Carcinogenesis vol.25 no.9 pp.1575--1585, 2004
doi:10.1093/carcin/bgh159
Enhanced expression of 14-3-3sigma in pancreatic cancer and its role in cell cycle
regulation and apoptosis
Ahmed Guweidhi1, J
org Kleeff1, Nathalia Giese1, Jamael
1
El Fitori , Knut Ketterer1,3, Thomas Giese2, Markus
W.B
uchler1, Murray Korc3 and Helmut Friess1,4
1
Department of General Surgery, University of Heidelberg, Germany,
Department of Immunology, University of Heidelberg, Germany and
Departments of Medicine, and Pharmacology and Toxicology, Dartmouth
Hitchcock Medical Center, Dartmouth Medical School, Lebanon, NH 03756,
USA
2
3
4
To whom correspondence should be addressed
Email: [email protected]
14-3-3sigma belongs to the 14-3-3 family of proteins, which
are involved in the modulation of diverse signal transduction pathways. Loss of 14-3-3sigma expression has been
observed in a number of human cancers, suggesting that
it may have a role as a tumor suppressor gene. The aim of
the study was to investigate the expression and the functional role of 14-3-3sigma in pancreatic ductal adenocarcinoma (PDAC). Expression of 14-3-3sigma was analyzed
using laser capture microdissection (LCM), quantitative
real-time--PCR (QRT--PCR), DNA arrays, immunohistochemistry and western blot analysis. The role of 14-33sigma in apoptosis and cell cycle regulation was evaluated
by western blotting, immunoprecipitation and FACS
analysis. By QRT--PCR, 14-3-3sigma mRNA levels were
54-fold increased in pancreatic adenocarcinoma in comparison with normal pancreatic samples and localized in
pancreatic cancer cells as determined by LCM. In pancreatic cancer cells, the degree of 14-3-3sigma expression was
not decisive for the maintenance of G2 /M cell cycle checkpoint or induction of apoptosis. Responses to radiation or
apoptosis-inducing agents were neither accompanied by a
significant 14-3-3sigma accumulation nor by a change
in association of 14-3-3sigma with cdc2, bad and bax. In
conclusion, the marked over-expression of 14-3-3sigma in
PADC together with multiple known genetic and epigenetic
alterations of potential 14-3-3sigma interacting partners
suggests an important role of aberrant 14-3-3sigma downstream signaling in pancreatic cancer.
Introduction
Pancreatic ductal adenocarcinoma (PDAC) is the fourth to
fifth leading cause of cancer-related mortality in the western
world (1,2). It is a devastating disease with a poor prognosis,
an overall 5-year survival rate of 51%, and a median survival
time after diagnosis of ~5--6 months. At the time of
diagnosis between 75 and 85% of PDAC patients have
unresectable tumors, and conventional therapies are virtually
ineffective (1--4). An improved understanding of the molecular
Abbreviations: LCM, laser capture microdissection; QRT--PCR, quantitative
real-time--PCR; PDAC, pancreatic ductal adenocarcinoma.
Carcinogenesis vol.25 no.9 # Oxford University Press 2004; all rights reserved.
characteristics of PDAC is the only means of providing new
markers for early diagnosis and identifying potential targets
for therapeutic intervention. Therefore, in recent decades
many laboratories have focused on understanding the molecular alterations that occur in PDAC.
During the process of malignant transformation, pancreatic
cancer cells acquire resistance to apoptosis mediated by conventional chemotherapeutic agents or by apoptosis-inducing
receptors such as Fas or TNF-R (5,6). Resistance to apoptosis
is mediated through a number of mechanisms, including p53
and K-ras mutations, aberrant expression of genes that induce
or prevent apoptosis, such as bax and bcl-2, respectively (7),
and excessive activation of mitogenic pathways (8). Another
hallmark of malignant transformation is deregulated cell cycle
control. Defects in cell cycle checkpoints can be the result of
gene mutations, chromosome damage and aneuploidy, all of
which result in permanent alterations of the genome (9). The
checkpoint mechanisms that normally regulate cell cycle progression are frequently disrupted in tumor cells (10,11).
14-3-3 proteins constitute a large family of acidic soluble
proteins that are expressed in virtually every organism studied
so far, ranging from mammals to yeast (12--17). In humans,
there are seven distinct 14-3-3 genes, denoted b, g, e, h, d, t (u)
and z (as well as a number of potential pseudogenes). Despite
this genetic diversity, 14-3-3 proteins exhibit a remarkable
degree of sequence homology and conservation between
species (18--20). 14-3-3 proteins bind to discrete phosphoserine-containing motifs present in many signaling molecules.
However, they are also capable of interacting with unphosphorylated ligands (21,22). At least 100 different binding
partners for 14-3-3 proteins have been identified, many of
which participate in the modulation of various cellular
processes such as cell cycle progression, apoptosis, signal
transduction, stress response, cytoskeleton organization and
malignant transformation (23--27).
The 14-3-3sigma gene (also called stratifin) was originally
characterized as the human mammary epithelial-specific marker, HME-1 (28), and is expressed in keratinocytes (29) and
epithelial cells (30). 14-3-3sigma is up-regulated through a
p53-dependent mechanism following DNA damage (31), and
sequesters cyclin B1/CDC2 complexes in the cytoplasm during
G2 arrest. Its absence allows cyclin B1/CDC2 complexes to
enter the nucleus, causing mitotic catastrophe (32,33). 14-33sigma has also been shown to specifically interact with
CDK2, CDC2 and CDK4 and to inhibit CDK activities, thereby
blocking cell cycle progression, thus defining it as a new class
of CKI (33). Besides its G2 /M checkpoint functions, 14-33sigma has an anti-apoptotic role through its inhibitory interactions with the pro-apoptotic proteins Bad and Bax. Thus,
14-3-3sigma sequesters phosphorylated Bad and Bax in the
cytoplasm, thereby preventing Bad from associating with
bcl-xL and Bax from translocating to the mitochondria (34,35).
The involvement of 14-3-3sigma in human cancer has
been established in studies of breast cancer in which
1575
A.Guweidhi et al.
methylation-dependent silencing of the gene was observed in
the majority of cases (36), and loss of 14-3-3sigma has been
shown to occur early in the neoplastic development of breast
epithelium (37). Silencing of 14-3-3sigma expression has been
reported in 43% of primary gastric adenocarcinomas (38) and
89% of hepatocellular carcinomas (39), as well as in certain
squamous cell carcinomas (40,41). In contrast, 14-3-3sigma is
reportedly up-regulated in lung cancer (42) and in head and
neck squamous cell carcinoma (43). Previously, using DNA
array technology, we and others have demonstrated an increase
of 14-3-3sigma mRNA expression in PDAC in comparison
with the normal pancreas (44--46). In the present study, we
investigated 14-3-3sigma localization, expression and function
in PDAC in order to assess its potential role in this disease.
Materials and methods
Patients and tissue collection
Human PDAC tissue samples were obtained from 52 patients (25 female, 27
male; median age 65 years; range 28--82) who underwent pancreatic resection
at the University Hospital of Berne (Switzerland) and the University Hospital
of Heidelberg (Germany). Normal human pancreatic tissue samples were
obtained through an organ donor program from 24 previously healthy individuals (11 females, 13 males; median age 45 years; range 20--74). Freshly
removed tissue samples were immediately fixed in paraformaldehyde solution
for 12--24 h and paraffin-embedded for immunohistochemical analysis. Concomitantly, tissue samples for RNA extraction were immediately snap-frozen
in liquid nitrogen in the operating room upon surgical removal and maintained
at ÿ80 C until use. The human subject committees of the Universities of Bern
and Heidelberg and of Dartmouth Medical School approved the studies.
cDNA array
The HG-U95Av2 array was obtained from Affymetrix (Santa Clara, CA). It
contains about 10 000 full-length human genes from the UniGene database.
