Differential Regulation of the IL-12 p40
Promoter and of p40 Secretion by CpG DNA
and Lipopolysaccharide
This information is current as
of June 16, 2017.
John S. Cowdery, Nancy J. Boerth, Lyse A. Norian, Peggy S.
Myung and Gary A. Koretzky
J Immunol 1999; 162:6770-6775; ;
http://www.jimmunol.org/content/162/11/6770
Subscription
Permissions
Email Alerts
This article cites 34 articles, 24 of which you can access for free at:
http://www.jimmunol.org/content/162/11/6770.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1999 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
References
Differential Regulation of the IL-12 p40 Promoter and of p40
Secretion by CpG DNA and Lipopolysaccharide1
John S. Cowdery,2*†‡ Nancy J. Boerth,‡ Lyse A. Norian,‡ Peggy S. Myung,‡ and
Gary A. Koretzky†‡§
I
*Department of Veterans Affairs Medical Center, Iowa City, IA 52246; and †Department of Internal Medicine, ‡Interdisciplinary Program in Immunology, and §Department of Biophysics, University of Iowa, College of Medicine, Iowa City, IA 52242
deficient mice are incapable of producing p40 following challenge
with virus, intracellular parasites, or LPS (14, 15). The mechanism
by which IFN-g augments p40 transcription is unclear, since the
mouse IL-12 promoter does not contain a recognized IFN-g-activated sequence or an IFN-sensitive response element.
Microbial DNA or synthetic oligonucleotides containing internal CpG motifs function as potent inducers of the inflammatory
response (reviewed in Refs. 16 and 17). Recent studies have identified the cells’ response to CpG DNA and the cytokines that are
induced; however, less is understood about the molecular mechanisms by which CpG DNA activates cells (18 –21). In earlier studies, we found that CpG DNA is a potent inducer of macrophage
IL-12 secretion, and we found that IL-10 inhibits CpG-induced
p40 secretion (21, 22). Although a receptor for CpG has not been
identified, cells responding to CpG DNA initiate synthesis of reactive oxygen species and translocate NF-kB to the nucleus (23,
24). Here, we show that while both LPS and CpG DNA induce
transcription of IL-12 promoter-reporter constructs, and both stimuli are associated with protein binding to the NF-kB half-site, CpG
DNA alone (unlike LPS) induces an increase in p40 mRNA in a
macrophage cell line. Additionally, the combination of IFN-g and
CpG DNA results in greater p40 mRNA levels and secreted protein than is seen after challenge with CpG DNA alone or with
LPS/LPS 1 IFN-g. These observations illustrate both similarities
and differences between CpG DNA and LPS-induced activation of
IL-12 p40 transcription.
Received for publication November 18, 1998. Accepted for publication March
17, 1999.
Materials and Methods
nterleukin-12 is a heterodimeric, proinflammatory cytokine
that induces the production of IFN-g, which, in turn, drives
the production of a number of inflammatory cytokines. Additionally, IL-12-induced IFN-g can direct activated T lymphocytes to differentiate into type 1 helper cells (reviewed in Refs. 1
and 2). Adequate production of IL-12 is essential for the maintenance of normal host defense mechanisms (especially against intracellular pathogens); however, excessive production of IL-12 has
been associated with deleterious inflammation (3–7). Although the
IL-12 p35 chain is produced by a number of cell types, secretion
of the biologically active p70 heterodimeric is controlled at the
level of p40 chain transcription (8, 9). Secretion of p40 or p70 is
limited to cells of the macrophage/monocyte lineage and occurs
only after activation of these cells. A number of stimuli, including
microbial products and anti-CD40, induce IL-12 p70 production
(10 –12). A major element in the control of p40 transcription is a
NF-kB half-site located at bp 2132 to 2122 59 of the TATA box.
Disruption of this site abolishes the activity of p40 reporter constructs (13). The T cell/NK cell cytokine IFN-g (which is induced
by IL-12) is a powerful costimulator of LPS-induced p40 transcription (8, 13). The critical role of IFN-g is underscored by the
finding that IFN consensus sequence-binding protein (ICSBP)3-
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work is supported by funding from the Department of Veterans Affairs and U.S.
Public Health Service Grant AI10112.
2
Address correspondence and reprint requests to Dr. John S. Cowdery, Department
of Internal Medicine, University of Iowa College of Medicine, C31-0 GH, Iowa City,
IA 52242. E-mail address: [email protected]
3
Abbreviations used in this paper: ICSBP, IFN consensus sequence binding-protein;
b-gal, b-galactosidase.
