Published July 7, 2016
o r i g i n a l r es e a r c h
AP2/ERF Transcription Factors Involved in Response
to Tomato Yellow Leaf Curly Virus in Tomato
Ying Huang, Bao-Long Zhang, Sheng Sun, Guo-Ming Xing, Feng Wang,
Meng-Yao Li, Yong-Sheng Tian, and Ai-Sheng Xiong*
Abstract
Core Ideas
Tomato yellow leaf curly virus (TYLCV), transmitted by the whitefly
(Bemisia tabaci), causes leaf curling and yellowing, plant dwarfism, and growth inhibition in tomato (Solanum lycopersicum
L.). The APETALA2 (AP2) and ethylene response factor (ERF)
transcription factor (TF) family, the largest plant-specific TF family,
was identified to function in plant development and pathogen
defense. Our study aimed to analyze the mechanism underlying the function of S. lycopersicum ERF (SlERF) TFs in response to
TYLCV infection and improve useful information to increase the
resistance to TYLCV in tomato. A total of 22 tomato AP2/ERF TFs
in response to TYLCV were identified according to transcriptome
database. Five ERF-B3 TFs were identified in cultivars Hongbeibei (highly resistant), Zheza-301, Zhefen-702 (both resistant),
Jinpeng-1, and Xianke-6 (both susceptible). Interaction network
indicated that SlERF TFs could interact with mitogen-activated
protein kinase (MAPK). Expression profiles of five ERF-B3 genes
(Soly19, Soly36, Soly66, Soly67, and Soly106) were detected
by quantitative real-time–polymerase chain reaction (qRT-PCR)
after TYLCV infection in five tomato cultivars. Soly106 expression
was upregulated in five tomato cultivars. The expressions of three
genes (Soly19, Soly67, and Soly36) were upregulated in Zheza-301 and Zhefen-702. Soly66 and Soly36 expressions were
downregulated in Hongbeibei and Xianke-6, respectively. Yeast
one-hybrid showed that the GCC-box binding ability of ERF-B3
TFs differed in resistant and susceptible tomato cultivars. Expression profiles were related to the GCC-box binding ability of SlERF
TFs in resistant and susceptible tomato cultivars. The defense
mechanism underlying the tomato’s response to TYLCV involved a
complicated network, which provided important information for
us in breeding and genetic analysis.
Published in Plant Genome
Volume 9. doi: 10.3835/plantgenome2015.09.0082
© Crop Science Society of America
5585 Guilford Rd., Madison, WI 53711 USA
This is an open access article distributed under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
the pl ant genome

ju ly 2016

vol . 9, no . 2 •
•
•
•
SlAP2/ERF factors respond to the TYLCV infection.
GCC-box binding ability of SlERF factors was
different in tomato cultivars.
SlERFs interact with other proteins in tomato.
The defense mechanism to TYLCV is a complicated
network.
T
omato yellow leaf curl virus, which belongs to the
genus Begomovirus of the family Geminiviridae, is a
monopartite virus containing one single-stranded DNA
molecule of 2.7 to 2.8 kDa (Ge et al., 2007). Originating
from the Middle East, TYLCV has been found in multiple
locations worldwide such as the Mediterranean, Japan,
China, and many other countries in recent years (Akad et
al., 2007; Lefeuvre et al., 2010). Transmitted by the whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae),
TYLCV can cause serious harm to tobacco (Nicotiana
tabacum L.), tomato, pumpkin (Cucurbita spp.), cassava
(Manihot esculenta Crantz), cotton (Gossypium hirsutum
Y. Huang, F. Wang, M.Y. Li, Y.S. Tian, and A.S. Xiong, State Key
Laboratory of Crop Genetics and Germplasm Enhancement, College
of Horticulture, Nanjing Agricultural University, Nanjing, China; B.L.
Zhang, Provincial Key Laboratory of Agrobiology, Jiangsu Academy
of Agricultural Sciences, Nanjing, China; S. Sun and G.M. Xing,
College of Horticulture, Shanxi Agricultural University, Taigu, China.
Received 8 Sept. 2015. Accepted 17 Dec. 2015. *Corresponding
author ([email protected]).
Abbreviations: AP2, APETALA2; AP2/ERF, APETALA2/ethylene
response factor; DREB, dehydration-responsive element binding;
JA, jasmonic acid; MAPK, mitogen-activated protein kinase; PCC,
Pearson correlation coefficient; qRT-PCR, quantitative real-time–
polymerase chain reaction; RAV, related to ABI3/VP; SA, salicylic
acid; SD, synthetic dropout; SlERF, S. lycopersicum ethylene response
factor; TF, transcription factor; Trp, tryptophan; TYLCV, tomato yellow
leaf curly virus; Ura, uracil.
1
of
15
L.), and other economically important crops (Jones et al.,
2008). In recent years, TYLCV has induced devastating
damages in tomato production and quality because of the
outbreak of its vector whitefly B. tabaci. Typical symptoms in the early onset of TYLCV include leaf yellowing
and curling as well as smaller and shrunken new leaves.
Infected whole plants even stop growing completely.
Flowers and fruits are abscised after exposure to viruliferous whiteflies for a month, leading to serious economic
loss (Lapidot, 2007). Tomato breeding for resistance to
TYLCV has focused on the introgression of resistance
genes. At present, five important resistance genes have
been identified: ty-1 (Zamir et al., 1994), ty-2 (Hanson et
al., 2006), ty-3 (Ji et al., 2007), ty-4 (Ji et al., 2009), and
ty-5 (Anbinder et al., 2009). Besides these five genes,
numerous other genes are involved in TYLCV infection
thereby forming a complex gene network.
Tomato, one of the most important vegetables worldwide, originated in western South America (Kimura and
Sinha, 2008). The species belongs to the nightshade family, Solanaceae, which contains other well-known species
such as pepper (Capsicum annuum L.), eggplant (Solanum
melongena L.), and potato (Solanum tuberosum L.) (Mueller et al., 2005). Worldwide tomato production has continued to increase from 110 Tg in 2000 to 161 Tg in 2012
(http://faostat.fao.org/). As an economically important
vegetable, tomato plays an important role in balancing
people’s diets. Tomato fruits are rich in sugars, dietary
fiber, minerals, essential amino acids, and vitamins
(Olaiya, 2011). Tomato also contributes to the experimental sciences such as in studies on defense regulation
against stresses, breeding, fruit development, and ripening (Klee and Giovannoni, 2011; Schauer et al., 2008). The
number of tomato cultivation areas has been increasing
on a daily basis. However, tomatoes are highly susceptible
to TYLCV damage. In 2009 to 2010, a TYLCV outbreak
happened in Jiangsu, Shandong, Henan, and other provinces of China, which considerably reduced tomato production and quality.
Numerous abiotic and biotic stresses influence plant
growth, development, and yield (Huang et al., 2015).
Numerous genes are induced to defend against stress via
two modes: one mode involves engendering related functional proteins, and the other mode involves functioning
as signal transduction factors in stress responses (Cao et
al., 2008; Yamaguchi-Shinozaki and Shinozaki, 2006).
The APETALA2/ethylene response factor (AP2/ERF)
TFs family is one of the largest plant-specific TFs with
a minimum of one APETALA2 (AP2) domain (Song et
al., 2014). According to the number and sequence similarities of the AP2 domain, AP2/ERF TFs are divided
into five subfamilies: AP2, ethylene responsive element
binding factors (ERF), RAV (related to ABI3/VP), dehydration-responsive element binding (DREB), and Soloist
(Licausi et al., 2013). The AP2/ERF TFs family plays an
important role in plant development processes such as
flower and seed development (Tsaftaris et al., 2012; Maes
et al., 2001), meristem capacity (Asahina et al., 2011),
2
of
15
stress responses (Chen et al., 2012), and primary and secondary metabolism (Shi et al., 2011; Zhang et al., 2005).
Some research also indicated that AP2/ERF family
TFs contributed to pathogen defense. TaPIEP1, a novel
pathogen-induced ERF gene of wheat, enhanced resistance to fungal pathogen, Bipolaris sorokiniana (Dong et
al., 2010). HvRAF, which was identified from barley (Hordeum vulgare L.), enhanced pathogen resistance and salt
tolerance in Arabidopsis thaliana (L.) Heynh. (Jung et al.,
2007). The ectopic expression of a tobacco stress-induced
gene, Tsi1, could enhance resistance to viral, bacterial,
and oomycete pathogens (Shin et al., 2002). A comparative transcriptome profiling in response to TYLCV infection between resistant tomato breeding line CLN2777A
and susceptible tomato breeding line TMXA48-4-0 was
conducted and found that numerous genes were induced,
including several transcription factors, such as AP2/ERF,
WRKY, and NAC (Chen et al., 2013). All these research
works demonstrated the important link between AP2/
ERF TFs and TYLCV infection, but information on the
mechanisms underlying this link is lacking. In this work,
we conducted in-depth research about the link between
AP2/ERF TFs family and TYLCV infection in tomato.
According to a previous transcriptome database, 22
TFs from SlAP2/ERF family that were induced in response
to TYLCV infection were identified in resistant and susceptible tomato cultivars. In the present work, five genes
(Soly19, Soly36, Soly66, Soly67, and Soly106) belonging to
ERF-B3 subfamily were selected to further analyze the
functional mechanism of SlAP2/ERF TFs and TYLCV
infection in five different tomato cultivars. An interaction
network was constructed to analyze the interaction between
SlERF TFs in response to TYLCV infection and other genes
in the tomato genome. The binding ability to GCC-box of
SlERF factors in response to TYLCV infection was identified by yeast one-hybrid. Quantitative real-time PCR was
used to analyze the expression profiles of the five SlERF
genes at 2, 4, 6, 8, 10, and 15 d after TYLCV inoculation.
This work aimed to determine the mechanism underlying
the function of SlERF factors in response to TYLCV infection and the improvement of TYLCV resistance in tomato.
Materials and Methods
Plant Material and Tomato Yellow Leaf Curly
Virus Inoculation
To determine whether phenotypes after TYLCV infection
differ between resistant and susceptible tomato cultivars,
we selected five different tomato cultivars: Hongbeibei,
Zhefen-702, Zheza-301, Xianke-6, and Jinpeng-1. Hongbeibei has high TYLCV resistance, Zhefen-702 and
Zheza-301 have middle-level resistance, and Xianke-6
and Jinpeng-1 are susceptible to TYLCV. The five tomato
cultivars were grown in a chamber programmed for 12 h
photoperiod at 25 and 18°C (day vs. night) and a relative
humidity of 60 to 70% with 320 µmol m−2 s−1 light intensity. Viruliferous whiteflies were fed on tomato plants in
the pl ant genome

