Cardiovascular Research 67 (2005) 245 – 255 www.elsevier.com/locate/cardiores Activation of cardiac and smooth muscle-specific genes in primary human cells after forced expression of human myocardin John van Tuyna,b, Shoshan Knaän-Shanzerb, Marloes J.M. van de Wateringb, Michelle de Graaf a,b,c, Arnoud van der Laarsea, Martin J. Schalija, Ernst E. van der Walla, Antoine A.F. de Vriesb, Douwe E. Atsmaa,* a Department of Cardiology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA, P.O. Box 9600, 2300 RC Leiden, the Netherlands b Department of Molecular Cell Biology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL, Leiden, the Netherlands c Interuniversity Cardiology Institute of the Netherlands, Catharijnesingel 52, 3511 GC, Utrecht, the Netherlands Received 22 October 2004; received in revised form 11 March 2005; accepted 5 April 2005 Available online 23 May 2005 Time for primary review 17 days Abstract Objective: Myocardin is a recently discovered transcriptional regulator of cardiac and smooth muscle development. Its ability to transactivate smooth muscle-specific genes has been firmly established in animal cells but its effect on heart muscle genes has been investigated less extensively and the consequences of ectopic myocardin expression in human cells are unknown. Methods: In this study, primary human mesenchymal stem cells and foreskin fibroblasts were transduced with human adenovirus vectors expressing the longest splice variant of the human myocardin gene (hAd5/F50.CMV.myocL) or with control vectors. One week later, the expression of muscle-restricted genes in these cells was analyzed by reverse transcription-polymerase chain reactions and immunofluorescence microscopy. Results: Forced expression of myocardin induced transcription of cardiac and smooth muscle genes in both cell types but did not lead to activation of skeletal muscle-specific genes. Double labeling experiments using monoclonal antibodies directed against striated (i.e. sarcomeric a-actin and sarcomeric a-actinin) and cardiac (i.e. natriuretic peptide precursor A) muscle-specific proteins together with a polyclonal antiserum specific for smooth muscle myosin heavy chain revealed that hAd5/F50.CMV.myocL-transduced cells co-express heart and smooth muscle-specific genes. Conclusions: These data indicate that the myocardin protein is a strong inducer of both smooth and cardiac muscle genes, but that additional factors are necessary to fully commit cells to either cardiac or smooth muscle cell fates. D 2005 European Society of Cardiology. Published by Elsevier B.V. All rights reserved. Keywords: Cell differentiation; Myocardin; Myocyte; Smooth muscle; Stem cells This article is referred to in the Editorial by C. Ventura (pages 182 – 183) in this issue. 1. Introduction The differentiation of cardiac, skeletal, and smooth muscle cells is characterized by the transactivation of * Corresponding author. Tel.: +31 71 5262020; fax: +31 71 5266809. E-mail address: [email protected] (D.E. Atsma). overlapping but distinct sets of muscle-restricted genes. Cardiovascular and neuromuscular diseases are often associated with alterations in the differentiation state of muscle cells. Accordingly, studying the factors that orchestrate the genetic program of cardiac and smooth muscle cells is important for understanding cardiac disease and to guide the development of novel treatment modalities aiming at the formation of new blood vessels and cardiomyocytes in infarcted myocardium. Myocardin is a recently discovered transactivator of the ubiquitous transcription factor (TF) serum response factor 0008-6363/$ - see front matter D 2005 European Society of Cardiology. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.cardiores.2005.04.013 246 J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 [1], which regulates the expression of many growth-related and muscle-restricted genes by binding to CC(A/T)6GG and closely related nucleotide sequence motifs (also known as CArG boxes) in their promoters [2]. In situ hybridization, Northern blot, and reverse transcription-polymerase chain reaction (RT-PCR) analyses have shown that myocardin expression is (largely) restricted to cardiac and smooth muscle tissue both during embryogenesis and in adults [1,3 – 6]. The repression of muscle protein-coding genes in the heart anlage, but not in the developing somites of Xenopus laevis embryos after microinjection in 8-cell blastomeres of mRNA encoding a dominant negative form of myocardin, yielded further evidence for a specific role of myocardin in cardiac muscle development [1]. Moreover, expression of a recombinant gene coding for a dominant negative version of myocardin in murine teratocarcinoma cells blocked their in vitro differentiation into cardiomyocytes [7]. Dominant negative myocardin mutants also inhibited the activity of the smooth muscle a-actin (ASMA), smooth muscle myosin heavy chain (smMHC), and transgelin (SM22) promoters but did not affect transcription of the smoothelin and aortic carboxypeptidase-like protein genes in various in vitro assay systems [1,4,6,8,9]. Failing human and porcine myocardium contained significantly more myocardin mRNA than heart muscle from healthy individuals [5]. Targeted degradation of myocardin transcripts in rat aortic smooth muscle cells by RNA interference technology inhibited expression of recombinant luciferase genes placed under the control of smooth muscle gene-specific promoters [4,6]. In addition, myocardin has been shown to activate promoters of both cardiac and smooth muscle genes in transfection assays based on the use of reporter gene constructs [1,3,4,6 – 12]. However, transgenic mice lacking exons 8 and 9 of the myocardin gene displayed no obvious defects in cardiac morphogenesis but failed to form smooth muscle cells and died at embryonic day 10.5 with severe vascular abnormalities [13]. These results suggest that the smooth muscle developmental program critically depends on myocardin but that its function in heart muscle formation can be taken over by other TFs. Moreover, whereas forced expression of myocardin in non-human cells consistently induced the transcription of multiple smooth muscle genes, the activation of cardiomyocyte-specific genes was much less usual [4,6 –12]. Since until now the transcription-enhancing activity of myocardin has only been studied in animal cells, we investigated the effect of ectopically expressed human myocardin on the expression of muscle-specific genes in human mesenchymal stem cells (hMSCs) isolated from bone marrow (BM) and in human fibroblasts derived from foreskin (hFFBs). hMSCs were chosen for this study because: (i) hMSCs are a readily obtainable source of autologous cells with the ability to generate bone, cartilage, fat, ligament, stroma, tendon, and under special conditions also muscle. (ii) hMSCs can be greatly expanded ex vivo using ordinary cell culture systems. (iii) Differentiation of hMSCs into cardiomyocytes has been reported both in vitro and in vivo, which makes these cells potentially useful for repairing heart muscle damage (see Ref. [14] and references therein). The hFFBs were included as previous in vitro studies on myocardin were mostly performed in fibroblasts. RT-PCR analyses of total RNA extracted from cultures of these two primary human cell types showed that myocardin activates genes encoding cardiomyocyte-specific TFs, sarcomeric components, and pore-forming proteins as well as smooth muscle cell-specific contractile proteins and thin filament regulatory proteins but does not induce expression of skeletal muscle-restricted genes. Immunofluorescence microscopy (IFM) revealed