Copyright © 1999 by The American Association of Immunologists
Mice and cell cultures
BALB/c mice were purchased from Harlan Sprague-Dawley (Indianapolis,
IN) and were maintained in a conventional mouse facility with cage-top
filters. The RAW 264.7 mouse macrophage cell line was purchased from
the American Type Culture Collection (Manassas, VA), and WEHI 231
cells were the gift of Dr. Gail Bishop (University of Iowa, Iowa City, IA).
Cell lines were maintained in RPMI 1640 supplemented with penicillin,
streptomycin, L-glutamine, and 10% FBS. Primary cultures of bone marrow-derived macrophages were prepared by flushing mouse femurs and
iliac wings with cold media. Cells were cultured at an initial concentration
0022-1767/99/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Challenge of macrophages with DNA containing an internal CpG motif results in IL-12 p40 secretion. In the presence of IFN-g,
CpG DNA induces more p40 secretion than does LPS. In the RAW 264 macrophage cell line, both CpG DNA and LPS activate
a p40 promoter-reporter construct, and the promoter response to either agent is augmented 2- to 5-fold by IFN-g. While either
LPS or CpG DNA induces p40 promoter activity, only CpG DNA induces an increase in p40 mRNA or protein secretion. Even
though IFN-g augmented LPS-driven p40 promoter activity in RAW 264 cells, the combination of IFN-g and LPS induced less
p40 mRNA or protein secretion than the combination of IFN-g and CpG DNA. The ability of IFN-g to augment LPS or CpG
DNA-induced p40 promoter activation was observed with truncation mutants of the IL-12 promoter containing as few as 250 bp
5* of the TATA box. Although LPS alone is a poor inducer of p40 transcription, both LPS and CpG DNA induce similar nuclear
translocation of NF-kB. This binding is not augmented by costimulation with IFN-g. Thus, CpG DNA induces p40 transcription
by a mechanism that includes NF-kB translocation; however, CpG DNA appears to induce other factor(s) necessary for p40
transcription. These results illustrate fundamental differences between CpG DNA and LPS with respect to activation of IL-12 p40
secretion. The Journal of Immunology, 1999, 162: 6770 – 6775.
The Journal of Immunology
nucleated cells/ml in complete RPMI supplemented with 15% conditioned
mouse L cell medium, which served as a source of M-CSF and GM-CSF
(25). After 4 days of culture, plates were washed twice with warm medium,
and adherent cells were removed with a cell lifter. Cell surface staining
revealed the recovered cells were .95% Mac1 bright.
In vitro cultures
Bone marrow-derived macrophage, or RAW 264 cells (5 3 105/ml) were
cultured in 0.2 ml in 96-well plates (Costar, Corning, NY) of complete
RPMI in the presence of various stimuli. Supernatant fluids were harvested
at 24 h, and IL-12 concentration was determined by ELISA. Cultures were
stimulated with LPS (Escherichia coli 0127:B8; Sigma, St. Louis, MO),
the CpG-containing, phosphorothioate backbone oligonucleotide designated 1826 (59-TTCATGACGTTCCTGACGTT-39) or a control phosphorothioate backbone oligonucleotide (designated 1982) in which the internal
CpG motif is reversed (59-TCCAGGACTTCTCTCAGGTT-39). These two
oligonucleotides have been shown in previous studies (20, 22) to be either
immunostimulatory (oligo 1826) or neutral (oligo 1982). Oligonucleotides
were synthesized by Oligos Etc. (Watsonville, OR) and were certified to be
endotoxin-free. Oligonucleotides were the gift of Dr. Arthur Krieg (University of Iowa). Some cultures were also stimulated with 100 U/ml murine
rIFN-g (R&D Systems, Minneapolis, MN).
Culture supernatants were evaluated for p40 concentration using Immunol
2 ELISA plates (Dynex, Chantilly, VA) that were coated with monoclonal
rat anti-mouse IL-12 p40 chain (PharMingen, San Diego, CA). The plates
were developed by the subsequent addition (with interposed washes) of:
biotin-conjugated rat anti-mouse p40 chain (PharMingen), (4-h incubation); streptavidin-HRP (Zymed, South San Francisco, CA), (1-h incubation); and peroxidase substrate (Kirkegaard & Perry Laboratories, Gaithersburg, MD), (20- to 30-min incubation). The observed OD (650 – 490 nM
reference) was compared with a standard curve generated with murine
rIL-12 (R&D Systems). The sensitivity of the ELISA is 0.5 ng/ml.
and UV-linked to nitrocellulose paper, then sequentially blotted with 32Plabeled probes for p40 and GAPDH. The p40 cDNA was prepared by PCR
amplification of a 610-bp section (bases 22– 632) of the p40 cDNA. Following isolation of total RNA, cDNA was synthesized as described previously (27). The PCR amplification was accomplished with 100 pM of
sense (59-GCAGCAAAGCAAGATGTGTCC-39) and antisense (59CAGTTGGGCAGGTGACATCC-39) primers. Each primer included a
BamHI site tailed to the 59 to permit excision of the segment from the
multiple cloning site of the pGEM T vector system (Promega, Madison,
WI), which was used to propagate the PCR product. The identity of the p40
cDNA was confirmed by sequence. The GAPDH control cDNA was a gift
of Dr. Arthur Krieg (University of Iowa).