Poly (A) ‡ RNA isolation, cDNA synthesis, and cRNA in vitro transcription
was carried out as reported previously (44,47). The in vitro transcription
product was purified and fragmented as described (44,47). Hybridization of
the fragmented in vitro transcription products to oligonucleotide arrays was
performed as suggested by the manufacturer (Affymetrix).
Light cycler quantitative real-time--PCR (QRT--PCR)
All reagents and equipment for mRNA/cDNA preparation were purchased
from Roche Applied Science (Mannheim, Germany). mRNA was prepared
by automated isolation using MagNA Pure LC instrument and isolation kits I
(for cells) and II (for tissues). cDNA was prepared using the first Strand cDNA
Synthesis Kit for RT--PCR according to the manufacturer's instructions.
QRT--PCR was performed with the Light Cycler Fast Start DNA SYBR
Green kit as described previously (48). The number of 14-3-3sigma-specific
transcripts was normalized to housekeeping genes (cyclophilin B and hypoxanthine guanine phosphoribosyltransferase; HPRT). All primers were obtained
from Search-LC (Heidelberg, Germany).
Laser capture microdissection
Tissue samples were embedded in OCT (Sakura Finetek, Torrance, CA) by
freezing the blocks in an acetone bath within liquid nitrogen. Tissues were then
stored at ÿ80 C until use. Tissue sections (6--8 mm thick) were prepared using
a Reichard-Jung 1800 cryostat. The sections were attached to glass slides and
immediately frozen on a block of dry ice followed by fixation (75% ethanol)
and staining (1.5% eosin) for 30 s. Sections were washed in 95% ethanol and
dehydrated in 100% high-grade ethanol. The sections were then incubated with
Xylene, air dried, and subjected to laser capture microdissection (LCM) using
the Pix Cell instrument and CapSure LCM Caps (Arcturus Engineering,
Mountain View, CA) (49). RNA was extracted using the Nanoprep RNA
isolation System (Stratagene, La Jolla, CA) according to the manufacturer's
protocol. Laser-captured cells from multiple serial sections were pooled in
one tube of lysis buffer, and the RNA concentration was measured using
RiboGreen (Molecular Probes, Eugene, OR) and a CytoFluor fluorescence
plate reader (PerSeptive Biosystems, Framingham, MA). To ensure RNA
integrity, ~10 ng were analyzed on an Agilent 2100 bioanalyzer using the
RNA LabChip (Ambion, Austin, TX). Only RNA samples with the ratio of 28S
4 18S and without the presence of multiple bands suggestive of RNA degradation were subjected to further analysis. To analyze expression in the LCM
samples 10 ng of total RNA were reverse transcribed using random hexamers
1576
and the Sensiscript Kit (Qiagen, Valencia, CA) according to the company's
protocol. One-tenth of each reaction was used as a template for the PCR
reaction. QRT--PCR was performed using the 7700 Sequence Detector
(Applied Biosystems, Foster City, CA) and TaqMan technology. Twenty
microliter reactions were set up using the 2 Universal PCR Master Mix
(Applied Biosystems) or Ambion's real-time SuperTaq reagents (Ambion),
template cDNA and adequate concentrations of primers and probes. All samples were analyzed in duplicate and data were analyzed using the relative
standard curve method with serial dilutions of cDNA made of 50 ng pancreatic
cancer RNA. Expression levels were normalized to the expression of 18S as an
internal control. The following sequences for the primer and probes were used:
18S forward primer cggctaccacatccaaggaa, reverse primer gctggaattaccgcggct,
TaqMan probe VIC-tgctggcaccagacttgccctc-TAMRA; 14-3-3sigma forward
primer cagtctgatccagaaggccaa, reverse primer gaaggctgccatgtcctca, TaqMan
probe 6-FAM-ggcagagcaggccgaacgc-TAMRA.
Southern blot analysis
For Southern blot analysis, 20 mg of genomic DNA from pancreatic cancer
tissues (n ˆ 3) and normal pancreata (n ˆ 3) was digested with HindIII and size
fractionated on 1% agarose gels containing ethidium bromide (0.1 mg/ml).
Products were visualized by UV transillumination. Gels were incubated twice
in denaturation solution (1.5 M NaCl, 0.5 M NaOH) for 20 min at room
temperature. Then, gels were twice incubated in neutralization solution
(1.5 M NaCl, 0.5 M Tris--HCl, pH 7.0) for 20 min at room temperature.
DNA was transferred by capillary action in 10 SSC to nylon membranes
(Hybond N‡). Hybridization was performed with [a-32 P]dCTP-labeled cDNA
in 10 ml hybridization solution (0.75 M NaCl; 5 mM EDTA, pH 8.0; 50 mM
sodium phosphate, pH 7.4; 25% formamide; 5 Denhardt's solution; 10%
dextran sulfate; 1% SDS; 1% salmon sperm DNA). Membranes were washed
twice at room temperature in 2 SSC and twice at 60 C in 0.1 SSC, 2%
SDS, and subsequently exposed at ÿ80 C to Kodak BioMax films with Kodak
intensifying screens for the appropriate time.
Immunohistochemistry
Immunohistochemical analysis was performed using the streptavidin-peroxidase technique and DAKO EnVision ‡ Systems, Peroxidase (Dako
Cytomation GmbH, Hamburg, Germany) according to the manufacturer's
protocol. Briefly, consecutive 3--5 mm paraffin-embedded tissue sections
were deparaffinized and dehydrated. Slides were incubated for 10 min in
0.3% hydrogen peroxide to block endogenous peroxidase activity. Then, the
sections were incubated for 30 min at room temperature with 10% normal goat
serum prior to overnight incubation at 4 C temperature with mouse monoclonal anti-14-3-3sigma (NeoMarkers, Westinghouse, CA) diluted in PBS
(2 mg/ml). Secondary goat anti-mouse peroxidase-labeled polymer was used.
Slides were counterstained with Mayer's hematoxylin. To ensure specificity of
the primary antibodies, consecutive tissue sections were incubated in the
absence of the primary antibody. In these cases, no immunostaining was
detected. In addition, skin sections were analyzed as positive controls.
Immunofluorescence
Paraffin-embedded tissue sections were deparaffinized and dehydrated. Then,
sections were incubated for 30 min at room temperature with 10% normal goat
serum prior to overnight incubation at 4 C with a mouse monoclonal anti-14-33sigma antibody (NeoMarkers) diluted in PBS (2 mg/ml). Secondary goat
anti-mouse Cy3 labeled antibodies were used. Slides were counterstained
with DAPI.
Cell culture
ASPC-1, BxPc-3, Capan-1, COLO-357, Mia PaCa-2, PANC-1, T3M4 and
Hela cells were grown in RPMI media. HCT 116 cells were grown in McCoy's
media. Cells were maintained at 37 C in humidified air with 5% CO2 . Media
were supplemented with penicillin (100 U/ml), streptomycin (100 mg/ml) and
10% FBS. For induction of apoptosis, cells were exposed to actinomycin
D (Sigma-Aldrich Chemie, Taufkirchen, Germany) at a concentration
of 0.5 mg/ml. Irradiation was performed using a 137Cs g-irradiator at
7.5 Gy/min for 2 min.
Mutation analysis
DNA was extracted from pancreatic cancer cell lines and skin as a positive
control using the DNA extraction kit Qiagen (Qiagen GmbH, Hilden,
Germany) according to the manufacturer's protocol. A 1.2-kb PCR product,
encompassing the entire 14-3-3sigma coding sequence, was generated by using
two primers: 50 -GTGTGTCCCCAGAGCCATGG-30 (sense) and 50 -GTCTCGGTCTTGCACTGGCG-30 (antisense). The PCR contained 1 mg of DNA,
PCR Master Mix, Promega (Promega GmbH, Mannheim, Germany) (25 U/ml
TaqDNA Polymerase, 200 mM each: dATP, dGTP, dCTP, dTTP, 1.5 mM
MgCl) in a 100 ml reaction volume. The PCR conditions were as follows: an
initial denaturation step for 5 min at 94 C and then 30 s at 94 C, 60 s at 58 C
14-3-3sigma in pancreatic cancer
and 2 min at 72 C for 34 cycles followed by an elongation step for 8 min at
72 C. PCR products were resolved by electrophoresis in a 1% agarose gel
pre-stained with ethidium bromide. The rest of the PCR product was purified
and sent for sequencing by Qiagen (Qiagen GmbH).