that myocardin initiated muscle-specific gene expression in 5– 15% of the hMSCs. These particular cells stained positive for cardiac as well as smooth muscle cell markers. Our findings underscore that myocardin is an important activator of the smooth muscle genetic program and show for the first time its ability to transactivate multiple endogenous heart muscle-specific genes in vitro. Furthermore, the acquisition of both heart and smooth muscle characteristics by the myocardinresponsive hMSCs suggests that other factors are necessary to fully commit these cells to either smooth or cardiac muscle cell fates. 2. Methods 2.1. Primary human cells and human cell lines hMSCs were purified from BM samples of adult patients as described [14]. All human materials were obtained after informed consent of the donors and experiments with the human specimens were carried out according to the official guidelines of the Leiden University Medical Center. Both hMSCs and hFFBs (VH10 cells [15]) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 Ag/ml streptomycin. The generation and propagation of conditionally immortalized euploid myoblasts derived from a patient with Duchenne muscular dystrophy has been described elsewhere [16]. These cells are phenotypically indiscernible from their nonimmortalized predecessors in various assays and can form myotubes in vitro. All cells were cultured at 37 -C in a humidified air—10% CO2 atmosphere except for the skeletal myoblasts, which were kept at 5% CO2. 2.2. Characterization of hMSCs The hMSCs were characterized by their surface antigen profile using a FACSort flow cytometer, CellQuest software (both from Becton Dickinson), and the antibodies specified in Table 1. The surface antigen profile of the hMSCs (for J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 Table 1 Antibodies used for the immunophenotypic characterization of hMSCs Antigen Source Clone (Iso)type Label Species CD1a CD10 BD CLB IgG2b IgG2a – PE mouse mouse CD14 CLB IgG2a PE mouse CD19 CD34 CD44 CD45 BD BD BD CLB IgG1 IgG1 IgG2b IgG1 PE FITC PE PE mouse mouse mouse mouse CD46 CD56 CD61 CD62P BD CLB BD CLB IgG2a IgG1 IgG1 IgG1 FITC PE FITC PE mouse mouse mouse mouse CD71 CD90 CD105 CD106 CXCR-4 (fusin) HLA-ABC HLA-DR CLB BD DC BD BD BD CLB IgG1 IgG1 IgG1 IgG1 IgG2a IgG1 IgG1 PE PE – PE PE FITC FITC mouse mouse mouse mouse mouse mouse mouse VEGFR-2 (Flk-1) KLH KLH Mouse IgG1 Mouse IgG SC BD BD BD BD IgG1 IgG1 IgG2a IgG1 – – PE/FITC PE PE FITC mouse mouse mouse rat goat SK9 CLB-CALLA/1, 4F9 CLB-mon/I, 8G3 4G7 8G12 G44-26 (C26) CLB-T200/1, 15D9 E4.3 B159 RUU-PL7F12 CLB-tromb/6, C2 RVS10 5E10 SN6h 51-10C9 12G5 G46-2.6 CLB-HLA-Dr, 1E5 A-3 X40 X39 X56 – The immunoglobulins directed against keyhole limpet hemocyanin (KLH) were used as isotype-matched control antibodies. BD, Becton Dickinson; CLB, Sanquin; DC, DakoCytomation; SC, Santa Cruz; PE, phycoerythrin; FITC, fluorescein isothiocyanate. All antibody preparations were used at the concentrations recommended by the suppliers. details see online supplement) matches previously published data [14]. In contrast to the hFFBs, the hMSCs differentiated into adipocytes and osteoblasts after proper stimulation confirming their multipotent nature (data not shown). 2.3. RNA extraction Total cellular RNAwas extracted from tissues and cultured cells using TRIzol reagent (Invitrogen). Human atrial RNA was derived from pooled right atrial appendices excised during cardiac surgery of adult patients; human ventricular RNA was obtained from an individual who underwent partial left ventriculectomy. Skeletal muscle RNA was extracted from a specimen of vastus lateralis muscle removed during orthopedic surgery. Arteries from human umbilical cords served as a source of vascular smooth muscle RNA. 2.4. Cloning of human myocardin cDNA The genomic sequence for