EMSA
After 1 or 3 h of stimulation, nuclear extracts were prepared as described
previously (28), and 5 mg of extract was reacted with a 32P-labeled doublestranded probe derived from the IL-12 promoter containing both the
NF-kB half-site and the 59 Pu.1 site (59-GGGGAGGGAGGAACTTCT
TAAAATTCCCCCAGAATGTTT-39) or a labeled probe in which the sequence of the Pu.1 site was replaced with random nucleotides (59ATGTT
TACTAGACAAAATTCCCCCAGAATGTTT). Other experiments used a
labeled 27-bp oligonucleotide containing a consensus NF-kB site from the
mouse IgH promoter (59-GTAGGGGACTTTCCGAGCTCGAGATC
CTATG-39). Binding reactions were conducted for 30 min at room temperature as described (29). In some reactions, the nuclear extracts were
coincubated with both labeled oligonucleotide and 10003 excess of an
unlabeled specific or nonspecific oligonucleotide competitor (containing
the SP.1 recognition site). Oligonucleotide specific competitors included
both 39- and 33-bp oligonucleotides and the 27-bp oligonucleotide containing the consensus NF-kB site. After reaction with nuclear extracts,
oligonucleotides and oligonucleotide-protein complexes were resolved on
6% nondenaturing polyacrylamide gel and visualized using a phosphorimaging system (Molecular Dynamics, Sunnyvale, CA).
Measurement of IL-12 p40 promoter activity
A segment of the IL-12 promoter (2703 to 154) coupled to a luciferaseencoding plasmid was the gift of Dr. Kenneth Murphy (Washington University, St. Louis, MO). This construct was used as a PCR template for the
generation of the following truncations: 2697, 2543, 2403, 2250, and
2100 to 153 (all numbers refer to position relative to the TATA box). The
PCR products were 59 and 39 tailed with BamHI and HindIII restriction
sites to allow directional cloning into the multiple cloning site of the luciferase reporter plasmid Luc Link. After confirmation of orientation and
sequence, plasmid DNA was isolated from transformed E. coli and was
purified by CsCl2 centrifugation. To measure promoter activity, we used
transient transfection of RAW 264 cells or WEHI 231 cells (electroporation at 260 MV/960 mFD). Cells were cotransfected with 20 mg of the
p40-luciferase constructs and 5 mg of a plasmid containing b-galactosidase
(b-gal) under control of a constitutive CMV promoter. In WEHI 231 cells,
we also transfected with a reporter construct in which luciferase was driven
by the NF-kB-containing promoter from the MHC class II invariant chain
(26). After electroporation, 106 cells were cultured overnight in a volume
of 5 ml in 6-well tissue culture plates (Costar). Cells were then treated with
the indicated stimulus and were harvested 24 h later into 100 ml of harvest
buffer (100 mM KPO4 (pH 7.8), 1.0 mM DTT, 1% Triton X-100). Lysates
were mixed with 100 ml of assay buffer (200 mM KPO4 (ph 7.8), 10 mM
ATP, 20 mM MgCl2), followed by 100 ml of 1 mM luciferin. Luciferase
activity was measured as light units using a Moonlight 2010 luminometer
(Analytical Luminescence Laboratory, San Diego, CA). b-gal expression
was assayed using an assay kit purchased from Tropix (Bedford, MA). In
all groups, the relative expression of luciferase light units by transfected
cells represents: light units experimental/light units unstimulated. The
transfected but unstimulated cells showed luciferase activity, which was
consistently ,43 the machine background of 100 U. For each experimental group, luciferase expression was corrected for the simultaneous expression of b-gal by multiplying the fold increase in luciferase by the fraction:
b-gal stimulated/b-gal control. This calculation corrects for variation in
cell number or ability to synthesize protein.