Antibodies
The following primary antibodies were used: mouse anti-14-3-3sigma Ab-1
(clone 1433S01) (NeoMarkers), rabbit polyclonal anti-Bad (H-168), agarose
conjugate mouse monoclonal anti-Bad (C-7), rabbit polyclonal anti-Bax
(N-20), agarose conjugate rabbit polyclonal anti-Bax (N-20), mouse monoclonal anti-cdc2 p34(17), mouse monoclonal anti-cyclinB1 (GNS1), goat
polyclonal anti-cdc25c (N-19) (Santa Cruz Biotechnology, Santa Cruz, CA),
rabbit polyclonal anti-pCdc2 (Tyr 15) 9111s (Cell Signaling Technology,
Beverly Hills, CA).
Western blot
Cultured pancreatic cancer cells were washed in ice-cold PBS, scraped, centrifuged briefly and lysed in 1 ml of ice-cold lysis buffer (50 mM Tris--HCl,
pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% SDS) supplemented with the
Complete-TM mixture of proteinase inhibitors (Roche Diagnostics). Cells
were centrifuged (14 000 r.p.m., 30 min at 4 C), the supernatants were
collected and the protein concentration was measured with the BCA protein
assay (Pierce Chemical, Rockford, IL). Protein (15 mg/sample) was diluted in
sample buffer (250 mM Tris--HCl, 4% SDS, 10% glycerol, 0.006% bromophenol blue and 2% b-mercaptoethanol), boiled for 5 min, cooled on ice for 5
min, and size-fractionated on 12% SDS--polyacrylamide gels. Proteins were
transferred onto nitrocellulose membranes at 100 V for 90 min. Subsequently,
membranes were incubated for 1 h in a blocking solution (5% non-fat milk in
20 mM Tris--HCl, 150 mM NaCl, 0.1% Tween-20), followed by incubation
with the indicated primary antibodies in blocking solution overnight at 4 C.
Membranes were then washed with the blocking solution and incubated with
the corresponding horseradish peroxidase conjugated secondary antibodies for
60 min at room temperature. Antibody detection was performed with the
enhanced chemoluminescence western blot detection system (Amersham
Life Science, Amersham, UK). For loading and transfer control, anti-ERK2
rabbit polyclonal antibodies were utilized (Santa Cruz Biotechnology).
Immunoprecipitation
For immunoprecipitation (IP), cells were washed twice with ice-cold PBS and
lysed in buffer containing 50 mM Tris pH 7.4, 250 mM NaCl, 1% Triton X-100
supplemented with the Complete-TM mixture of proteinase inhibitors (Roche
Diagnostics), 2 mM PMSF, 50 mM NaF, 1 mM sodium orthovanadate and
0.5 mM sodium paraphosphate for at least 30 min on ice. Following centrifugation the supernatant was incubated overnight at 4 C with the indicated
antibody, and the antibody-bound complexes were precipitated for 60 min
with 50 ml of protein G--Sepharose (Santa Cruz Biotechnology). The
immunoprecipitates were washed three times with lysis buffer without
additions, and then eluted with 80 ml of 2 SDS sample buffer for analysis
by SDS--polyacrylamide gel electrophoresis and immunoblotting.
FACS analysis
Cell cycle analysis. Both adherent and floating cells were collected for
analysis. Cell cycle analysis was performed using a hypotonic fluorochrome
solution (propidium iodide 50 mg/ml, sodium citrate 0.1%, Triton X-100
0.1%). Flow cytometry was performed with a FACS instrument (Becton
Dickinson Biosciences, Erembodegem, Belgium).
Detection of apoptosis. Detection of apoptosis was carried out by the
Annexin-V-Fluos kit (Roche Diagnostics). Both adherent and floating cells
were collected for analysis. Cells were collected by centrifugation at 200 g for
5 min. Subsequently the cell pellet was re-suspended in 100 ml AnnexinV-Fluos in a HEPES buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM sodium
chloride, 5 mM calcium chloride) containing propidium iodide and incubated
for 10--15 min. Subsequently, flow cytometry was performed with a FACS
instrument (Becton Dickinson Biosciences, Erembodegem, Belgium).
Results
Expression and genomic analysis of 14-3-3sigma
We first screened the mRNA expression of 14-3-3 family
members in pancreatic cancer, chronic pancreatitis and the
normal pancreas utilizing DNA arrays. This analysis revealed
that 14-3-3sigma is the most prominently over-expressed isoform of the 14-3-3 family in pancreatic cancer compared with
normal pancreatic tissues (Table I). Thus, 14-3-3sigma mRNA
Table I. Expression of different 14-3-3 isoforms in the normal pancreas (No),
chronic pancreatitis (CP), primary pancreatic cancer (CA) and pancreatic
cancer metastasis (Mx) as determined by DNA array analysis
Fold change
Beta
Epsilon
Eta
Sigma
Tau
Zeta
Ca versus No
CP versus No
Mx versus No
2.79
ÿ2.32
1.70
11.61
ÿ1.61
2.06
1.82
ÿ2.00
1.22
3.45
ÿ1.69
1.54
3.39
ÿ1.78
1.69
19.23
ÿ1.70
2.05
expression levels were increased 11.6- and 3.5-fold in
pancreatic cancer compared with chronic pancreatitis and the
normal pancreas, respectively. Furthermore, in metastatic
lesions, 14-3-3sigma levels were increased 19.2- and 1.6-fold
in comparison with normal pancreatic and primary cancer
samples, respectively. In contrast, the other 14-3-3 isoforms
displayed different patterns. 14-3-3epsilon and tau mRNA
levels were down regulated in pancreatic cancer in comparison
with normal pancreatic tissues, whereas 14-3-3beta, eta and
zeta expression was slightly increased in pancreatic cancer.
These findings are in agreement with previous DNA array
results in pancreatic cancer that specifically identified 14-33sigma (and not the other 14-3-3 isoforms) as an overexpressed gene in this disease (44--46).
To more accurately quantify this over-expression,
QRT--PCR was carried out using whole tissue RNA from
normal (n ˆ 24) and PDAC (n ˆ 52) tissues. This analysis
revealed that there was a 54 9.0-fold (mean SEM)
increase in 14-3-3sigma levels in PDAC as compared with
the normal pancreas (Figure 1A). Moreover, 39 of 52 PDAC
samples (75%) exhibited 14-3-3sigma mRNA levels that
exceeded the highest 14-3-3sigma levels in normal tissues.