ju ly 2016

vol . 9, no . 2
an insect-proof greenhouse. Two-leaf-stage tomatoes were
transferred into the insect-proof greenhouse for exposure
to whiteflies carrying TYLCV for 0, 2, 4, 6, 8, 10, 15, and
40 d. Leaves of five tomato cultivars were collected and
frozen in liquid N2 immediately after exposure.
Sequence Database Searches
The ERF TFs family sequences of tomato related to
TYLCV were downloaded from the tomato genome view
according to comparative transcriptome profiling in
response to TYLCV between resistant and susceptible
tomato cultivars (The Tomato Genome Consortium,
2015; Chen et al., 2013). The AP2 domain of each AP2/
ERF factor was confirmed using BLASTp. The AP2/ERF
TFs family was retrieved from Sol Genomics Network
(ITAG2.4) (Fernandez-Pozo et al., 2015).
Phylogenetic Analysis and Motif Recognition
The amino acid sequences of SlAP2/ERF TFs were used to
conduct phylogenetic analysis. Several AP2/ERF TFs that
responded to the pathogen were identified such as PpERF
(PpERF1a and PpERF1b) (Sherif et al., 2012), TaPIEP1
(Dong et al., 2010), OsERF922 (Liu et al., 2012), and Opbp1
(Guo et al., 2004). Clustal X was used to align the sequence
by neighbor-joining method (Chenna et al., 2003), and
MEGA5.0 was used to construct the phylogenetic tree
(Tamura et al., 2011). The chemical and physical characteristics of the 22 SlAP2/ERF factors in response to TYLCV
infection were determined by Expert Protein Analysis
System (ExPASy) program (http://web.expasy.org/protparam/) (Gasteiger et al., 2003). Conserved motifs were
detected using MEME (Version 4.9.1) (Bailey et al., 2009).
Identification of Orthologous and
Paralogous Genes
Orthologous and paralogous genes of AP2/ERF TFs family in tomato, rice (Oryza sativa L.), and Arabidopsis were
identified by OrthoMCL (Li et al., 2003). Circos software
was used to display the relationship between orthologous and paralogous genes (Krzywinski et al., 2009). The
databases of Arabidopsis and rice AP2/ERF TFs family
were downloaded from TAIR10 and DRTF, respectively.
Arabidopsis Interactions Viewer was used to construct
the interaction network of Arabidopsis AP2/ERF proteins
(http://bar.utoronto.ca/interactions/cgi-bin/Arabidopsis_interactions_viewer.cgi).
RNA Extraction and Quantitative Real-Time–
Polymerase Chain Reaction Analysis
An RNA kit (RNA simple total RNA kit, Tiangen) was
used to extract the total RNA of tomato. A Prime Script
RT reagent kit (TaKaRa) reverse transcribed the RNA into
complementary DNA. ABI7500 (Applied Biosystems7500)
was used to carry out qRT-PCR with SYBR Premix Ex-Taq
(TaKaRa). The PCR procedure was conducted according to the following operating instructions: 95°C for 30
s, followed by 40 cycles at 95°C for 5 s and 60°C for 30
s, and melting curve analysis (61 cycles) at 65°C for 10 s.
Table 1. Quantitative real-time–polymerase chain
reaction primers of five SlERF-B3 genes and Tubulin.
Gene
Soly19
Soly36
Soly106
Soly67
Soly66
Tubulin
Forward primer 5¢-3¢
Reverse primer 5¢-3¢
TCCATCTGAAATAGTGAACGCCT
AGCAACAAAATGATGAGACTAAAAC
TAGACGATGATTGCTCCCCTGTA
TTTCATCAATACACCTCAAAGTTCA
TTCACTTCAGTAAAAACAGAGCCAT
TGACGAAGTCAGGACAGGAA
GATTCAAATACATCATTAGTTCCAC
GAGATAATGGTGACAATGGTGGC
ATAATCAGCACCCAAATCTTCAAAC
CGAATTTTCTACCATTTTCTCCTTA
GAAAACTGGACTGAGGATGGTAT
CTGCATCTTCTTTGCCACTG
Three technical repeats were performed with each RNA
sample of five tomato cultivars. The comparative CT
method (2−DDCT) method was used to measure the RNA
level, which was expressed relative to the Tub gene (DCT =
CT target sample − CT Tub) (Pfaffl, 2001). The primer sequences
of each selected gene were designed using Primer Premier
5.0 software (PREMIER Biosoft, 2012). A-Tubulin (Solyc04
g077020.2) was used to regulate the expression level
according to the previous study (Chen et al., 2013). Primers used in this study are listed in Table 1.
Gene Cloning and Yeast One-Hybrid Assay of
SlERF Transcription Factors
According to the phylogenetic tree, most of SlAP2/ERF
factors in response to TYLCV were identified in the ERF
group, especially in the ERF-B3 subfamily (Supplemental
Table S2). According to previous studies, SlERF TFs in
other plants that responded to pathogen were focused on
the ERF-B3 subfamily. Five genes encoding ERF-B3 TFs
(Soly19, Soly36, Soly66, Soly67, and Soly106) were selected
to analyze the plant’s response to TYLCV infection. Special primers of the five genes were designed with Bam HI
and Sac I enzymes at the end of each primer (Table 2).
Polymerase chain reaction amplification was performed
under the following conditions: 94°C for 5 min, followed
by 35 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for
60 s, and then a final 10-min extension at 72°C. pMD19 simple-T vector (TaKaRa) was used to ligate the PCR
product after sequencing and digestion.
The pPC87 vector, a reconstruction of pPC86 vector, which contained tryptophan (Trp) synthesis gene
and a galactose-inducible protein (GAL4) activating
domain, was used to ligate the coding region of each
ERF-B3 gene. Recombinant plasmids were imported into
the yeast EGY48, which contained the vector that could
generate uracil (Ura) and carried the reporter gene LacZ
under the control of a 75-bp fragment containing a GCC
element (5¢-ACCCTCGAGCGGATAACAATTTCACACAGGGGCGGCTCTTAGGCGGCTCTTATAAGAGCCGCCGGATCCGGGCCC-3¢, GenBank No.
AF394909). Transformed yeast cells were cultured on
synthetic dropout (SD)/-Ura/-Trp plates for 3 d at 30°C.
X-gal (20 µg mL−1) was used to identify positive clones.
Beta-galactosidase activity was determined to screen the
colonies with X-gal by culturing three positive clones in
liquid SD/-Ura/-Trp medium, with o-nitrophenyl-b-Dgalactopyranosideas substrate (Jin et al., 2010).
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 3
of
15
Table 2. Primers of five SlERF-B3 genes used for vector construction. Bold primer segments represent the Bam HI
(GGATCC) and Sac I (GAGCTC) restriction enzyme sites.
Gene
Soly19
Soly36
Soly106
Soly67
Soly66
Forward primer 5¢-3¢
Reverse primer 5¢-3¢
CGGGATCCATGGTTCCAACTCCTCAAAGTGAT
CGGGATCCATGGGTTCTCCACAAGAGAC
CGGGATCCATGGATTCTTCTTCTTCTTCATCTC
CGGGATCCATGGATAAGCCCCACAAGTGGCTTC
CGGGATCCATGACGAAACAAGATGAAGGATTAA
CGAGCTCTTAACATCTTGATTCAAATACATCA
CGAGCTCATTATATCATAACAAGCTGAGATAA
CGAGCTCTTACCATGGACTAAAATAAGTTGCA
CGAGCTCCTATGATACCAAAAGTTGAGAATAA
CGAGCTCCTACACCAACTCCATCTTGTTCTCT
Results
Symptoms of Five Different Tomato Cultivars
In Response to Tomato Yellow Leaf Curly
Virus Infection
Two-leaf-stage tomato cultivars (highly tolerant cultivar, Hongbeibei; tolerant cultivars, Zheza-301 and
Zhefen-702; and susceptible cultivars, Jinpeng-1 and
Xianke-6) were infected with TYLCV for 0, 2, 4, 6, 8, 10,
15, and 40 d by exposure to viruliferous whiteflies. After
10 d, the symptoms of five tomato cultivars were normal.
The leaves of Jinpeng-1 and Xianke-6 became curly, and
those of the resistant cultivars were normal after 2 wk
(Fig. 1). The symptoms of TYLCV infection in tomato
cultivars became typical with increasing time of exposure, except in Hongbeibei. After 40 d, the leaf of Hongbeibei became slightly curly. Zheza-301 and Zhefen-702
became curly and slightly yellow colored. Two susceptible cultivars (Jinpeng-1 and Xianke-6) displayed typical
symptoms. The cultivars showed symptoms of dwarfing with yellow and curly leaves and new leaves became
smaller and shrunken (Fig. 2; Supplemental Fig. S6).
SlAP2/ERF Transcription Factors Involved
in Response to Tomato Yellow Leaf Curly
Virus Infection
To determine the SlAP2/ERF TFs involved in TYLCV
resistance, SlAP2/ERF TFs that exhibited up- or downregulation in tomato after TYLCV infection were identified based on transcriptome data (Chen et al., 2013). A
total of 22 SlAP2/ERF TFs that responded to TYLCV
infection were determined. Two genes encoding SlERF
factors (Soly66 and Soly67) and one gene encoding SlAP2
(Soly165) was upregulated by four to six times in the
resistant cultivar. A total of 18 downregulated SlAP2/
ERF TFs and one upregulated TF (Soly147) were associated with plant defense response at different levels
in the susceptible cultivar (Supplemental Fig. S7).The
responses of 22 SlAP2/ERF TFs to TYLCV infection
were examined by sequence alignment. These 22 TFs
were conserved in an AP2 domain comprising 58 to 59
amino acids. Seven amino acid residues (Arg29, Arg31,
Trp33, Glu39, Arg41, Arg49, and Trp51) that could bind
the GCC-box were conserved (Supplemental Fig. S8B).
Soly147, which was identified to belong to the AP2 subfamily, possessed two AP2 domains. The DREB and ERF
subfamilies (Soly32 and Soly19) contained only one AP2
4
of
15
Fig. 1. Symptoms in five tomato cultivars after tomato yellow leaf
curly virus (TYLCV) infection. (A) Two-leaf stage before TYLCV infection; (B) 10 d after TYLCV infection; (C) 15 d after TYLCV infection.
domain. AP2 and B3 domains were found in the transcription factor Soly165, which belonged to RAV subfamily (Supplemental Fig. S8A).
The bioinformatics resource portal ExPASy (http://
web.expasy.org/translate/) was used to analyze the
chemical and physical characteristics of 22 SlAP2/ERF
TFs (Supplemental Table S2). The theoretical pI values
the pl ant genome