p40 mRNA measurement
Total RNA was isolated from unstimulated or stimulated (4 h) RAW 264
cells using RNA stat (Tel-Test “B” Inc., Friendswood, TX), according to
the manufacturer’s recommendation. Ten micrograms of RNA were separated on a denaturing 1.5% agarose gel (MOPS running buffer with 3%
formaldehyde). Following electrophoretic separation, RNA was transferred
Results
IFN-g augments CpG DNA-induced secretion of IL-12 p40
Bacterial DNA, or oligonucleotides with internal CpG motifs, are
known to induce IL-12 secretion by macrophages or dendritic
cells, but the mechanism by which CpG DNA-induces IL-12 secretion is unknown. Since IFN-g augments the IL-12 response to
other stimuli (such as LPS), we evaluated the influence of IFN-g
on CpG DNA and LPS-induced p40 secretion. Culture of bone
marrow-derived macrophages with a CpG-containing oligonucleotide (designated 1826) resulted in a significant, dose-dependent
IL-12 p40 response (Fig. 1). A similar oligonucleotide in which the
internal CpG is switched to GpC (designated 1982) did not induce
p40 secretion. Fig. 1 also shows that LPS alone induced less p40
secretion than did CpG DNA. Although IFN-g alone did not induce p40 secretion, costimulation with IFN-g and 1826 (but not
1982) resulted in a marked increase in the p40 response compared
with the response to oligonucleotide alone. The combination of
IFN-g and CpG DNA induced a p40 response that exceeded that
seen following challenge with IFN-g and LPS.
Because the response observed in ex vivo-obtained macrophages could be influenced by other cells, we evaluated the ability
of CpG DNA to induce p40 secretion in a murine macrophage cell
line (RAW 264). The use of a cell line also permits manipulation
of conditions to favor or antagonize p40 production. The results
presented in Fig. 2 demonstrate that IFN-g again augments CpG
DNA-induced p40 secretion. Fig. 2 also shows that in RAW 264
cells, LPS alone does not induce p40 secretion and that the IFN-g
induced augmentation of the LPS response is less than the synergy
observed between IFN-g and CpG DNA. As we observed in bone
marrow-derived macrophages, IFN-g alone did not induce appreciable p40 secretion nor did the combination of IFN-g and the
control oligonucleotide 1982 (data not shown).
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
IL-12 p40 ELISA
6771
6772
IFN-g augments CpG DNA-induced p40 promoter activity
To address the mechanism(s) by which IFN-g augments CpG
DNA-induced IL-12 secretion, we used an IL-12 promoter-luciferase construct to test the ability of CpG DNA (in the presence or
absence of IFN-g) to activate the IL-12 p40 promoter. We transiently transfected RAW 264 cells with a plasmid containing a
2703 to 154 segment of the p40 promoter linked to the luciferase
reporter gene. Fig. 3 illustrates that, while both CpG DNA and LPS
induce reporter-driven luciferase activity, the addition of IFN-g to
either of these stimuli results in a marked increase in reporter gene
activity. Interestingly, LPS is a more potent activator of this promoter segment than CpG DNA (in the absence or presence of
FIGURE 3. IFN-g exhibits synergy with both CpG DNA and LPS in
activating a p40 reporter construct. RAW 264 cells were transiently transfected with a p40 promoter construct consisting of the 59 703-bp of the
promoter coupled to luciferase. To control for transfection efficiency and
viability, cells were cotransfected with a b-gal reporter under control of the
CMV constitutive promoter. After 24 h, cultures were stimulated with LPS
(1 mg/ml) 1826 0.3 mg/ml, with or without IFN-g (100 U/ml), with the
indicated stimuli, and reporter activity was assayed 24 h later.
IFN-g). This observation contrasts sharply with our finding that
LPS is a less effective inducer of p40 protein secretion in macrophages or RAW 264 cells (Figs. 1 and 2). Because reporter assays
may not reflect actual mRNA transcription, we used Northern blot
analysis to confirm that IFN-g increased the amount of p40 mRNA
in CpG DNA-treated cells (Fig. 4). Here again, we found that CpG
DNA alone (but not LPS alone) induced an increase in the level of
p40 mRNA. In the presence of IFN-g, CpG DNA induced greater
levels of p40 mRNA than the levels seen in RAW 264 cells treated
with IFN-g and 1 mg/ml LPS. Thus, the reporter assay does accurately reflect the impact of IFN-plus CpG DNA on intracellular
p40 mRNA level, but, at the same time, reveals a discordance
between LPS-induced promoter activity (present) and LPS-induced p40 secretion (absent). This discordance between regulation
of p40 promoter constructs and regulation of p40 mRNA transcription has also been observed by others (30).
CpG DNA-induced p40 promoter activation requires elements 39
of the 2250 position and induces transcription factor binding to
the NF-kB half-site
To localize the region(s) of the p40 promoter necessary for CpG
DNA-induced promoter activity, we used PCR to prepare 59 truncations of the 2703 to 154 segment. These consisted of segments
FIGURE 2. IFN-g exhibits synergy with CpG DNA in the induction of
p40 secretion by the macrophage cell line RAW 264. Cultures containing
105 log-phase RAW 264 cells were stimulated as in Fig. 1, and p40 was
measured in a manner identical to that depicted in Fig. 1. The results
represent one of four representative experiments.