Next, RNA was extracted from laser-captured ductal cells
obtained from three normal pancreas samples, five chronic
pancreatitis samples, and six PDAC samples. In addition,
RNA was prepared from three samples of total, non-microdissected, normal pancreatic tissues. After reverse transcription,
mRNA expression levels were assessed by QRT--PCR analysis. The microdissected normal ducts and the ductal cells in
chronic pancreatitis exhibited moderate levels of 14-3-3sigma,
whereas total pancreas samples (containing mostly acinar
cells) displayed relatively low levels of 14-3-3sigma
(Figure 1B). Moreover, the microdissected cancer cells showed
a 3 0.9-fold increase in 14-3-3sigma mRNA levels when
compared with the microdissected non-neoplastic ducts, and a
40 12-fold increase when compared with total pancreatic
tissue samples (Figure 1B). Southern blot analysis revealed no
obvious difference in the number of gene copies in pancreatic
cancer samples in comparison with normal pancreatic tissues
and no gross genomic rearrangement (Figure 1C).
Immunohistochemical localization of 14-3-3sigma was
carried out next using 10 normal pancreatic tissues, 20 primary
and 10 metastatic PDAC samples. 14-3-3sigma immunoreactivity was absent in all 10 normal pancreas tissues and was not
detectable in either the acinar, ductal or islet cells (Figure 2A
and B). In contrast, in all 20 primary PDAC samples, strong
cytoplasmic 14-3-3sigma immunostaining was present in the
cancer cells (Figure 2C and D). Similarly, strong 14-3-3sigma
immunoreactivity was observed in the cytoplasm of the cancer
1577
A.Guweidhi et al.
analyzed. As described previously (29), positive cytoplasmic
staining of keratinocytes could be detected (Figure 3C). Overexpression of 14-3-3sigma at the protein level was also
confirmed by western blot analysis of normal tissues and
pancreatic cancer samples (Figure 1D).
The expression level of 14-3-3sigma was examined next in
eight pancreatic cancer cell lines. BxPc-3, Colo-357 and T3M4
cells exhibited relatively high levels of 14-3-3sigma mRNA
(Figure 4A) and protein (Figure 4B). Aspc-1 and Capan-1 cells
exhibited moderate levels of 14-3-3sigma mRNA (Figure 4A)
and protein (Figure 4B). Panc-1 cells exhibited low levels of
14-3-3sigma mRNA (Figure 4A) and protein (Figure 4B), and
Mia-PaCa-2 cells exhibited very low levels of 14-3-3sigma
mRNA (Figure 4A) and no detectable protein levels
(Figure 4B). It has been shown previously that low expression
levels in these cells are due to promoter hypermethylation
(46,50). In order to determine whether there were mutations
of the 14-3-3sigma coding sequence in pancreatic cancer cells,
full-length DNA sequencing of ASPC-1, Mia-Paca2, T3M4
and skin (as a positive control) was performed. No mutation
was detected in the coding sequence in any of the samples
(data not shown).
Fig. 1. Expression analysis of 14-3-3sigma mRNA in various pancreatic
tissues. QRT--PCR was carried out as described in the Materials and Methods
section. (A) QRT--PCR of 24 normal pancreatic samples and 52 pancreatic
cancer samples. The result represented 14-3-3sigma mRNA copies per
microliter cDNA normalized to housekeeping genes. Black dots, normal
pancreas; white dots, pancreatic cancer. The bars represent the mean and the
SEM. (B) LCM and 14-3-3sigma mRNA analysis by QRT--PCR. LCM of the
indicated cells in the normal pancreas (n ˆ 3), chronic pancreatitis (n ˆ 5)
and pancreatic cancer (n ˆ 6) was carried out as described in the Materials
and Methods section. In addition, three samples of total, not microdissected,
normal pancreatic tissues were included. The results are presented as
arbitrary units normalized to the housekeeping genes and represent the mean
and the SEM. (C) Southern blot analysis of genomic DNA isolated from
three normal pancreatic tissues and three pancreatic cancer samples was
performed as described in Materials and Methods section. (D) Western blot
analysis of total protein isolated from three normal pancreatic tissues and
three pancreatic cancer samples was carried out using specific 14-3-3sigma
antibodies as described in the Materials and Methods section.
cells in the 10 metastatic samples (Figure 2E and F). No
staining was detected in the extracellular matrix or infiltrating
inflammatory cells. Immunofluorescence analysis revealed
comparable results of high cytoplasmic expression of 14-33sigma in pancreatic cancer cells (Figure 3A and B). To prove
the specificity of the antibody, skin sections were also
1578
14-3-3sigma and G2 cell cycle checkpoint in pancreatic
cancer
Following DNA damage, 14-3-3sigma is up-regulated both in
human colon carcinoma cells and in mouse ES cells by a p53and BRCA1-dependent mechanism, thereby blocking G2 /M
progression (31,32,51). One of the mechanisms by which this
G2 /M block is mediated is the subcellular translocation of
Cdc2. During the G2 phase, the Cdc2/cyclin B complex is
kept inactive by phosphorylation of tyrosine 15 and threonine
14 residues of Cdc2. At the onset of mitosis, both of these
residues are dephosphorylated (activated) by the phosphatases
Cdc25c and Cdc2. Subsequently, the Cdc2/cyclin B complex
translocates to the nucleus and initiates mitosis (52,53). 14-33sigma binds to Cdc2 and blocks entry into mitosis by anchoring the Cdc2/cyclin B1 complex in the cytoplasm, resulting in
G2 /M block (31).
To elucidate the role of 14-3-3sigma in mediating the effects
of DNA-damaging agents in pancreatic cancer cell lines, we
performed cell cycle analysis in cells with high and low levels
of 14-3-3sigma. We also examined the expression levels of
Cdc2, cyclin B1, Cdc25c and p21. The cell lines examined
were Colo-357 (p53 wild-type and high levels of 14-33sigma), T3M4 (p53 mutated and high levels of 14-3-3
sigma), and Mia-Paca-2 (p53 mutated and low levels of 14-33sigma). Cells were exposed to gamma irradiation (15 Gy)
followed by FACS analysis, QRT--PCR and western blot analysis at 0, 1 and 48 h after treatment. Based on the FACS
analysis, following irradiation Colo-357 and Mia-Paca-2
were blocked in the G2 /M-phase of the cell cycle, while
T3M4 showed S-phase accumulation (Figure 5). In T3M4
cells, QRT--PCR analysis revealed transiently increased levels
of 14-3-3sigma mRNA after irradiation in comparison with its
basal levels, while in Mia-Paca2 and Colo-357 cells no change
in the basal 14-3-3sigma mRNA levels was observed (data not
shown). Western blot analysis showed only a significant
increase of the basal levels of 14-3-3sigma protein in T3M4
cell lines after 1 h of irradiation, while no significant change
was observed in Colo-357 and Mia-Paca2 cells (Figure 6). In
addition, following irradiation, there was a slight increase in
14-3-3sigma in pancreatic cancer
Fig. 2. Localization of 14-3-3sigma in pancreatic tissues. Immunohistochemistry was carried out using a specific 14-3-3sigma antibody as described in the
Materials and Methods section; (A and B) normal pancreas; (C and D) pancreatic cancer; (E and F) liver metastases of pancreatic cancer. Note the strong
14-3-3sigma immunoreactivity in the metastatic pancreatic cancer cells in comparison with the adjacent normal liver, as seen in insert (E).
p21 protein levels in Colo-357 pancreatic cancer cells, but not
in the other tested cell lines (Figure 6).
Since no correlation between G2 block and 14-3-3sigma
levels could be established, we next analyzed the availability
of required protein partners. Western blot analysis for Cdc2
and Cdc25c showed that after exposure to radiation, both
phosphorylated and non-phosphorylated forms of Cdc2
accumulated in T3M4 and Mia-Paca2 cells, while Colo-357
showed no difference in the basal levels of Cdc2 (Figure 6).
Cdc25c was not expressed in the examined pancreatic cancer
cell lines (Figure 4B). Taken together, these results might
suggest that in pancreatic cancer 14-3-3sigma is not crucial
for maintenance of G2 checkpoint integrity.