ju ly 2016

vol . 9, no . 2
one to three different amino acids were found between
Zheza-301 and Xianke-6 in each SlERF factor. Sequence
analysis showed that all five SlERFs possessed the AP2
domain, which consisted of a three-stranded, antiparallel
b-sheet and a-helix packed approximately parallel. There
were different amino acids residues among five ERF TFs
though the AP2 domain was conserved (Fig. 3).
Phylogenetic analysis of SlAP2/ERF Transcription
Factors Involved in Response to Tomato Yellow
Leaf Curly Virus Infection
Fig. 2. Symptoms of five cultivars after 40 d of tomato yellow leaf
curly virus (TYLCV) infection. (A) Hongbeibei; (B) Zheza-301; (C)
Zhefen-702; (D) Jinpeng-1; (E) Xianke-6.
of factors (Soly83, Soly108, and Soly109) belonging to
ERF-B1 were >8.0, whereas the pI values of the DREB-A1
subfamily (Soly32 and Soly87) were <6.0. The pI of ERFB3 factors varied widely from 4.98 to 9.07. The motifs of
SlAP2/ERF TFs were detected by MEME (Supplemental
Fig. S9). The LOGOs of proteins are shown in Supplemental Fig. S10. The WLG element (in motif1) was conserved in all SlAP2/ERF TFs. Nearly all AP2/ERF TFs,
except Soly95 and Soly165, possessed motif 2, which
contained YRG amino acids. Different TFs presented
different motifs that maybe related to the differences in
proteins or function in response to TYLCV.
To analyze the mechanism between ERF-B3 and
TYLCV infection, full lengths of five SlERF-B3 genes
(Soly19, Soly36, Soly66, Soly67, and Soly106) from Zheza-301
and Xianke-6 were cloned. As shown in Supplemental Fig.
S1 to S5, the genes encoded proteins with calculated molecular masses of 161, 244, 201, 365, and 240 amino acids, and
A phylogenetic tree was constructed to analyze phylogenetic development. A total of 172 AP2/ERFs (167
tomato SlAP2/ERFs and five ERFs factors responding
to the pathogen) were used. Among the 22 SlAP2/ERFs
involved in the plant’s response to TYLCV infection, four
factors (Soly87, Soly95, Soly97, and Soly32) were classified
as DREB TFs, whereas 16 factors belonged to the ERF
subfamily. Only Soly165 and Soly147 TFs were classified
into the RAV and AP2 subfamilies, respectively (Fig.
4A). A total of 16 factors (72.73%) were identified in the
ERF group. Eight factors were categorized into the ERFB3 group, whereas three factors belonged to the ERF-B1
group. The ERF-B5 subfamily contained only one factor
(Supplemental Table S2). The different proportions of the
22 SlAP2/ERF TFs indicated that the ERF group may
play a key role in the response to TYLCV.
Eight TFs of 22 AP2/ERFs belonged to ERF-B3
subfamily (Fig. 4A; Supplemental Table S2), which
showed there was close relationship between ERF-B3
and TYLCV infection. By protein alignment, five SlERF
factors (Soly19, Soly36, Soly66, Soly67, and Soly106)
belonging to ERF-B3 showed different degrees of similarity to other plant ERF proteins that were identified to be
involved in defense responses such as PpERFs, OPBP1,
Pti4, and AtERF2 (Fig. 4B).
Evolution of AP2/ERF Family Transcription
Factor in Plant Species
To analyze the evolution of AP2/ERF family TFs, comparisons were constructed among different plant species.
Fig. 3. APETALA2 domain alignment of ethylene responsive element binding factors between tomato and Arabidopsis. The ※ symbol
represents the GCC-box binding domain described in AT4G17500.1.
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 5
of
15
Fig. 4. Phylogenetic tree of APETALA2 (AP2)/ethylene responsive element binding factors (ERF) transcription factors in tomato. (A)
Phylogenetic tree of 167 SlAP2/ERF factors and other ERF factors; (B) Phylogenetic tree of ERF transcription factors from different plant
species. GenBank accession numbers of ERF proteinsare listed as follows: tobacco, Opbp1 (U81157); peach, PpERF-1.a (HQ825094),
PpERF-1.b (HQ825095), PpERF-2.a (HQ825096), PpERF-2.b (HQ825097) and PpERF-2.c (HQ825098); rice, OsERF922 (BAD87106)
and OsBiERF3 (AAV98702); wheat, TaPIEP (ABU62817.1) and TaERF2 (AAP32468); tomato, Pti4 (AAc50047) and JERF3 (AAQ91334);
pepper, CaPF1 (AAP72289); Arabidopsis, AtERF2 (AAM64544).
6
of
15
the pl ant genome

