopeptides existing in
peptone or tryptone, and this brings on a change in biofilm productivity by the oppA mutant.
Limitation of nutrient elements such as carbon and
nitrogen may have profound effects on the cell surface
composition of bacteria [28]. In Pseudomonas aeruginosa, it has been reported that surface properties are affected by different mediums and growth conditions [29].
The effects of limitating carbon and nitrogen sources in
nutrient showed that adhesion of P. aeruginosa was not
influenced by carbon source. But the synthesis of alginate for exopolysaccharide and production of mucoid
colonies were increased under nitrogen-limited conditions. OppA proteins have the important roles for the
uptake of nitrogen source from medium. Therefore,
lacking of oppA induces decrease of oligopeptide concentration for bacterial availability in cytoplasm, so that
nitrogen-limited condition may affect biofilm formation.
According to Helinck et al. [30], the cell wall proteinase
PrtP of L. lactis is involved in the first step of casein
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
utilization. The action of proteinase on caseins results in
the release of oligopeptides which plays a crucial role for
the amino acid supply. Recently, in Treponema denticola
which is a major aetiological organism in the onset of
periodontal disease, lacking of the PrtP protein for
chymotrypsin-like protease that is one of components
associated with outer sheath showed an increased ability
to form mixed biofilms [31]. At present, we cannot explain the exact reason why V. fluvialis oppA mutant
formed much more biofilm compared to the wild-type
strain in the medium containing the specific nitrogen.
However, it has been known that biofilm formation of
bacteria depends on the activation or repression by environmental factors of genes which are involved in adhesion, quorum sensing, and stress response [32]. Future
work in our laboratory is being carried out to investigate
the effects on transcriptions of genes for biofilm formation in V. fluvialis.
[11]
[12]
[13]
[14]
[15]
[16]
[17]
Acknowledgements
This work was supported by Grant No. R05-2002000-00653-0 from the Basic Research Program of the
Korea Science & Engineering Foundation. E.M.L.
and S.H.A. are recipients of graduate student fellowships of the Brain Korea 21 Project and BB 21
Project.
References
[1] Wall, V.W., Kreger, A.S. and Richardson, S.H. (1984) Production
and partial characterization of a Vibrio fluvialis. Infect. Immun.
46, 773–777.
[2] Han, J.H., Lee, J.H., Choi, Y.H., Park, J.H., Choi, T.J. and
Kong, I.S. (2002) Purification, characterization and molecular
cloning of Vibrio fluvialis hemolysin. Biochim. Biophys. Acta
1599, 106–114.
[3] Payne, J.W. and Smith, M.W. (1994) Peptide transport by
microorganisms. Adv. Microb. Physiol. 36, 1–80.
[4] Detmers, F.J.M., Lanfermeijer, F.C. and Poolman, B. (2001)
Peptides and ATP binding cassette peptide transporters. Res.
Microbiol. 152, 245–258.
[5] Higgins, C.F. (1992) ABC transporters: from microorganisms to
man. Annu. Rev. Cell Biol. 8, 67–113.
[6] Manson, M.D., Blank, V., Brade, G. and Higgins, C.F. (1986)
Peptide chemotaxis in E. coli involves the Tap signal transducer
and the dipeptide permease. Nature 321, 253–256.
[7] Hiles, I.D., Powell, L.M. and Higgins, C.F. (1987) Peptide
transport in Salmonella typhimurium: molecular cloning and
characterization of the oligopeptide permease genes. Mol. Gen.
Genet. 206, 101–109.
[8] Hiles, I.D., Gallagher, M.P., Jamieson, D.J. and Higgins, C.F.
(1987) Molecular characterization of oligopeptide permease of
Salmonella typhimurium. J. Mol. Biol. 195, 125–142.
[9] Tam, R. and Saier, M.H. (1993) Structural, functional, and
evolutionary relationships among extracellular solute-binding
receptors of bacteria. Microbiol. Rev. 57, 320–346.
[10] Miller, V.L. and Mekalanos, J.J. (1988) A novel suicide vector
and its use in construction of insertion mutations: osmoregulation
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
29
of outermembrane proteins and virulence determinants in Vibrio
cholerae requires toxR. J. Bacteriol. 170, 2575–2583.
Kim, S.H., Ahn, S.H., Lee, J.H., Lee, E.M., Kim, N.H., Park,
K.J. and Kong, I.S. (2003) Genetic analysis of phosphomannomutase/phosphoglucomutase from Vibrio furnissii and characterization of its role in virulence. Arch. Microbiol. 180, 240–250.
Kakuda, T., Dishi, D., Tsubaki, S. and Takai, S. (2003) Cloning
and characterization of the fur gene from Moraxella bovis.
Microbiol. Immunol. 47, 411–417.
Kyte, J. and Doolittle, R.F. (1982) A simple method of displaying
the hydrophobic character of protein. J. Mol. Biol. 157, 105–132.
Keen, N.T., Tamaki, S., Kobayashi and Trollinger, D. (1988)
Improved broad-host-range plasmids for DNA cloning in Gramnegative bacteria. Gene 70, 191–197.
Bomchil, N., Watnick, P. and Kolter, R. (2003) Identification and
characterization of Vibrio cholerae gene, mbaA, involved in
maintenance of biofilm architecture. J. Bacteriol. 185, 1384–1390.