14-3-3sigma and induction of apoptosis in pancreatic cancer
14-3-3sigma is known to exert anti-apoptotic effects by
interacting with and inhibiting the actions of bad and bax
pro-apoptotic proteins (34,35). Bad induces apoptosis by binding to and inhibiting the anti-apoptotic effects of bcl-xL and
bcl-2. 14-3-3sigma sequesters phosphorylated bad in the
cytosol, thereby preventing it from interacting with bcl-xL
(54,58). 14-3-3sigma also binds to and sequesters bax in the
1579
A.Guweidhi et al.
Fig. 4. Expression of 14-3-3sigma in pancreatic cancer cell lines.
QRT--PCR (A) and western blot analysis (B) of 14-3-3sigma and Cdc25c
expression in the indicated pancreatic cancer cell lines. (A) Results represent
14-3-3sigma mRNA copies per microliter cDNA normalized to
housekeeping genes. (B) Molecular weight markers are indicated on the
left side.
Fig. 3. Localization of 14-3-3sigma in pancreatic cancer and normal skin.
(A and B) Immunofluorescence of paraffin-embedded pancreatic cancer
tissue sections was carried out as described in the Materials and Methods
section. (A) Strong 14-3-3sigma immunofluorescence (red) in pancreatic
cancer cells. (B) Same section as (A) overlapped with nuclear DAPI counter
staining (blue). (C) Immunohistochemistry of normal human skin showing
strong 14-3-3sigma immunoreactivity (brown) in the squamous epithelium.
cytoplasm, thereby preventing the translocation of bax to
the mitochondria and blocking the cytoplasmic release of
cytochrome c (34,35).
To induce apoptosis, Colo-357, Mia-Paca-2 and T3M4 cells
were treated with 500 ng/ml actinomycin D (59) for 12 h and
then subjected to analysis by FACS, western blotting and
immunoprecipitation. In 14-3-3sigma-high Colo357 cells,
very limited apoptosis occurred (Figure 7), without obvious
change of 14-3-3sigma protein levels (Figure 8). However,
1580
both 14-3-3sigma-high T3M4 and 14-3-3sigma-low MiaPaca2
showed prominent induction of apoptosis (Figure 7), with no
other significant changes in cell cycle distribution for T3M4
cells and slight G1 accumulation for Mia-Paca2 cells (data not
shown). In T3M4 cells, 14-3-3sigma protein decreased slightly
after treatment with actinomycin D, but Mia-Paca2 did not
display detectable levels of 14-3-3sigma prior to or after actinomycin D treatment (Figure 8). The reason for and the functional consequences of reduced levels of 14-3-3sigma in T3M4
cells following drug exposure are currently not known.
Analysis of expression of proteins known to be targeted by
14-3-3sigma during its anti-apoptotic action (Cdc2, cyclin B1,
bad and bax) revealed that after actinomycin D treatment, the
phosphorylated Cdc2 protein was significantly down-regulated
in MiaPaca2 and T3M4 cells and to a lesser extent in Colo-357
cells (Figure 8). Significant down-regulation of cyclin B1 protein was observed in Mia-Paca-2 and T3M4 cells. Cleavage of
bax protein after treatment with actinomycin D was observed in
Colo-357 and T3M4 cells (Figure 8), but not in Mia-Paca-2
cells. Levels of bad protein remained unchanged (Figure 8).
To investigate the molecular mechanism of 14-3-3sigma
interaction with its expected partners in pancreatic cancer
cell lines, we carried out immunoprecipitation experiments.
Colo-357, T3M4 and Mia-Paca-2 cell lines, treated with actinomycin D, were analyzed for complex formation between
14-3-3sigma and Cdc2, cyclin-B1, bad and bax. In Colo-357
and T3M4 cells, a spontaneous complex formation of 14-33sigma with Cdc2 was observed, with or without actinomycin
D treatment (Figure 9A). No complex formation was detected
between 14-3-3sigma and bad or between 14-3-3sigma and
bax. Reversed immunoprecipitation with bad, bax and Cdc2
confirmed these results (Figure 9B and C). In Mia-Paca-2
cells, with undetectable basal and induced levels of
14-3-3sigma, no complexes were detected.
14-3-3sigma in pancreatic cancer
complex formation in HCT116 cells for 14-3-3sigma and its
partners including bax, bad and Cdc2 (Figure 10).
In conclusion, in pancreatic cancer cells, 14-3-3sigma
levels do not seem to correlate with the outcome of apoptosis
induction, possibly due to improper complex formation with
protein targets.
Discussion
Fig. 5. Effects of irradiation on cell cycle distribution in pancreatic cancer
cell lines. The indicated pancreatic cancer cells were exposed to 7.5 Gy/min
for 2 min, and after 48 h FACS analysis was carried out as described
in the Materials and Methods section. Black curve, normal cells; white
curve, cells exposed to irradiation.
Next, to exclude possible false negative results, co-IP
experiments were carried out in HCT116 cells, which express
wild-type p53 and 14-3-3sigma and for whom an interaction
between 14-3-3sigma and its partners, bad, bax and Cdc2 has
been reported (32,35,60). As reported previously, there was a
Deregulation of 14-3-3sigma expression has been observed in
a wide variety of human cancers, with both decreasing and
increasing 14-3-3sigma levels being associated with development of malignancy. Loss of 14-3-3 sigma expression has been
reported in primary gastric (38), hepatocellular (39) and breast
(36) adenocarcinoma, and certain squamous cell carcinomas
(40,41). Furthermore, 14-3-3sigma has been described as a
potential marker for the non-cancerous state of epithelial
cells (28,29). Also, lack of 14-3-3sigma in colorectal tumor
cells was shown to sensitize them to chemotherapy-induced
apoptosis. One of the major mechanisms of the 14-3-3sigma
down-regulation seems to be methylation-dependent silencing
(36). Recently, strategies aiming to correct 14-3-3sigma
expression during chemotherapy have been considered to be
of therapeutic interest (30). In contrast, 14-3-3sigma expression is up-regulated in head and neck squamous cell carcinoma
and in chemoresistant pancreatic adenocarcinoma cells (61).
Apparently, due to diversity of 14-3-3sigma functions, its role
in cancerogenesis might be restricted to the particular type of
tumor. To exert its effects, 14-3-3sigma recruits several interacting partners, suggesting that the functional status of downstream targets will at least partially determine its effects.
In the present study, we confirmed the up-regulation of 14-33sigma mRNA and protein in malignant cells of PDAC as
compared with the normal pancreas. No mutation in the coding
sequence of 14-3-3sigma was detected by sequencing analysis,
indicating that cancer cell-associated 14-3-3sigma is potentially functional although other genetic and epigenetic alterations cannot be ruled out.
Since p53-controlled 14-3-3sigma expression was recognized as a key event in maintaining the G2 checkpoint after
DNA damage, we expected that the pattern of responses to
radiation would be determined by the individual p53 and 143-3sigma status in pancreatic cancer cells. Surprisingly, no
such correlation could be seen: both Colo-357 (p53wt, 14-33sigma ‡‡) and Mia-Paca2 (p53mutated, 14-3-3sigma ‡/--)
entered and maintained G2 block in response to irradiation.
Interestingly, transient up-regulation of already high 14-33sigma levels after DNA damage was only seen in S-phase
arrested T3M4 cells (p53mutated, 14-3-3sigma ‡‡), which
express a mutated form of p53, indicating that pancreatic
cancer cells possess alternative pathways for p53-independent
14-3-3sigma induction and 14-3-3sigma-independent G2
checkpoint maintenance. In addition, expression of 14-33sigma in several pancreatic cancer cell lines with mutated
p53 phenotype strongly indicates that 14-3-3sigma expression
in pancreatic cancer is controlled by an alternative p53independent mechanism. It could be speculated that other p53
family members such as p63 or p73 (62) might be responsible
for the irradiation induced increase in 14-3-3sigma levels in
T3M4 cells and the high basal 14-3-3sigma levels in other
pancreatic cancer cell lines.