ju ly 2016

vol . 9, no . 2
Fig. 5. Comparison of APETALA2 (AP2)/ethylene responsive element binding factors (ERF) family transcription factors among different plants.
A total of 3332 AP2/ERF factors were identified (Fig. 5).
All five subfamilies, namely DREB, ERF, AP2, RAV, and
Soloist, were identified in land plants except in rice and
Arabidopsis lyrata (L.) O’Kane & Al-Shehbaz, which did
not contain a factor from the Soloist subfamily. Among
20 plant species, Chinese cabbage [Brassica rapa L. subsp.
chinensis (L.) Hanelt] contained the most number of AP2/
ERF family TFs (289 AP2/ERF factors). In dicots, the
number of AP2/ERF factors in tomato (167) exceeded
those of A. thaliana (147), watermelon [Citrullus lanatus
(Thunb.) Matsum. & Nakai] (145), and grapevine (Vitis
vinifera L.) (132). However, more AP2/ERF TFs were found
in turnip (B. rapa L.) (289), apple (Malus domestica Borkh.)
(259), and potato (231). The AP2/ERF protein density in
tomato (0.186) was the lowest among dicots. The number
of AP2/ERF TFs in land plants was larger than in algae.
Only 24 and nine factors were found in Chlamydomonas
reinhardtii and Ostreococcus lucimarinus, respectively.
As shown in Fig. 5, the TF numbers in the ERF subfamily were the largest among the five subfamilies except
in A. lyrata, watermelon, and Brachypodium distachyon
(L.) Beauv. Numbers in the ERF subfamily were twice that
in the DREB subfamily in certain species, such as potato,
maize (Zea mays L.), and barley. In tomato, the number of
ERF factors (88) was considerably larger than those from
other subfamilies (DERB, 49; AP2, 26; RAV, 3; and Soloist, 1). At the same time, 16 factors that were induced in
response to TYLCV infection were classified into the ERF
subfamily, and only four, one, and one factor belonged to
DERB, AP2, and RAV subfamilies, respectively.
As model plants, Arabidopsis and rice were selected
to construct a comparative analysis with tomato to analyze the paralogs and orthologs (Fig. 6). Fifty-seven and
32 pairs of orthologous AP2/ERF factors were identified
between tomato and Arabidopsis and between tomato
and rice, respectively. Moreover, 83, 43, and 76 paralogs
were located in Arabidopsis, rice, and tomato, respectively.
Among 22 SlAP2/ERF TFs that were induced in response
to TYLCV infection, seven and one orthologs were found
between tomato and Arabidopsis and between tomato and
rice, respectively (Supplemental Table S3). Twelve paralogs
were identified in tomato (Supplemental Table S4).
Distribution of SlAP2/ERF Transcription Factors
Involved in Response to Tomato Yellow Leaf Curly
Virus in Tomato Chromosome
A total of 167 AP2/ERF TFs were distributed on 12
tomato chromosomes (Fig. 7). The AP2/ERF TFs of
tomato were mainly distributed on chromosome 3 (26),
followed by chromosome 1 (18), chromosome 8 (15), and
chromosome 12 (14). The proportion in chromosome 7
(6) was minimal (3.59%) (Supplemental Fig. S11A). The
22 SlAP2/ERF TFs involved in response to TYLCV infection were distributed on chromosomes 1 to 10, except
chromosomes 11 and 12. The 22 SlAP2/ERF factors were
mainly distributed on chromosomes 3, 4, and 8, each
with four, five, and four (18.18, 22.73, and 18.18%, respectively) (Supplemental Fig. S11B). The selected five SlERFs,
namely Soly19, Soly36, Soly106, Soly67, and Soly66, were
distributed on chromosomes 2, 3, 9, 5, and 5, respectively.
Interaction Network of AP2/ERF Factors Involved
in Tomato Yellow Leaf Curly Virus Infection
An interaction network of AP2/ERF factors in tomato was
developed using the orthologous TFs in Arabidopsis to further analyze the correlations among tomato AP2/ERF factors
(Fig. 8). Red, blue, and green lines represented the correlation
of AP2/ERF factors under different values of Pearson correlation coefficient (PCC). A total of 115 pairs (PCC > 0) were
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 7
of
15
Fig. 6. Comparative analysis of synteny between tomato and two other model plant species. Five Arabidopsis (At01 to At05), 12
tomato (S101 to S112), and 12 rice (Os01 to Os12) chromosomes were based on orthologous and paralogous pair positions and
demonstrated highly conserved synteny. Blue and yellow lines represent orthologous AP2/ERF genes among three species. Red lines
represent paralogous AP2/ERF genes in tomato, Arabidopsis, and rice.
identified, and 43 pairs showed negative correlation (PCC <
0). A total of 21 pairs could not be calculated.
As shown in Fig. 8, numerous AP2/ERF proteins were identified to interact with other proteins
in the tomato genome. Three AP2/ERF proteins
(Solyc01 g108240.2.1, Solyc08 g078190.1.1, and Solyc09
g089930.1.1) that responded to TYLCV interacted with
MAPK 2 (Solyc08 g014420.2.1). Solyc01 g108240.2.1 and
Solyc08 g078190.1.1 showed positive correlation with
MAPK, whereas Solyc09 g089930.1.1 was potentially
8
of
15
negatively correlated with MAPK. As universal signal
transduction pathways, MAPK cascades could activate
plant defense against fungal and viral attacks (Desikan et
al., 2001; Nuhse et al., 2000). Previous study had shown
that after inoculation with TYLCV, the abundance of
MAPK showed a less pronounced decline (Gorovits et
al., 2007).
Transcription factor proteins Solyc11 g072600.1.1,
Solyc06 g075510.2.1, and Solyc02 g077840.1.1 showed
potential contact with numerous proteins, such as TCP
the pl ant genome