FIGURE 4. IFN-g costimulates with both LPS and CpG DNA to induce
an increase in IL-12 p40 mRNA level. Cultures (20 ml) containing 2 3 107
RAW 264 cells were stimulated for 4.5 h with LPS (1 mg/ml), the CpGcontaining oligonucleotide 1826 (0.3 mg/ml), in the presence or absence of
IFN-g (100 U/ml). Following electrophoretic separation and blotting to
nitrocellulose, mRNA band was visualized by the use of labeled cDNA
probes specific for either the coding region of p40 or GAPDH.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 1. IFN-g is a powerful costimulator of CpG DNA-induced
IL-12 p40 secretion. Cultures (0.2 ml) containing 105 bone marrow-derived
adherent cells were stimulated overnight with the indicated CpG oligonucleotide 1826 (0.01–1 mg/ml) or LPS (.01–1 mg/ml); non-CpG oligonucleotide 1982 (1 mg/ml), with or without murine IFN-g (100 U/ml). Ordinate units represent mg/ml concentration. Supernatant p40 concentration
was determined by ELISA. Values represent the mean of four replicate
cultures. This is one of three similar experiments. 1826, containing oligonucleotide; 1982, control (non-CpG-containing) oligonucleotide.
IL-12 p40 REGULATION
The Journal of Immunology
beginning 59 at 2697, 2543, 2406, 2250, and 2100 and extending 39to 154 (Fig. 5A). These truncated constructs were cloned
into a luciferase-containing plasmid that was used to transiently
transfect RAW 264 cells. After stimulation of the transfected cells,
it was apparent that stimulation of cells transfected with truncations of 2250 or longer resulted in increased luciferase activity,
but the 2100 construct was inactive (Fig. 5B). As was seen with
the 2703 construct, IFN-g markedly increased the activity of all
CpG-stimulated functional promoter constructs. Since the promoter region between 2250 and 2100 contains the NF-kB half-
FIGURE 6. EMSA showing that stimulation of
RAW 264 cells with either CpG DNA or LPS induces
nuclear translocation of an NF-kB binding factor. Cells
were stimulated as indicated (1826, 0.3 mg/ml; LPS, 1
mg/ml; IFN-g, 100 U/ml) for 3 h, and 5 mg of nuclear
extracts were incubated with a labeled 39-bp oligonucleotide encompassing both the NF-kB half-site and the
adjacent Pu.1 site. Where indicated, the reaction mixture
contained a 10003 molar excess of the following unlabeled oligonucleotide competitors: SP.1 (nonspecific
competitor); 39 (identical to the labeled probe); 33 (oligonucleotide with the NF-kB half-site, but not the Pu.1
site); and NF-kB (oligonucleotide containing the NF-kB
recognition element contained in the mouse k-chain
enhancer.
site (2122 to 132) and an adjacent 59 Pu.1 site (13), we utilized a
gel shift assay to analyze the DNA binding properties of nuclear
extracts from treated and control RAW 264 cells. Fig. 6 shows
that, after 3 h of stimulating RAW 264 cells, CpG DNA induces
nuclear translocation of at least two proteins that bind to a 39-bp
oligonucleotide encompassing both the NF-kB half-site and the
Pu.1 site. Addition to the extracts of a 10003 excess of unlabeled
39 mer was able to compete the bands induced by CpG DNA or
LPS. Additionally, the unlabeled 39 mer eliminated visualization
of the lower band that was present in both resting and activated
cells. Addition of a 10003 excess of unlabeled 33 mer (containing
only the NF-kB half-site) or addition of an unlabeled oligonucleotide containing the B cell NF-kB IgH enhancer element, competed only the upper two bands. Thus, the lower band likely represents binding to the Pu.1 site by a constitutively produced
protein.
Because the 3-h stimulation period might not reveal differences
in the transcription factor activity that was present at an earlier
time, we compared RAW 264 nuclear extracts at 1 and 3 h poststimulation with 1826, LPS, IFN-g, or IFN-g combined with either
1826 or LPS. The results shown in Fig. 7, A and B, show no
appreciable difference in the EMSA pattern at 1 and 3 h. Additionally, Fig. 7B shows more intense oligonucleotide binding after
3 h. As found in Fig. 6, the induced bands were effectively completed by an unlabeled oligonucleotide containing an NF-kB site.
We found some increase in NF-kB binding in cells treated with
IFN-g alone, but the intensity of the bands was less than observed
with 1826 or LPS (with or without IFN-g). While LPS activates
NF-kB translocation and drives p40 promoter constructs as effectively as CpG DNA, LPS alone is a weak inducer of p40 mRNA
transcription. Thus, CpG DNA has p40 promoter-activating properties that are distinct from those of LPS (although the activity of
both are augmented by IFN-g).