1581
A.Guweidhi et al.
Fig. 6. Effects of irradiation on the expression of 14-3-3sigma and its partners in pancreatic cancer cell lines. The indicated pancreatic cancer cells were exposed
to 7.5 Gy/min for 2 min. One and 48 h later, proteins were extracted and western blot analysis for 14-3-3sigma, Cdc-2, phosphorylated Cdc-2 (p-cdc-2) and p21 was
carried out as described in the Materials and Methods section. N, normal cells; R, irradiated cells; 1, 1 h; 48, 48 h.
Fig. 7. Effects of actinomycin D in pancreatic cancer cell lines. The indicated pancreatic cancer cell lines were treated with 0.5 mg/ml actinomycin D for
12 h. Then the cells were stained with Annexin-V and PI, and FACS analysis was carried out as described in the Materials and Methods section. The number in
the upper left corner depicts the percentage of apoptotic cells, in the upper right corner the percentage of necrotic cells, and in the lower right corner the
percentage of both apoptotic and necrotic cells.
1582
14-3-3sigma in pancreatic cancer
Fig. 8. Effect of actinomycin D on the expression of 14-3-3sigma and its
partners in pancreatic cancer cell lines. The indicated pancreatic cancer cell
lines were treated with 0.5 mg/ml actinomycin D for 12 h. Western blot
analysis for 14-3-3sigma, Cdc-2, phosphorylated Cdc-2 (p-Cdc-2), cyclin B,
bad and bax was carried out as described in the Materials and Methods
section. (ÿ) Untreated cells; (‡) treated cells.
Elaboration of experiments to study responses of pancreatic
cancer cells to the apoptosis-inducing agent actinomycin D
allowed us to elucidate molecular anomalies in 14-3-3sigma
downstream signaling. Thus, we demonstrated for the first
time that: (i) 14-3-3sigma was able to bind Cdc2 prior to
DNA damage; (ii) 14-3-3sigma/Cdc2 complexes did not
further accumulate after DNA damage and (iii) sequestered
Cdc2 was present in the complex in its active tyr15dephosphorylated form. Interestingly, although cyclin B1
was absent from constitutive 14-3-3sigma/Cdc2 complexes,
treatment with actinomycin D led to the drastic down-regulation of this protein, a possible path to cell cycle arrest. The
aspect of Cdc2-phosphorylation status is of particular interest,
as the phosphatase Cdc25c was absent in all examined
pancreatic cancer cells except BxPc-3 (Figure 4), which is in
agreement with the observed reduced Cdc25c expression in
pancreatic cancer tissues compared with normal controls (63).
These findings indicate that Cdc25c, normally responsible for
dephosphorylation and activation of Cdc2, might be replaced
with other members of the Cdc25 family, such as Cdc25b (63),
allowing initiation of mitosis.
Thus, although absence of 14-3-3sigma was shown
previously to be associated with the inability to sustain
the G2 checkpoint, leading to mitotic catastrophe, whereas
14-3-3sigma over-expression resulted in spontaneous `irradiation-like' phenomenon, these consequences of 14-3-3sigma
deregulation are apparently of no relevance in the case of
pancreatic cancer: despite abundant amounts of 14-3-3sigma
in tumor cells, its downstream partners, necessary for execution
of this pathway, are missing or not presented in the right form.
Anti-apoptotic effects of 14-3-3sigma are ascribed to its
interaction with and inhibition of the pro-apoptotic proteins
bad and bax. Phosphorylated bad induces apoptosis by binding
to and inhibiting the anti-apoptotic effects of Bcl-xL and Bcl-2.
14-3-3sigma sequesters phosphorylated bad in the cytosol, and
Fig. 9. Effect of actinomycin D on the association of 14-3-3sigma with
its partners in pancreatic cancer cell lines. The indicated pancreatic cancer
cell lines were treated with 0.5 mg/ml actinomycin D for 12 h.
Immunoprecipitation was carried out as described in the Materials and
Methods section. (ÿ) Untreated cells; (‡) treated cells. (A)
Immunoprecipitation with 14-3-3sigma and immunoblotting with the
indicated antibodies. (B) Immunoprecipitation with bad and immunoblotting
with the indicated antibodies. Positive control, Hela lysate (not precipitated).
(C) Immunoprecipitation with bax and immunoblotting with the indicated
antibodies. Positive control, Hela lysate (not precipitated). Negative control,
Mia-PaCa-2 cell lysate (not precipitated).
then the 14-3-3sigma-bad complex is sequestered from mitochondrial localized Bcl-xL and thus inhibits bad-induced
apoptosis (54--58). More recently it was reported that Cdc2 is
capable of mediating apoptosis of cerebellar granule. Active
Cdc2 catalyzes the phosphorylation of the BH3-only protein
bad at a distinct site, serine 128, and thereby induces badmediated apoptosis in primary neurons by opposing growth
factor inhibition of the apoptotic effect of bad. The phosphorylation of bad serine 128 inhibits the interaction of growth
factor-induced serine 136-phosphorylated bad with 14-3-3 proteins (16). It was also reported that 14-3-3sigma could have an
anti-apoptotic effect by direct interaction and sequestration of
1583
A.Guweidhi et al.
Fig. 10. Effect of adriamycin on the association of 14-3-3sigma with its
partners in HCT116 cells. HCT116 cells were treated with 0.5 mg/ml
adriamycin for 48 h. Immunoprecipitation was carried out as described in the
Materials and Methods section. (ÿ) Untreated cells; (‡) treated cells;
(L) whole HCT116 cell lysate. Following 14-3-3sigma immunoblotting the
membrane was exposed for 90 s (fourth panel). Longer exposure
(overnight) revealed positive signals for bax and bad IP (fifth panel).
bax. With regard to the anti-apoptotic role of 14-3-3sigma in
pancreatic cancer, our study showed that although both bad and
bax proteins were present in cancer cells, neither a significant
change of the protein level nor complexes with 14-3-3sigma
were associated with actinomycin D-induced apoptosis. It
seems that 14-3-3sigma does not interact directly with Bad
and bax but could play an anti-apoptotic role by binding to and
setting off the kinase activity of Cdc2, consequently prevent
the induction of Cdc2-induced bad-mediated apoptosis.
In conclusion, accumulation of 14-3-3sigma in malignant
cells is a hallmark of pancreatic cancer. However, due to
multiple alterations of the interaction with downstream partners, 14-3-3sigma does not seem to carry out its major ascribed
functions, such as the sustaining of a G2 checkpoint and antiapoptotic action. Alternative pathways of 14-3-3sigma-signaling in pancreatic cancer and their pathologic consequences are
the subject of further investigations.
References
1. Jemal,A., Murray,T., Samuels,A., Ghafoor,A., Ward,E. and Thun,M.J.
(2003) Cancer statistics, 2003. CA Cancer J. Clin., 53, 5--26.
2. Gudjonsson,B. (1987) Cancer of the pancreas. 50 years of surgery. Cancer,
60, 2284--2303.
1584
3. Beger,H.G., Buchler,M.W. and Friess,H. (1994) [Surgical results and
indications for adjuvant measures in pancreatic cancer]. Chirurg, 65,
246--252.
4. Warshaw,A.L. and Fernandez-del Castillo,C. (1992) Pancreatic carcinoma. N. Engl. J. Med., 326, 455--465.
5. Ungefroren,H., Voss,M., Jansen,M., Roeder,C., Henne-Bruns,D.,
Kremer,B. and Kalthoff,H. (1998) Human pancreatic adenocarcinomas
express Fas and Fas ligand yet are resistant to Fas-mediated apoptosis.