ju ly 2016

vol . 9, no . 2
Fig. 7. Chromosome distribution of SlAP2/ERF factors in tomato. Blue indicates the 22 SlAP2/ERF factors in response to tomato yellow
leaf curly virus infection.
and thioredoxin, which indicated that ERF TFs played
important roles in transcriptional level regulation (Fig.
8). The interaction network of SlAP2/ERF factors in
tomato showed that the response mechanisms to TYLCV
in tomato were complicated by interacting with other
proteins in tomato genome.
SlERF Proteins Interact Specifically with GCC-Box
The AP2/ERF TFs could bind to the GCC-box AGCCGCC (Gutterson and Reuber, 2004). To analyze whether
the tomato SlERF TFs involved in TYLCV infection possessed the ability to bind to the GCC-box element, yeast
one-hybrid method was used; this method was identified
as effective for this purpose (Ou et al., 2011; Ye et al.,
2004). The GCC-box binding activities of five selected
genes belonging to ERF-B3 subfamily were identified in
two tomato cultivars, namely Zheza-301 (resistant cultivar) and Xianke-6(susceptible cultivar) (Fig. 9). Betagalactosidase activity indicated that the SlERF factors
could bind to GCC-box (Fig. 9B). Soly106 showed high
binding ability in both Zheza-301 and Xianke-6. The
binding ability of Soly19 to the GCC element in Zheza301 was higher than to that in Xianke-6. The binding
ability of Soly36 and Soly66 in Zheza-301 was weaker
than in Xianke-6. However, Soly67 did not bind or presented weak binding ability to GCC-box in Xianke-6.
Expression Profiles of Selected SlERF Genes
in Response to Tomato Yellow Leaf Curly Virus
Infection in Tomato
The expression profiles of five genes (Soly19, Soly36,
Soly106, Soly67, and Soly66) were analyzed to confirm
whether SlERFs were involved in the defense responses
of tomato to TYLCV. The five SlERF genes, classified
into ERF-B3 subfamily, had close relationship with genes
PpERFs, OsERF922, TaPIEP1, and Opbp1. As shown in
Fig. 10, the expression levels varied not only among genes
but also among tomato cultivars. In the overall trend, the
expression levels of five genes generally increased after
inoculation with TYLCV, except for Soly36 and Soly66,
which were downregulated in Xianke-6 and Hongbeibei,
respectively. In the highly resistant cultivar Hongbeibei,
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 9
of
15
Fig. 8. The interaction network of AP2/ERF factors in tomato according to orthologs in Arabidopsis.
Fig. 9. Yeast one-hybrid and b-galactosidase activity assays. (A) GCC-box-binding of five ERF-B3 transcription factors. The pictures
were captured after 12 h at 30°C with 20 mg mL−1 X-gal incubation on SD/-Ura/-Trp medium. (B) Relative b-galactosidase activity of
ERFs that bind to the GCC-box element. The data was calculated with independent clones for three replicates.
the expression patterns of Soly19 and Soly106 increased
by 4.5 (after 15 d) and 7.93 times (after 8 d), respectively.
Four genes (Soly19, Soly36, Soly67, and Soly106) were
upregulated in resistant cultivars Zheza-301 and Zhefen-702. In susceptible cultivars, the expression levels of
Soly36 were insensitive in Jinpeng-1 and downregulated
in Xianke-6. Soly106 showed upregulated expression patterns in the five tomato cultivars.
10
of
15
Discussion
As a major plant crop and a model system for scientific
research, tomato production worldwide was threatened
by the whitefly-transmitted geminiviruses, especially
TYLCV (Jones et al., 2008; Liu et al., 2012). The resistant
ability to TYLCV infection varies following the different
tomato cultivars. After TYLCV infection for 2 mo, Hongbeibei has high TYLCV resistance with only 15% disease
incidence, Zhefen-702 and Zheza-301 have middle level
resistance with 50 and 45% disease incidence, respectively,
the pl ant genome

ju ly 2016

vol . 9, no . 2
Fig. 10. Expression levels of five SlERF-B3 genes after tomato yellow leaf curly virus infection in tomato.
and with both above 90% disease incidence, Xianke-6
and Jinpeng-1 are identified to be susceptible to TYLCV.
These five tomato cultivars with different resistant abilities
to TYLCV infection were chosen to analyze the defense
mechanism between AP2/ERF TFs and TYLCV infection.
Genes in Response to Tomato Yellow
Leaf Curly Virus Infection
When faced with pathogen infection, a defense system that combines physical and chemical barriers to
protect the plant from damage is induced (Sade et al.,
2015). Plant diseases can cause considerable losses to
agriculture worldwide (Anderson et al., 2004). As the
model plant of the Solanaceae family, tomato production decreases because of damage from TYLCV, which
is transmitted by the whitefly B. tabaci. At present, the
genetic structure and population variability of TYLCV
is extensively studied (Ge et al., 2007). Identifying five
important resistance genes, namely Ty-1, Ty-2, Ty-3, Ty-4,
and Ty-5, was crucial. Aside from the five major genes,
numerous other genes play important roles in resistance
against TYLCV such as GroEL (Morin et al., 1999) and
CLNLR (Li et al., 2014). The TYLCV defense mechanism in tomato involves a complex signal transduction
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 11
of
15
network. Thus, taking alternative measures to increase
the resistance of tomato to TYLCV based on thorough
knowledge of plant defense responses is necessary.
AP2/ERF Factors Involved in Response
to Tomato Yellow Leaf Curly Virus Infection
in Higher Plants
As a large transcription factor family, AP2/ERF factors
play important roles not only in plant development but
also in pathogen defense. Numerous research works
demonstrated that overexpression of the ERF factor
could increase the resistance to fungal, bacterial, and
viral pathogens. In our study, 167 SlAP2/ERF TFs were
identified in tomato, and according to the transcriptome
data, 22 AP2/ERF TFs were identified at different expression levels in response to TYLCV infection in resistant
vs. susceptible tomato cultivars (Chen et al., 2013).
Sequence alignment showed that the AP2 domain consisting of ~58 to 59 amino acids was identified in all 22
SlAP2/ERF factors. Seven conserved amino acids existed
in three-stranded, antiparallel b sheets of the AP2
domain. Among the 22 SlAP2/ERF factors, a total of 16
factors belonged to the ERF subfamily, whereas only four,
one, and one factors were identified in the DERB, AP2,
and RAV subfamilies, respectively.
The GCC-box Binding Ability of SlERF Factors
in Response to Tomato Yellow Leaf Curly Virus
Infection in Different Tomato Cultivars
Ethylene response factors can bind a short cis-acting
element GCC-box (AGCCGCC) by seven amino acid
residues, namely arginine29 (Arg29), arginine31 (Arg31),
tryptophan33 (Trp33), glutamic acid39 (Glu39), arginine41 (Arg41), arginine49 (Arg49), and tryptophan5
(Trp5) (Allen et al., 1998; Ohme-Takagi and Shinshi,
1995). Consisting of seven amino acids residues, the b
sheet in the AP2 domain may play an important role in
the formation of the domain GCC-box complex (Allen
et al., 1998). Yeast one-hybrid was constructed to analyze
the GCC-box binding ability of five factors in Zheza-301
(resistant cultivar) and Xianke-6 (susceptible cultivar)
(Fig. 9). According to b-galactosidase activity, each factor could bind the GCC-box except for Soly67, which
exhibited weak or no binding ability in Xianke-6. Soly19
factor showed the strongest binding ability with a 19-fold
increase. As shown in Fig. 3, the AP2 domain was identified in five ERF factors with seven conserved residues
and other nonconserved residues. The binding specificity
of the seven amino acid residues to the GCC-box varied
(Wang et al., 2009). Arg29, Glu39, and Arg41 showed the
primary DNA binding capability of AtERFs, whereas
Arg31, Arg49, and Trp51 exhibited different binding
preferences. Differences may also exist among five SlERF
factors, thereby resulting in different binding abilities to
the GCC-box. Previous studies showed that the change of
12
of
15
Glu156 to Arg and of phenylalanine62 (Phe62) to serine
(Ser) increased the GCC-box binding ability of BnaERFB3-hy15 (Jin et al., 2010, Xiong et al., 2013). The alanine14
(Ala14) and aspartic acid19 (Asp19) played important
roles in recognizing the DNA-binding sequence (Liu et
al., 2006). The diverse binding ability among five SlERF
factors may be related to the binding specificity of the
seven conserved amino acids. Other key residues that
may affect the binding ability also need to be analyzed.
Results indicated that the binding ability between ERF
factors and GCC-box was necessary but was complicated.
Interaction network indicated AP2/ERF TFs could
interact with other proteins such as MAPK, which could
regulate the expression of MAPKs. As we know, MAPK
cascades took part in regulation of response to hormones, biological and environment stresses, and showed
decreased expression levels after TYLCV infection
(Gorovits et al., 2007). Previous study demonstrated that
OsERF3 positively regulated transcriptional of at least
two MAPKs (Lu et al., 2011). As upstream regulators,
MAPKs also mediated some WRKY TFs, which could
regulated the biosynthesis of jasmonic acid (JA), salicylic
acid (SA), ethylene, and H2O2 (Pandey and Somssich,
2009). OsEREBF1 could be phosphorylated by BWMW1
in vitro, a rice MAPK protein, and enhanced the ability
of OsERFPF1 to bind the GCC-box DNA motif, which
was suggested to be an advantageous function in multiple stresses in plants (Cheong et al., 2003). Those studies suggest that when faced with TYLCV infection, ERF
TFs in tomato may regulate the signal pathway of JA, SA,
ethylene, and H2O2 by mediating MAPKs and WRKY
to resist the stress. Apart from MAPK, ERF TFs could
interact with TCP and thioredoxin in tomato as shown in
Fig. 8. All the results showed a complex defense mechanism of AP2/ERF TFs in response to TYLCV infection.
Expression Profiles of SlERF Genes in
Response to Tomato Yellow Leaf Curly Virus
Infection in Different Tomato Cultivars
To investigate whether SlERF factors are involved in
responses to TYLCV, the expression patterns of five
genes encoding SlERFs were analyzed in resistant and
susceptible tomato cultivars. As shown in Fig. 10, the
expression levels of five SlERF genes varied. Three SlERF
genes (Soly19, Soly67, and Soly106) showed more rapid
and vigorous expression levels in resistant and susceptible tomato cultivars, whereas the expression levels of
Soly66 in the resistant cultivar were much smaller than
in the susceptible cultivar. The expression level of this
gene increased by 6.3-fold in Xianke-6 after 4 d. Soly36
also showed different expression profiles in resistant and
susceptible cultivars. The expression levels were considerably higher in resistant cultivars, reaching 16 times in
Zheza-301 after 8 d. There was research found that the
expression patterns of TaERF3 in resistant and susceptible cultivars varied after inoculation with various pathogens (Zhang et al., 2007). Five ERF genes (Pp-ERF1.a,
the pl ant genome