Discussion
CpG-containing DNA can serve as a potent inducer of inflammatory cytokines, and, for this reason, there is much interest in its
adjuvant properties. We and others have shown that CpG-containing DNA is a potent inducer of IFN-g production (31, 32). Subsequent work revealed that CpG DNA-induced IFN-g production
is, in fact, IL-12-dependent (19, 20). Thus, IL-12 secretion may
represent the most proximal proinflammatory cytokine that is induced by CpG DNA. Our finding that IFN-g augments CpG DNAinduced IL-12 secretion is consistent with the documented activity
of IFN-g on other IL-12-inducing stimuli, and is also consistent
with the observation that ICSBP-deficient mice do not transcribe
p40 after microbial challenge (14, 15). Although LPS and CpG
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. Activation of the p40 promoter by CpG DNA or LPS depends on elements contained in the 250-bp 59 of the TATA box. A, Promoter truncation mutants were constructed using PCR amplification from
the 2703-bp construct presented in Fig. 3. Truncations were directionally
cloned into the luciferase-containing plasmid Luc Link. B, Individual promoter constructs were cotransfected with CMV-b-gal into RAW 264 cells
using the protocol described in Fig. 3. Corrected reporter activity was determined after 24 h.
6773
6774
DNA share a number of biologic properties, our findings demonstrate that CpG DNA (like LPS) induces the secretion of more
IL-12 p40 and in the presence of IFN-g; however, CpG DNA alone
is a stronger inducer of p40 transcription/secretion than is LPS
alone.
Since IL-12 is a potent inducer of IFN-g secretion by T and NK
cells, the ability of CpG DNA to induce some IL-12 secretion can
lead to the subsequent production of IFN-g by T and NK cells
(which can, in turn, augment CpG DNA-induced IL-12 production). Although CpG DNA alone induces p40 transcription/secretion by RAW 264 cells (while LPS alone does not), the two stimuli
have similar activity with respect to driving a p40 promoter construct containing up to 703 bp of sequence proximal to the TATA
box. Both CpG DNA and LPS induce luciferase activity in promoter constructs containing as few as 250 bp 59 of the TATA box.
A more drastic truncation, leaving only the proximal 100 bp of the
p40 promoter could not be induced to drive luciferase activity in
RAW 264 cells. This finding is consistent with the observation that
the NF-kB half-site located at position 2132 to 2122 is critical for
promoter function (13).
We observed that IFN-g augments the ability of either CpG
DNA or LPS to activate the promoter-reporter constructs that extended 250 bp (or farther) 59 of the TATA box. The promoter
segments that we tested do not contain sites that are known be
recognized by either STAT transcription factors or ICSBP. Additionally, the ability of IFN-g to augment promoter activity is not
due to increased cell survival/proliferation posttransfection, since
the activity of a CMV b-gal control reporter was similar in the
presence of absence of IFN-g. Thus, the effect of IFN-g may indirectly regulate an as yet unidentified transcription factor; alternatively, there may be an unidentified sequence in the proximal
250 bp of the p40 promoter that binds a known IFN-g-induced
transcription factor. Although the use of promoter constructs is
useful to dissect mechanisms responsible for p40 transcription, our
study also illustrates limitations in the interpretation of results. In
RAW 264 cells, LPS alone can drive a number of p40 reporter
constructs, however LPS does not (in the absence of IFN-g) induce
either p40 secretion or an increase in p40 mRNA level. Thus, other
as yet unidentified factors may operate outside the promoter region
that we evaluated in our constructs.
We found that stimulation with either CpG DNA or LPS induce
similar translocation of proteins that bind to the NF-kB half-site.
Additionally, there is constitutive nuclear translocation of a protein
that binds to the adjacent Pu.1 site, and this binding is not markedly influenced by CpG DNA, LPS, or IFN-g. Binding to the
NF-kB half-site appears to be necessary for both CpG DNA and
LPS-induced p40 secretion, but binding to this site alone clearly is
not sufficient to activate p40 transcription. Despite the fact that
nuclear extracts from cells stimulated with LPS or CpG DNA
show an identical pattern of binding to an oligonucleotide containing the NF-kB half-site, only CpG DNA is able to increase levels
of p40 mRNA or induce p40 secretion in the absence of IFN-g.