Cancer Res., 58, 1741--1749.
6. Raitano,A.B., Scuderi,P. and Korc,M. (1990) Binding and biological
effects of tumor necrosis factor and gamma interferon in human pancreatic
carcinoma cells. Pancreas, 5, 267--277.
7. Friess,H., Lu,Z., Graber,H.U., Zimmermann,A., Adler,G., Korc,M.,
Schmid,R.M. and Buchler,M.W. (1998) bax, but not bcl-2, influences
the prognosis of human pancreatic cancer. Gut, 43, 414--421.
8. Korc,M. (1998) Role of growth factors in pancreatic cancer. Surg. Oncol.
Clin. N. Am., 7, 25--41.
9. Paulovich,A.G., Toczyski,D.P. and Hartwell,L.H. (1997) When checkpoints fail. Cell, 88, 315--321.
10. Stewart,Z.A. and Pietenpol,J.A. (1999) Cell cycle checkpoints as
therapeutic targets. J. Mammary Gland Biol. Neoplasia, 4, 389--400.
11. Hartwell,L.H. and Kastan,M.B. (1994) Cell cycle control and cancer.
Science, 266, 1821--1828.
12. Aitken,A., Collinge,D.B., van Heusden,B.P., Isobe,T., Roseboom,P.H.,
Rosenfeld,G. and Soll,J. (1992) 14-3-3 proteins: a highly conserved,
widespread family of eukaryotic proteins. Trends Biochem. Sci., 17,
498--501.
13. Aitken,A. (1995) 14-3-3 proteins on the MAP. Trends Biochem. Sci., 20,
95--97.
14. Martens,G.J., Piosik,P.A. and Danen,E.H. (1992) Evolutionary conservation of the 14-3-3 protein. Biochem. Biophys. Res. Commun., 184,
1456--1459.
15. Swanson,K.D. and Ganguly,R. (1992) Characterization of a Drosophila
melanogaster gene similar to the mammalian genes encoding the tyrosine/
tryptophan hydroxylase activator and protein kinase C inhibitor proteins.
Gene, 113, 183--190.
16. Wang,W. and Shakes,D.C. (1994) Isolation and sequence analysis of a
Caenorhabditis elegans cDNA which encodes a 14-3-3 homologue. Gene,
147, 215--218.
17. van Heusden,G.P., Griffiths,D.J., Ford,J.C., Chin,A.W.T.F., Schrader,P.A.,
Carr,A.M. and Steensma,H.Y. (1995) The 14-3-3 proteins encoded by the
BMH1 and BMH2 genes are essential in the yeast Saccharomyces
cerevisiae and can be replaced by a plant homologue. Eur. J. Biochem.,
229, 45--53.
18. Wang,W. and Shakes,D.C. (1996) Molecular evolution of the 14-3-3
protein family. J. Mol. Evol., 43, 384--398.
19. Rosenquist,M., Alsterfjord,M., Larsson,C. and Sommarin,M. (2001) Data
mining the Arabidopsis genome reveals fifteen 14-3-3 genes. Expression
is demonstrated for two out of five novel genes. Plant Physiol., 127,
142--149.
20. Rittinger,K., Budman,J., Xu,J., Volinia,S., Cantley,L.C., Smerdon,S.J.,
Gamblin,S.J. and Yaffe,M.B. (1999) Structural analysis of 14-3-3
phosphopeptide complexes identifies a dual role for the nuclear export
signal of 14-3-3 in ligand binding. Mol. Cell, 4, 153--166.
21. Yaffe,M.B., Rittinger,K., Volinia,S., Caron,P.R., Aitken,A., Leffers,H.,
Gamblin,S.J., Smerdon,S.J. and Cantley,L.C. (1997) The structural basis
for 14-3-3: phosphopeptide binding specificity. Cell, 91, 961--971.
22. Yaffe,M.B. (2002) How do 14-3-3 proteins work? Gatekeeper
phosphorylation and the molecular anvil hypothesis. FEBS Lett., 513,
53--57.
23. Xiao,B., Smerdon,S.J., Jones,D.H., Dodson,G.G., Soneji,Y., Aitken,A. and
Gamblin,S.J. (1995) Structure of a 14-3-3 protein and implications for
coordination of multiple signalling pathways. Nature, 376, 188--191.
24. Chung,H.J., Sehnke,P.C. and Ferl,R.J. (1999) The 14-3-3 proteins: cellular
regulators of plant metabolism. Trends Plant Sci., 4, 367--371.
25. Finnie,C., Borch,J. and Collinge,D.B. (1999) 14-3-3 proteins:
eukaryotic regulatory proteins with many functions. Plant Mol. Biol.,
40, 545--554.
26. Fu,H., Subramanian,R.R. and Masters,S.C. (2000) 14-3-3 proteins:
structure, function and regulation. Annu. Rev. Pharmacol. Toxicol., 40,
617--647.
27. van Hemert,M.J., Steensma,H.Y. and van Heusden,G.P. (2001) 14-3-3
proteins: key regulators of cell division, signalling and apoptosis.
Bioessays, 23, 936--946.
28. Prasad,G.L., Valverius,E.M., McDuffie,E. and Cooper,H.L. (1992)
Complementary DNA cloning of a novel epithelial cell marker protein,
14-3-3sigma in pancreatic cancer
HME1, that may be down-regulated in neoplastic mammary cells. Cell
Growth Differ., 3, 507--513.
29. Leffers,H., Madsen,P., Rasmussen,H.H., Honore,B., Andersen,A.H.,
Walbum,E., Vandekerckhove,J. and Celis,J.E. (1993) Molecular cloning
and expression of the transformation sensitive epithelial marker stratifin. A
member of a protein family that has been involved in the protein kinase C
signalling pathway. J. Mol. Biol., 231, 982--998.
30. Vellucci,V.F., Germino,F.J. and Reiss,M. (1995) Cloning of putative
growth regulatory genes from primary human keratinocytes by subtractive
hybridization. Gene, 166, 213--220.
31. Hermeking,H.,
Lengauer,C.,
Polyak,K.,
He,T.C.,
Zhang,L.,
Thiagalingam,S., Kinzler,K.W. and Vogelstein,B. (1997) 14-3-3 sigma is
a p53-regulated inhibitor of G2 /M progression. Mol. Cell, 1, 3--11.
32. Chan,T.A., Hermeking,H., Lengauer,C., Kinzler,K.W. and Vogelstein,B.
(1999) 14-3-3Sigma is required to prevent mitotic catastrophe after DNA
damage. Nature, 401, 616--620.
33. Laronga,C., Yang,H.Y., Neal,C. and Lee,M.H. (2000) Association of the
cyclin-dependent kinases and 14-3-3 sigma negatively regulates cell cycle
progression. J. Biol. Chem., 275, 23106--23112.
34. Subramanian,R.R., Masters,S.C., Zhang,H. and Fu,H. (2001) Functional
conservation of 14-3-3 isoforms in inhibiting bad-induced apoptosis.
Exp. Cell Res., 271, 142--151.
35. Samuel,T., Weber,H.O., Rauch,P., Verdoodt,B., Eppel,J.T., McShea,A.,
Hermeking,H. and Funk,J.O. (2001) The G2 /M regulator 14-3-3sigma
prevents apoptosis through sequestration of Bax. J. Biol. Chem., 276,
45201--45206.
36. Ferguson,A.T., Evron,E., Umbricht,C.B. et al. (2000) High frequency of
hypermethylation at the 14-3-3 sigma locus leads to gene silencing in
breast cancer. Proc. Natl Acad. Sci. USA, 97, 6049--6054.