ju ly 2016

vol . 9, no . 2
Pp-ERF1.b, Pp-ERF2.a, Pp-ERF2.b, and Pp-ERF2.c) were
identified in peach [Prunus persica (L.) Batsch], among
which Pp-ERF2.b showed higher transcript level in the
susceptible cultivar than in the resistant cultivar after
infection with Xanthomonas campestris (Sherif et al.,
2012). The differences in response to TYLCV in different
tomato cultivars may be related to the specificity of different ERFs to different types of pathogens.
The expression levels of Soly19 and Soly67 in Zheza301 (resistant cultivar) were considerably higher than in
Xianke-6 (susceptible cultivar), thereby indicating that
the binding ability to GCC-box in Zheza-301 was stronger than in Xianke-6. Soly106, which exhibited GCC-box
binding ability that is similar to Soly19, showed the same
expression patterns in the two tomato cultivars. By contrast, Soly66 showed a higher expression level that corresponded to GCC-box binding ability in Xianke-6 than in
Zheza-301. The results indicated that the ability to induce
resistance against TYLCV varied among ERFs in different tomato cultivars, and such difference may be related
to the binding ability of the transcription factors to the
GCC-box. Several amino acids differ in each SlERF
between Zheza-301 and Xianke-6, which may have
affected the expression response to TYLCV infection.
Numerous studies have demonstrated that AP2/ERF
TFs play important roles during various stress response
such as abiotic and biotic stresses (Dong et al., 2010;
Guo et al., 2004; Licausi et al., 2013). Less information is
available about their function in defense against TYLCV
infection. The expression levels of AP2/ERF TFs in resistant and susceptible tomato cultivars showed different
function patterns in anti-TYLCV infection, which, given
the difference, choose for tomato breeders. Based on
our research, a new opportunity is provided for further
understand the new function of AP2/ERF TFs family in
the process of mediating TYLCV infection. The study
also paves the way to investigate the unknown defense
mechanism against TYLCV infection in tomato.
Conclusions
When encountered with TYLCV infection, tomato
plants may be considered to inhibit the replication and
movement of virus by interconnecting gene networks
and signaling pathways. Our study is the first to analyze
the relationship between ERFs and TYLCV infection
in tomato. Previous research indicated that AP2/ERFs
interacted with numerous other tomato genes (such as
MAPK), which played important roles in activating plant
defense against fungal and viral attacks. The AP2/ERF
factors could respond to TYLCV infection with positive
or negative expression patterns and by interacting with
other genes and regulating the signal pathway of JA, SA,
ethylene, and H2O2. The TYLCV defense mechanisms in
tomato are a complicated network. At present, the transgenic system and proteomics are being developed by our
group, and we are preparing to transfer the five SlERF
genes to different tomato cultivars to further analyze the
functional mechanisms of ERFs and TYLCV. Moreover,
as functional molecules, proteins play vital roles in the
living cell, and we are preparing to use the proteomics
approach to identify the protein that respond to TYLCV
infection to improve tomato TYLCV resistance.
Competing Interests
The authors declare that they have no competing interests.
Author Contributions
Conceived and designed the experiments: ASX YH. Performed the experiments: YH, MYL, FW, SS, GMX, YST,
BLZ, ASX. Analyzed the data: YH, MYL, ASX. Contributed reagents/materials/analysis tools: ASX. Wrote the
paper: YH. Revised the paper: ASX YH. All authors read
and approved the final manuscript.
Acknowledgments
The research was supported by Jiangsu Natural Science Foundation
(BK20130027), Shanxi Province Coal Based Key Scientific and Technological Project (FT201402-07), New Century Excellent Talents in University (NCET-11-0670), and Priority Academic Program Development of
Jiangsu Higher Education Institutions Project.
References
Akad, F., A. Eybishtz, D. Edelbaum, R. Gorovits, O. Dar-Issa, N. Iraki, et
al. 2007. Making a friend from a foe: Expressing a GroEL gene from
the whitefly Bemisia tabaci in the phloem of tomato plants confers
resistance to tomato yellow leaf curl virus. Arch. Virol. 152:1323–
1339. doi:10.1007/s00705-007-0942-0
Allen, M.D., K. Yamasaki, M. Ohme-Takagi, M. Tateno, and M. Suzuki.
1998. A novel mode of DNA recognition by a b-sheet revealed by the
solution structure of the GCC-box binding domain in complex with
DNA. EMBO J. 17:5484–5496. doi:10.1093/emboj/17.18.5484
Anbinder, I., M. Reuveni, R. Azari, I. Paran, S. Nahon, H. Shlomo,
L. Chen, M. Lapidot, and I. Levin. 2009. Molecular dissection of
tomato leaf curl virus resistance in tomato line TY172 derived from
Solanum peruvianum. Theor. Appl. Genet. 119:519–530. doi:10.1007/
s00122-009-1060-z
Anderson, P.K., A.A. Cunningham, N.G. Patel, F.J. Morales, P.R. Epstein,
and P. Daszak. 2004. Emerging infectious diseases of plants: Pathogen pollution, climate change and agrotechnology drivers. Trends
Ecol. Evol. 19:535–544. doi:10.1016/j.tree.2004.07.021
Asahina, M., K. Azuma, W. Pitaksaringkarn, T. Yamazaki, N. Mitsuda,
M. Ohme-Takagi, et al. 2011. Spatially selective hormonal control
of RAP2.6L and ANAC071 transcription factors involved in tissue
reunion in Arabidopsis. Proc. Natl. Acad. Sci. USA 108:16128–16132.
doi:10.1073/pnas.1110443108
Bailey, T.L., M. Boden, F.A. Buske, M. Frith, C.E. Grant, L. Clementi, et
al. 2009. MEME SUITE: Tools for motif discovery and searching.
Nucleic Acids Res. 37:W202–W208. doi:10.1093/nar/gkp335
Cao, Y., S. Chen, and J. Zhang. 2008. Ethylene signaling regulates salt
stress response: An overview. Plant Signal. Behav. 3:761–763.
doi:10.4161/psb.3.10.5934
Chen, N., Q. Yang, M. Su, L. Pan, X. Chi, M. Chen, et al. 2012. Cloning of
six ERF family transcription factor genes from peanut and analysis of their expression during abiotic stress. Plant Mol. Biol. Rep.
30:1415–1425. doi:10.1007/s11105-012-0456-0
Chen, T., Y. Lv, T. Zhao, N. Li, Y. Yang, W. Yu, et al. 2013. Comparative transcriptome profiling of a resistant vs. susceptible tomato
(Solanum lycopersicum) cultivar in response to infection by tomato
yellow leaf curl virus. PLoS ONE 8:e80816. doi:10.1371/journal.
pone.0080816
Chenna, R., H. Sugawara, T. Koike, R. Lopez, T.J. Gibson, D.G. Higgins,
et al. 2003. Multiple sequence alignment with the Clustal series of
programs. Nucleic Acids Res. 31:3497–3500. doi:10.1093/nar/gkg500
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 13
of
15
Cheong, Y.H., B.C. Moon, J.K. Kim, C.Y. Kim, M.C. Kim, et al. 2003.
BWMK1, a rice mitogenactivated protein kinase, locates in the
nucleus and mediates pathogenesis-related gene expression by
activation of a transcription factor. Plant Physiol. 132:1961–1972.
doi:10.1104/pp.103.023176
Desikan, R., J.T. Hancock, K. Ichimura, K. Shinozaki, and S.J. Neill. 2001.
Harpin induces activation of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6. Plant Physiol. 126:1579–1587.
doi:10.1104/pp.126.4.1579
Dong, N., X. Liu, Y. Lu, L. Du, H. Xu, H. Liu, et al. 2010. Overexpression of TaPIEP1, a pathogen-induced ERF gene of wheat, confers
host-enhanced resistance to fungal pathogen Bipolaris sorokiniana.