Our observed discordance between the induced activity of p40
promoter constructs and the actual transcription of p40 mRNA is
similar to observations by others who noted that, while IL-10 was
a potent inhibitor of p40 transcription, IL-10 did not inhibit the
induced activity of a p40 promoter construct (28). Our findings
suggest that there may be an element(s) in the proximal p40 promoter that (together with NF-kB) is necessary for the activation of
transcription. A possible explanation of our findings is that CpG
DNA induces this factor that, together with NF-kB, induces p40
transcription. Alternatively, CpG DNA may inhibit a repressor,
thus permitting NF-kB-induced p40 transcription. Since CpG
DNA is not more effective than LPS in activating the 703-bp p40
promoter construct, it is likely that the CpG DNA-sensitive element lies outside the 703-bp promoter segment.
It is important to note that p40 transcription/secretion does not
always directly correlate with the level of the secreted p70 heterodimer. Activation-induced transcription of p40 is required for
p70 secretion. The regulation of p70 secretion is complex and has
been shown to be inhibited by the p40 homodimer (33). Treatment
of mice with CpG DNA results in a sustained increase in serum
IL-12 and in resistance to challenge with Listeria monocytogenes
(34). The increased serum IL-12 levels and the resistance were
dependent on IFN-g. Our studies suggest that the observed influence of IFN-g on the in vivo response to CpG DNA may be a
consequence of enhanced p40 gene transcription.
Acknowledgments
We thank Shelly Forbes for her assistance in preparation of the manuscript.
References
1. Trinchieri, G. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive
immunity. Annu. Rev. Immunol. 13:251.
2. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, and
D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: role in
normal and pathologic immune responses. Ann. Rev. Immunol. 16:495.
3. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, and
P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 7. EMSA showing that stimulation of RAW 264 cells for 1 or
3 h induces a similar pattern of nuclear translocation of NF-kB. Nuclear
extracts (5 mg) were incubated with a labeled 27-bp oligonucleotide containing a consensus NF-kB recognition site. Where indicated, the reaction
mixture contained a 10003 molar excess of the unlabeled NF-kB
oligonucleotide.
IL-12 p40 REGULATION
The Journal of Immunology
20. Chace, J. H., N. A. Hooker, K. L. Mildenstein, A. M. Krieg, and J. S. Cowdery.
1997. Bacterial DNA-induced NK cell IFN-g production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.
21. Stacey, K. J., M. J. Sweet, and D. A. Hume. 1996. Macrophages ingest and are
activated by bacterial DNA. J. Immunol. 157:2116.
22. Anitescu, M., J. H. Chace, R. Tuetken, A-K. Yi, D. J. Berg, A. M. Krieg, and
J. S. Cowdery. 1997. Interleukin-10 functions in vitro and in vivo to inhibit
bacterial DNA-induced secretion of interleukin-12. J. Interferon Cytokine Res.
17:781.
23. Yi, A-K., R. Tuetken, T. W. Redford, M. Waldschmidt, J. Kirsch, and
A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the
pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.
24. Yi, A-K., and A. M. Krieg. 1998. CpG DNA rescue from anti-IgM-induced
WEHI-231B lymphoma apoptosis via modulation of I 75 Ba and I 75 Bb and
sustained activation of nuclear factor-75 B/C-rel. J. Immunol. 160:1240.
25. Crowley, M. T., P. S. Costello, C. J. Fitzer-Attas, M. Turner, F. Meng, C. Lowell,
V. L. J. Tybulewicz, and A. L. DeFranco. 1997. A critical role for syk in signal
transduction and phagocytosis mediated by Fcg receptors on macrophages.
J. Exp. Med. 186:1027.
26. Berberich, I., G. L. Shu, and E. A. Clark. 1994. Cross-linking CD40 on B cells
rapidly activates nuclear factor- 75 B. J. Immunol. 153:4357.
27. Latinis, K. M., L. L. Carr, E. J. Peterson, L. A. Norian, S. L. Eliason, and
G. A. Koretzky. 1997. Regulation of CD95 (Fas) ligand expression by TCRmediated signaling events. J. Immunol. 158:4602.
28. Thompson, C. B., C. Y. Wang, J. C. Ho, R. P. Bohjanen, B. Petyrniak, C. H. June,
S. Miesfeldt, L. Zhang, G. J. Nabel, B. Karpinski, and J. N. Leiden. 1992. cisActing sequences required for inducible interleukin-2 enhancer function bind a
novel Ets-related protein Elf-1. Mol. Cell. Biol. 12:1043.
29. Latinis, K. M., L. A. Norian, S. L. Eliason, and G. A. Koretzky. 1997. Two NFAT
transcription factor binding sites participate in the regulation of CD95 (Fas) ligand expression in activated human T cells. J. Biol. Chem. 272:31427.
30. Aste-Amezaga, M., X. Ma, A. Sartori, and G. Trinchieri. 1998. Molecular Mechanisms of the induction of IL-12 and its inhibition by IL-10. J. Immunol. 160:
5936.