37. Umbricht,C.B., Evron,E., Gabrielson,E., Ferguson,A., Marks,J. and
Sukumar,S. (2001) Hypermethylation of 14-3-3 sigma (stratifin) is an
early event in breast cancer. Oncogene, 20, 3348--3353.
38. Suzuki,H., Itoh,F., Toyota,M., Kikuchi,T., Kakiuchi,H. and Imai,K. (2000)
Inactivation of the 14-3-3 sigma gene is associated with 50 CpG island
hypermethylation in human cancers. Cancer Res., 60, 4353--4357.
39. Iwata,N., Yamamoto,H., Sasaki,S. et al. (2000) Frequent hypermethylation
of CpG islands and loss of expression of the 14-3-3 sigma gene in human
hepatocellular carcinoma. Oncogene, 19, 5298--5302.
40. Gasco,M., Sullivan,A., Repellin,C., Brooks,L., Farrell,P.J., Tidy,J.A.,
Dunne,B., Gusterson,B., Evans,D.J. and Crook,T. (2002) Coincident
inactivation of 14-3-3sigma and p16INK4a is an early event in vulval
squamous neoplasia. Oncogene, 21, 1876--1881.
41. Gasco,M., Bell,A.K., Heath,V. et al. (2002) Epigenetic inactivation of 143-3 sigma in oral carcinoma: association with p16 (INK4a) silencing and
human papillomavirus negativity. Cancer Res., 62, 2072--2076.
42. Nakanishi,K., Hashizume,S., Kato,M., Honjoh,T., Setoguchi,Y. and
Yasumoto,K. (1997) Elevated expression levels of the 14-3-3 family of
proteins in lung cancer tissues. Hum. Antibodies, 8, 189--194.
43. Villaret,D.B., Wang,T., Dillon,D., Xu,J., Sivam,D., Cheever,M.A. and
Reed,S.G. (2000) Identification of genes overexpressed in head and neck
squamous cell carcinoma using a combination of complementary DNA
subtraction and microarray analysis. Laryngoscope, 110, 374--381.
44. Friess,H., Ding,J., Kleeff,J., Fenkell,L., Rosinski,J.A., Guweidhi,A.,
Reidhaar-Olson,J.F., Korc,M., Hammer,J. and Buchler,M.W. (2003)
Microarray-based identification of differentially expressed growth- and
metastasis-associated genes in pancreatic cancer. Cell Mol. Life Sci., 60,
1180--1199.
45. Logsdon,C.D., Simeone,D.M., Binkley,C., Arumugam,T., Greenson,J.K.,
Giordano,T.J., Misek,D.E., Kuick,R. and Hanash,S. (2003) Molecular
profiling of pancreatic adenocarcinoma and chronic pancreatitis identifies
multiple genes differentially regulated in pancreatic cancer. Cancer Res.,
63, 2649--2657.
46. Iacobuzio-Donahue,C.A., Maitra,A., Olsen,M. et al. (2003) Exploration of
global gene expression patterns in pancreatic adenocarcinoma using cDNA
microarrays. Am. J. Pathol., 162, 1151--1162.
47. Tureci,O., Ding,J., Hilton,H. et al. (2003) Computational dissection of
tissue contamination for identification of colon cancer-specific expression
profiles. FASEB J., 17, 376--385.
48. Giese,N.A., Raykov,Z., DeMartino,L., Vecchi,A., Sozzani,S., Dinsart,C.,
Cornelis,J.J. and Rommelaere,J. (2002) Suppression of metastatic
hemangiosarcoma by a parvovirus MVMp vector transducing the
IP-10 chemokine into immunocompetent mice. Cancer Gene Ther., 9,
432--442.
49. Emmert-Buck,M.R., Bonner,R.F., Smith,P.D., Chuaqui,R.F., Zhuang,Z.,
Goldstein,S.R., Weiss,R.A. and Liotta,L.A. (1996) Laser capture microdissection. Science, 274, 998--1001.
50. Sato,N., Maitra,A., Fukushima,N., van Heek,N.T., Matsubayashi,H.,
Iacobuzio-Donahue,C.A., Rosty,C. and Goggins,M. (2003) Frequent
hypomethylation of multiple genes overexpressed in pancreatic ductal
adenocarcinoma. Cancer Res., 63, 4158--4166.
51. Aprelikova,O., Pace,A.J., Fang,B., Koller,B.H. and Liu,E.T. (2001)
BRCA1 is a selective co-activator of 14-3-3 sigma gene transcription in
mouse embryonic stem cells. J. Biol. Chem., 276, 25647--25650.
52. Booher,R.N., Holman,P.S. and Fattaey,A. (1997) Human Myt1 is a cell
cycle-regulated kinase that inhibits Cdc2 but not Cdk2 activity. J. Biol.
Chem., 272, 22300--22306.
53. Liu,F., Stanton,J.J., Wu,Z. and Piwnica-Worms,H. (1997) The human
Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and
localizes to the endoplasmic reticulum and Golgi complex. Mol. Cell.
Biol., 17, 571--583.
54. Zha,J., Harada,H., Yang,E., Jockel,J. and Korsmeyer,S.J. (1996) Serine
phosphorylation of death agonist BAD in response to survival factor
results in binding to 14-3-3 not BCL-X (L). Cell, 87, 619--628.
55. Yang,E., Zha,J., Jockel,J., Boise,L.H., Thompson,C.B. and Korsmeyer,S.J.
(1995) Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax
and promotes cell death. Cell, 80, 285--291.
56. Ottilie,S., Diaz,J.L., Horne,W., Chang,J., Wang,Y., Wilson,G., Chang,S.,
Weeks,S., Fritz,L.C. and Oltersdorf,T. (1997) Dimerization properties of
human BAD. Identification of a BH-3 domain and analysis of its binding
to mutant BCL-2 and BCL-XL proteins. J. Biol. Chem., 272,
30866--30872.
57. Zha,J., Harada,H., Osipov,K., Jockel,J., Waksman,G. and Korsmeyer,S.J.
(1997) BH3 domain of BAD is required for heterodimerization with BCLXL and pro-apoptotic activity. J. Biol. Chem., 272, 24101--24104.
58. Kelekar,A., Chang,B.S., Harlan,J.E., Fesik,S.W. and Thompson,C.B.
(1997) Bad is a BH3 domain-containing protein that forms an inactivating
dimer with Bcl-XL. Mol. Cell. Biol., 17, 7040--7046.
59. Kleeff,J., Kornmann,M., Sawhney,H. and Korc,M. (2000) Actinomycin D
induces apoptosis and inhibits growth of pancreatic cancer cells. Int. J.
Cancer, 86, 399--407.
60. Waldman,T., Kinzler,K.W. and Vogelstein,B. (1995) p21 is necessary for
the p53-mediated G1 arrest in human cancer cells. Cancer Res., 55,
5187--5190.
61. Sinha,P., Hutter,G., Kottgen,E., Dietel,M., Schadendorf,D. and Lage,H.
(1999) Increased expression of epidermal fatty acid binding protein,
cofilin and 14-3-3-sigma (stratifin) detected by two-dimensional
gel electrophoresis, mass spectrometry and microsequencing of drugresistant human adenocarcinoma of the pancreas. Electrophoresis, 20,
2952--2960.
62. Courtois,S., de Fromentel,C.C. and Hainaut,P. (2004) p53 protein variants:
structural and functional similarities with p63 and p73 isoforms.
Oncogene, 23, 631--638.
63. Guo,J., Kleeff,J., Li,J., Ding,J., Hammer,J., Zhao,Y., Giese,T., Korc,M.,
Buchler,M.W. and Friess,H. (2004) Expression and functional significance
of CDC25B in human pancreatic ductal adenocarcinoma. Oncogene,
23, 71--81.
Received December 2, 2003; revised February 24, 2004;
accepted March 31, 2004
1585