Funct. Integr. Genomics 10:215–226. doi:10.1007/s10142-009-0157-4
Fernandez-Pozo, N., M. Naama, J.D. Edwards, S. Surya, I.Y. Tecle, S.R.
Strickler, et al. 2015. The Sol Genomics Network (SGN): From genotype to phenotype to breeding. Nucleic Acids Res. 43:D1036–D1041.
doi:10.1093/nar/gku1195
Gasteiger, E., A. Gattiker, C. Hoogland, I. Ivanyi, R.D. Appel, and A.
Bairoch. 2003. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31:3784–3788.
doi:10.1093/nar/gkg563
Ge, L., J. Zhang, X. Zhou, and H. Li. 2007. Genetic structure and population variability of tomato yellow leaf curl China virus. J. Virol.
81:5902–5907. doi:10.1128/JVI.02431-06
Gorovits, R., F.H. Akad, F. Vidavsky, A. Mahadav, and H. Czosnek. 2007.
Expression of stress-response proteins upon whitefly-mediated
inoculation of tomato yellow leaf curl virus in susceptible and
resistant tomato plants. Mol. Plant Microbe Interact. 20:1376–1383.
doi:10.1094/MPMI-20-11-1376
Guo, Z., X. Chen, X. Wu, J. Ling, and P. Xu. 2004. Overexpression of the
AP2/EREBP transcription factor OPBP1 enhances disease resistance and salt tolerance in tobacco. Plant Mol. Biol. 55:607–618.
doi:10.1007/s11103-004-1521-3
Gutterson, N., and T.L. Reuber. 2004. Regulation of disease resistance
pathways by AP2/ERF transcription factors. Curr. Opin. Plant Biol.
7:465–471. doi:10.1016/j.pbi.2004.04.007
Hanson, P., S.K. Green, and G. Kou. 2006. Ty-2, a gene on chromosome
11 conditioning geminivirus resistance in tomato. Tomato Genetics
Coop. Rep. 56:17–18.
Huang, Y., M. Li, F. Wang, Z. Xu, W. Huang, G. Wang, et al. 2015. Heat
shock factors in carrot: Genome-wide identification, classification,
and expression profiles response to abiotic stress. Mol. Biol. Rep.
42:893–905. doi:10.1007/s11033-014-3826-x
Ji, Y., D. Schuster, and J. Scott. 2007. Ty-3, a begomovirus resistance locus
near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol. Breed. 20:271–284. doi:10.1007/s11032007-9089-7
Ji, Y., J.W. Scott, D.J. Schuster, and D.P. Maxwell. 2009. Molecular mapping of Ty-4, a new Tomato yellow leaf curl virus resistance locus on
chromosome 3 of Tomato. J. Am. Soc. Hortic. Sci. 134:281–288.
Jin, X.F., B. Zhu, R. Peng, H. Jiang, J. Chen, J. Zhuang, et al. 2010. Optimizing the binding activity of the AP2/ERF transcription factor
with the GCC box element from Brassica napus by directed evolution. BMB Rep. 43:567–572. doi:10.5483/BMBRep.2010.43.8.567
Jones, C.M., K. Gorman, I. Denholm, and M.S. Williamson. 2008. Highthroughput allelic discrimination of B and Q biotypes of the whitefly, Bemisia tabaci, using TaqMan allele-selective PCR. Pest Manag.
Sci. 64:12–15. doi:10.1002/ps.1482
Jung, J., S.Y. Won, S.C. Suh, H. Kim, R. Wing, Y. Jeong, et al. 2007. The
barley ERF-type transcription factor HvRAF confers enhanced
pathogen resistance and salt tolerance in Arabidopsis. Planta
225:575–588. doi:10.1007/s00425-006-0373-2
Kimura, S., and N. Sinha. 2008. Tomato (Solanum lycopersicum): A model
fruit-bearing crop. Cold Spring Harbor Protocols 2008. doi:10.1101/
pdb.emo105
Klee, H.J., and J.J. Giovannoni. 2011. Genetics and control of tomato
fruit ripening and quality attributes. Annu. Rev. Genet. 45:41–59.
doi:10.1146/annurev-genet-110410-132507
14
of
15
Krzywinski, M., J. Schein, I. Birol, J. Connors, R. Gascoyne, D. Horsman, et al. 2009. Circos: An information aesthetic for comparative
genomics. Genome Res. 19:1639–1645. doi:10.1101/gr.092759.109
Lapidot, M. 2007. Screening for TYLCV-resistance plants using
whitefly-mediated inoculation. In: H. Czosnek, editor, Tomato
yellow leaf curl virus disease. Springer, Netherlands. p. 329–342.
doi:10.1007/978-1-4020-4769-5_19
Lefeuvre, P., D.P. Martin, G. Harkins, P. Lemey, A.J. Gray, S. Meredith, et
al. 2010. The spread of tomato yellow leaf curl virus from the Middle
East to the world. PLoS Pathog. 6:e1001164. doi:10.1371/journal.
ppat.1001164
Li, L., C.J. Stoeckert, Jr., and D. S. Roos. 2003. OrthoMCL: Identification
of ortholog groups for eukaryotic genomes. Genome Res. 13:2178–
2189. doi:10.1101/gr.1224503
Li, N., M. Yang, T. Chen, B. Zhang, T. Zhao, T.M. Zhao, et al. 2014. Functional characterization of ClNLR gene involved in tomato defense
against tomato yellow leaf curl disease. Acta Hortic. Sin. 41:889–897.
Licausi, F., O.T. Masaru, and P. Pierdomenico. 2013. APETALA2/Ethylene Responsive Factor (AP2/ERF) transcription factors: Mediators of stress responses and developmental programs. New Phytol.
199:639–649. doi:10.1111/nph.12291
Liu, D., X. Chen, J. Liu, J. Ye, and Z. Guo. 2012. The rice ERF transcription
factor OsERF922 negatively regulates resistance to Magnaporthe
oryzae and salt tolerance. J. Exp. Bot. 63:3899–3911. doi:10.1093/jxb/
ers079
Liu, Y., T. Zhao, W. Liu, Y. Yan, and H. Zhou. 2006. The conserved Ala37
in the ERF/AP2 domain is essential for binding with the DRE element and the GCC box. FEBS Lett. 580:1303–1308. doi:10.1016/j.
febslet.2006.01.048
Lu, J., H. Ju, G. Zhou, C. Zhu, M. Erb, X. Wang, P. Wang, and Y. Lou.
2011. An EAR‐motif‐containing ERF transcription factor affects
herbivore‐induced signaling, defense and resistance in rice. Plant J.
68:583–596. doi:10.1111/j.1365-313X.2011.04709.x
Maes, T., N. Van de Steene, J. Zethof, M. Karimi, M. D’Hauw, G. Mareset,
et al. 2001. Petunia Ap2-like genes and their role in flower and seed
development. Plant Cell 13:229–244. doi:10.1105/tpc.13.2.229
Morin, S., M. Ghanim, M. Zeidan, H. Czosnek, M. Verdeek, and J.F.J.M.
van den Heuvel. 1999. A GroEL homologue from endosymbiotic
bacteria of the whitefly Bemisia tabaci is implicated in the circulative transmission of tomato yellow leaf curl virus. Virology 256:75–
84. doi:10.1006/viro.1999.9631
Mueller, L.A., T.H. Solow, N. Taylor, B. Skwarecki, R. Buels, J. Binns,
et al. 2005. The SOL Genomics Network: A comparative resource
for Solanaceae biology and beyond. Plant Physiol. 138:1310–1317.
doi:10.1104/pp.105.060707
Nuhse, T.S., S.C. Peck, H. Hirt, and T. Boller. 2000. Microbial elicitors
induce activation and dual phosphorylation of the Arabidopsis
thaliana MAPK 6. J. Biol. Chem. 275:7521–7526. doi:10.1074/
jbc.275.11.7521
Ohme-Takagi, M., and H. Shinshi. 1995. Ethylene-inducible DNA-binding proteins that interact with an ethylene-responsive element. Plant
Cell 7:173–182. doi:10.1105/tpc.7.2.173
Olaiya, C.O., 2011. Bioregulators favourably affect the levels of vitamins
and sugars in tomato fruit tissues. Vegetable Crops Research Bulletin 75:71–79. doi:10.2478/v10032-011-0019-1
Ou, B., K.Q. Yin, S.N. Liu, Y. Yang, T. Gu, J.M. Wing Hui, et al. 2011. A
high-throughput screening system for Arabidopsis transcription factors and its application to Med25-dependent transcriptional regulation. Mol. Plant 4:546–555. doi:10.1093/mp/ssr002
Pandey, S.P., and I.E. Somssich. 2009. The role of WRKY transcription factors in plant immunity. Plant Physiol. 150:1648–1655.
doi:10.1104/pp.109.138990
Pfaffl, M. 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acids Res. 29:E45. doi:10.1093/
nar/29.9.e45
PREMIER Biosoft. 2012. Primer Premier version 5.0 software. PREMIER
Biosoft, Palo Alto, CA.
Sade, D., O. Shriki, A. Cuadros-Inostroza, T. Tohge, Y. Semel, Y. Havivet,
et al. 2015. Comparative metabolomics and transcriptomics of plant
response to Tomato yellow leaf curl virus infection in resistant and
the pl ant genome