31. Yamamoto, S., T. Yamamoto, T. Katoka, E. Kuramoto, O. Yano, and
T. Tokunaga. 1992. Unique palindromic sequences in synthetic oligonucleotides
are required to induce IFN and augment IFN-mediated natural killer activity.
J. Immunol. 148:4072.
32. Cowdery, J. S., J. H. Chace, A-K. Yi, and A. M. Krieg. 1996. Bacterial DNA
induces NK cells to produce IFN-g in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.
33. Gillessen, S., D. Carvajal, P. Ling, F. J. Podlaski, D. L. Stremlo, P. C. Familletti,
U. Gubler, D. H. Presky, A. S. Stern, and M. K. Gately. 1995. Mouse interleukin-12 (IL-12) p40 homodimer: a potent IL-12 antagonist. Eur. J. Immunol. 25:
200.
34. Krieg, A. M., L. Love-Homan, A-K. Yi, and J. T. Harty. 1998. CpG DNA induces
sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
4. Flynn, J. L., M. M. Goldstein, K. J. Triebold, J. Sypek, S. Wolf, and B. R. Bloom.
1995. IL-12 increases resistance of BALB/c mice to Mycobacterium tuberculosis
infection. J. Immunol. 155:2515.
5. Zhou, P., M. C. Sieve, J. Bennett, K. J. Kwon-Chung, R. P. Tewari,
R. T. Gazzinelli, A. Sher, and R. A. Seder. 1995. IL-12 prevents mortality in mice
infected with Histoplasma capsulatum through induction of IFN-g. J. Immunol.
155:785.
6. Trembleau, S., G. Penna, E. Bosi, A. Mortara, M. K. Gately, and L. Adorini.
1995. Interleukin 12 administration induces T helper type 1 cells and accelerates
autoimmune diabetes in NOD mice. J. Exp. Med. 181:817.
7. Windhagen, A., J. Newcombe, F. Dangond, C. Strand, M. N. Woodroofe,
M. L. Cuzner, and D. A. Hafler. 1995. Expression of costimulatory molecules
B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis
lesions. J. Exp. Med. 182:1985.
8. Ma, X., J. M. Chow, G. Gri, G. Carra, F. Gerosa, S. F. Wolf, R. Dzialo, and
G. Trinchieri. 1996. The interleukin 12 p40 gene promoter is primed by interferon
g in monocytic cells. J. Exp. Med. 183:147.
9. Ma, X., M. Neurath, G. Gri, and G. Trinchieri. 1997. Identification and characterization of a novel Ets-2-related nuclear complex implicated in the activation of
the human interleukin-12 p40 gene promoter. J. Biol. Chem. 272:10389.
10. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, and
G. Trinchieri. 1995. Interleukin-12 is required for interferon-g production and
lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.
11. Koch, F., U. Stanzl, P. Jennewein, K. Janke, C. Heufler, E. Kampgen, N. Romani,
and G. Schuler. 1996. High level IL-12 production by murine dendritic cells:
upregulation via MHC class II and CD40 molecules and downregulation by IL-4
and IL-10. J. Exp. Med. 184:741.
12. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, and
G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high
levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via
APC activation. J. Exp. Med. 184:747.
13. Murphy, T. L., M. G. Cleveland, P. Kulesza, J. Magram, and K. M. Murphy.
1995. Regulation of interleukin 12 p40 expression through an NF-KB half-site.
Mol. Cell. Biol. 15:5258.
14. Scharton-Kersten, T., C. Contursi, A. Masumi, A. Sher, and K. Ozato. 1997.
Interferon consensus sequence binding protein-deficient mice display impaired
resistance to intracellular infection due to a primary defect in interleukin 12 p40
induction. J. Exp. Med. 186:1523.
15. Giese, N. A., L. Gabriele, T. M. Doherty, D. M. Klinman, L. Tadesse-Heath,
C. Contursi, S. L. Epstein, and H. C. Morse III. 1997. Interferon (IFN) consensus
sequence-binding protein, a transcription factor of the IFN regulatory factor family, regulates immune responses in vivo through control of interleukin 12 expression. J. Exp. Med. 186:1535.
16. Pisetsky, D. 1996. Immune activation by bacterial DNA: a new genetic code.
Immunity 5:303.
17. Krieg, A. M. 1996. An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J. Clin. Lab. Med. 128:128.
18. Krieg, A. M., A-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale,
G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger
direct B-cell activation. Nature 374:546.
19. Halpern, M. D., R. J. Kurlander, and D. S. Pisetsky. 1996. Bacterial DNA induces
murine IFN-g production by stimulation of IL-12 and tumor necrosis factor-a.
Cell. Immunol. 167:72.
6775