Tynkkynen, S., Buist, G., Kunji, E., Kok, J., Poolman, B.,
Venema, G. and Haandrikman, A. (1993) Genetic and biochemical characterization of the oligopeptide transport of Lactococcus
lactis. J. Bacteriol. 175, 7523–7532.
Parkhill, J., Wren, B.W., Thomson, N.R., Titball, R.W., Holden,
M.T.G., Prentice, M.B., Sebaihia, M., James, K.D., Churcher, C.,
Mungall, K.L., Baker, S., Basham, D., Bentley, S.D., Brooks, K.,
Cerdeno-Tarraga, A.M., Chillingworth, T., Cronin, A., Davies,
R.M., Davis, P., Dougan, G., Feltwell, T., Hamlin, N., Holroyd,
S., Jagels, K., Leather, S., Karlyshev, A.V., Moule, S., Oyston,
P.C.F., Quail, M., Rutherford, K., Simmonds, M., Skelton, J.,
Stevens, K., Whitehead, S. and Barrell, B.G. (2001) Genome
sequence of Yersinia pestis the causative agent of plaque. Nature
413, 523–527.
Pearce, S.R., Mimmack, M.L., Gallagher, M.P., Gileadi, U.,
Hyde, J.C. and Higgins, C.F. (1992) Membrane topology of the
integral membrane components, OppB and OppC, of the oligopeptide permease of Salmonella typhimurium. Mol. Microbiol. 6,
47–57.
Walker, J.E., Saraste, M., Runswick, M.J. and Gay, N.J. (1982)
Distantly related sequences in a- and b-subunits of ATP synthase,
myosin, kinase and other ATP-requiring enzymes and a common
nucleotide-binding fold. EMBO J. 1, 945–951.
Holland, I.B. and Blight, M.A. (1999) ABC-ATPase, Adaptable
energy generators fuelling transmembrane movement of a variety
of molecules in organisms from bacteria to humans. J. Mol. Biol.
293, 381–399.
Heidelberg, J.F., Eisen, J.A., Nelson, W.C., Clayton, R.A.,
Gwinn, M.L., Dodson, R.J., Haft, D.H., Hickey, E.K., Peterson,
J.D., Umayam, L.A., Gill, S.R., Nelson, K.E., Read, T.D.,
Tettelin, H., Richardson, D., Ermolaeva, M.D., Vamathevan, J.,
Bass, S., Qin, H., Dragoi, I., Sellers, P., McDonald, L., Utterback,
T., Fleishmann, R.D., Nierman, W.C., White, O., Salzberg, S.L.,
Smith, H.O., Colwell, R.R., Mekalanos, J.J., Venter, J.C. and
Fraser, C.M. (2000) DNA sequence of both chromosomes of the
cholera pathogen Vibrio cholerae. Nature 406, 477–483.
Goodell, E.W. and Higgins, C.F. (1987) Uptake of cell wall
peptides by Salmonella typhimurium and Escherichia coli. J.
Bacteriol. 169, 3861–3865.
Solomon, J.M., Magnuson, R., Srivastava, A. and Grossman,
A.D. (1995) Convergent sensing phathways mediate response to
two extracellular competence factors in Bacillus subtilis. Genes
Dev. 9, 547–558.
Rudner, D.Z., LeDeaux, J.R., Ireton, K. and Grossman, A.D.
(1991) The Spo0K locus of Bacillus subtilis is homologous to
oligopeptide permease locus and is required for sporulation and
competence. J. Bacteriol. 173, 1388–1398.
Leonard, B.A., Podbileski, A., Hedberg, P.J. and Dunny, G.M.
(1996) Enterococus faecalis pheromone binding protein, PrgZ,
recruits a chromosomal oligopeptide permease system to import
30
E.-M. Lee et al. / FEMS Microbiology Letters 240 (2004) 21–30
sex pheromone cCF10 for induction of conjugation. Proc. Natl.
Acad. Sci. USA 93, 260–264.
[26] Cundell, D.R., Pearce, B.J., Samderls, J., Naughton, A.M. and
Masure, H.R. (1995) Peptide permease from Streptococcus
pneumoneae affect adherence to eukaryotic cells. Infect. Immun.
63, 2493–2498.
[27] Dewanti, R. and Wong, A.C.L. (1995) Influence of culture
conditions on biofilm formation by Escherichia coli O157:H7. Int.
J. Food Microbiol. 26, 147–164.
[28] Stanley, N.R. and Lazazzera, B.A. (2004) Environmental signals
and regulatory pathways that influence biofilm formation. Mol.
Microbiol. 52, 917–924.
[29] Cowell, B.A., Willcox, M.D.P., Herbert, B. and Schneider, R.P.
(1999) Effect of nutrient limitation on adhesion characterization
of Pseudomonas aeruginosa. J. Appl. Microbiol. 86, 944–954.
[30] Helinck, S., Charbonnel, P., Foucaud, C., Piard, J.C. and Juillard,
V. (2003) Charged casein-derived oligopeptides competitively
inhibit the transport of a reporter oligopeptide by Lactococcus
lactis. J. Appl. Microbiol. 94, 900–907.
[31] Vesey, P.M. and Kuramitsu, H.K. (2004) Genetic analysis of
Treponema denticola ATCC35405 biofilm formation. Microbiology 150, 2401–2407.
[32] Jefferson, K.K. (2004) What drives bacteria to produce a biofilm?.
FEMS Microbiol. Lett. 236, 163–173.