ju ly 2016

vol . 9, no . 2
susceptible tomato cultivars. Metabolomics 11:81–97. doi:10.1007/
s11306-014-0670-x
Schauer, N., Y. Semel, I. Balbo, M. Steinfath, D. Repsilber, J. Selbig, et al.
2008. Mode of inheritance of primary metabolic traits in tomato.
Plant Cell 20:509–523. doi:10.1105/tpc.107.056523
Sherif, S., I. El-Sharkawy, G. Paliyath, and S. Jayasankar. 2012. Differential expression of peach ERF transcriptional activators in
response to signaling molecules and inoculation with Xanthomonas
campestris pv. pruni. J. Plant Physiol. 169:731–739. doi:10.1016/j.
jplph.2012.02.003
Shi, J.X., S. Malitsky, S. De Oliveira, C. Branigan, R.B. Franke, L. Schreiber, et al. 2011. SHINE transcription factors act redundantly to
pattern the archetypal surface of Arabidopsis flower organs. PLoS
Genet. 7:E1001388. doi:10.1371/journal.pgen.1001388
Shin, R., J.M. Park, J.M. An, and K.H. Paek. 2002. Ectopic expression
of Tsi1 in transgenic hot pepper plants enhances host resistance to
viral, bacterial, and oomycete pathogens. Mol. Plant Microbe Interact. 15:983–989. doi:10.1094/MPMI.2002.15.10.983
Song, X., G. Liu, W. Duan, T. Liu, Z. Huang, J. Ren, et al. 2014. Genomewide identification, classification and expression analysis of the heat
shock transcription factor family in Chinese cabbage. Mol. Genet.
Genomics 289:541–551. doi:10.1007/s00438-014-0833-5
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar.
2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony
methods. Mol. Biol. Evol. 28:2731–2739. doi:10.1093/molbev/msr121
The Tomato Genome Consortium. 2015. The tomato genome sequence
provides insights into fleshy fruit evolution. Nature 485:635–641.
doi:10.1038/nature11119
Tsaftaris, A.S., K. Pasentsis, P. Madesis, and A. Argiriou. 2012. Sequence
characterization and expression analysis of three APETALA2like genes from saffron crocus. Plant Mol. Biol. Rep. 30:443–452.
doi:10.1007/s11105-011-0355-9
Wang, S., S. Yang, Y. Yin, J. Xi, S. Li, and D. Hao. 2009. Molecular dynamics simulations reveal the disparity in specific recognition of GCCbox by AtERFs transcription factors superfamily in Arabidopsis. J.
Mol. Recognit. 22:474–479. doi:10.1002/jmr.965
Xiong, A., H. Jiang, J. Zhuang, R. Peng, X. Jin, B. Zhu, et al. 2013. Expression and function of a modified AP2/ERF transcription factor from
Brassica napus enhances cold tolerance in transgenic Arabidopsis.
Mol. Biotechnol. 53:198–206. doi:10.1007/s12033-012-9515-x
Yamaguchi-Shinozaki, K., and K. Shinozaki. 2006. Transcriptional regulatory networks in cellular responses and tolerance to dehydration
and cold stresses. Annu. Rev. Plant Biol. 57:781–803. doi:10.1146/
annurev.arplant.57.032905.105444
Ye, R., Q. Yao, Z.H. Xu, and H.W. Xue. 2004. Development of an efficient
method for the isolation of factors involved in gene transcription
during rice embryo development. Plant J. 38:348–357. doi:10.1111/
j.1365-313X.2004.02037.x
Zamir, D., I. Ekstein-Michelson, Y. Zakay, N. Navot, M. Zeidan, M. Sarfatti, et al. 1994. Mapping and introgression of a tomato yellow leaf
curl virus tolerance gene, Ty-1. Theor. Appl. Genet. 88:141–146.
doi:10.1007/BF00225889
Zhang, J., C.D. Broeckling, E.B. Blancaflor, M.K. Sledge, L.W. Sumner,
and Z. Wang. 2005. Overexpression of WXP1, a putative Medicago
truncatula AP2 domain-containing transcription factor gene,
increases cuticular wax accumulation and enhances drought tolerance in transgenic alfalfa (Medicago sativa). Plant J. 42:689–707.
doi:10.1111/j.1365-313X.2005.02405.x
Zhang, Z., W. Yao, N. Dong, H. Liang, H. Liu, and R. Huang. 2007. A
novel ERF transcription activator in wheat and its induction kinetics after pathogen and hormone treatments. J. Exp. Bot. 58:2993–
3003. doi:10.1093/jxb/erm151
huang et al .: ap 2/erf tfs responded to t ylcv in tom ato 15
of
15