human myocardin was identified in a tblastn search of the GenBank database using murine myocardin (GenBank accession number: AAK71683.2) as query. The gene for a protein with 78% amino acid sequence identity to murine myocardin was found 247 on human chromosome 17. The gene encoding human myocardin was cloned using RT-PCR (for more information see online supplement). Nucleotide sequence analysis using the primers listed in Table 2 revealed that the largest splice variant (splice variant B [5]) of the human myocardin gene had been cloned. The assembled nucleotide sequence has been deposited in GenBank (http://www.ncbi.nih.gov/) under accession number AY764180. 2.5. First-generation adenovirus vectors Fiber-modified human adenovirus serotype 5 (hAd5) vectors (hAd5/F50 vectors) encoding human myocardin (hAd5/F50.CMV.myocL) or without heterologous expression cassette (hAd5/F50.empty) were generated as described [17]. The vectors hAd5/F5.CMV.eGFP and hAd5/ F50.CMV.eGFP, expressing the enhanced green fluorescent protein (eGFP) gene and carrying human adenovirus serotype 5 and 50 fiber domains, respectively, have been documented elsewhere [17]. To determine the optimal vector (doses) for hMSCs and hFFBs, these cell types were transduced with 0, 12.5, 25, 50, 100, or 200 infectious units (IU) of hAd5/F5.CMV.eGFP or hAd5/F50.CMV.eGFP per cell and seeded in 2-cm2 wells at a concentration of 104 cell/ cm2. At 72 h postinfection, the cells were subjected to flow cytometric analyses. 2.6. Reverse transcription-polymerase chain reaction analysis hMSCs and hFFBs were either mock-infected or infected with 100 IU/cell of hAd5/F50.CMV.myocL or hAd5/ F50.empty and plated at a density of 4 103 cells/cm2. At 24 h postinfection, the inoculum was replaced by fresh medium. Total cellular RNA was extracted from the cells 7 days after transduction. To detect cardiac, skeletal, and smooth muscle-specific mRNAs, cDNA was then synthesized and subjected to PCR (details available in online supplement). The forward primer in each set always targeted another exon than the reverse primer (Table 3). As internal controls for the quantity and quality of the RNA specimens, RT-PCR amplifications targeting transcripts of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were performed in parallel. Total RNA samples derived from human atrium, ventricle, smooth muscle, Table 2 Primers used for nucleotide sequence analysis of human myocardin cDNA ctccattggtcttccatagcactg cgggatccggcagcctatgacatca atccacgctgttttga gctgcaataaacaagtt acgccactgagcaatacc tcataggatggaggctgt ggtccattccaactgctcagatgaag cagtggcgttgaagaagagttt Primer sequences are given in the 5V– 3Vdirection. 248 J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 Table 3 Primer sequences and PCR conditions used for RT-PCR analysis Product (size in bp) Ta Cycles Forward primer (5V– 3V) Reverse primer (5V– 3V) GAPDH (302) Myocardin (1141, 997) cTnI (250) cTnT (150) Mlc2a (381) Mlc2v (382) aMHC (413) hMHC (118) dHand (258) eHand (342) GATA4 (475) Mef2C (300) Nkx2.5 (279) ANF (406) Cx43 (232) SERCA2a (186) ASMA (965) CNN1 (671) SM22 (928) smMHC (479) fsTnI (201) skMHC (167) ssTnI (310) 62 63 61 61 61 60 61 55 60 60 61 60 60 63 60 60 60 60 60 60 60 60 64 25 35 35 32 35 40 35 35 35 40 35 35 40 35 35 25 30 30 30 24 38 28 35 agccacatcgctcagacacc ggactgctctggcaacccagtgc ccctgcaccagccccaatcaga ggcagcggaagaggatgctgaa aaggtgaagtgtcccagagg ggtgctgaaggctgattacgtt gtcattgctgaaaccgagaatg gatcaccaacaacccctacg ccgacgtgaaagaggagaag ggagacgcactgagagcatt gacgggtcactatctgtgcaac ctgggaaaccccaacctatt tctatccacgtgcctacagc gaaccagaggggagagacagag aggcgtgaggaaagtaccaa ggtgctgaaaatctccttgc ccagctatgtgtgaagaagagg gagtgtgcagacggaacttcagcc cgcgaagtgcagtccaaaatcg cagatccgagctcgccat cctgaagcaggtcaagaagg gaaattacttctggcaaaatacagg aacccaagatcactgcctcccg gtactcagcgccagcatcg catctgctgactccgggtcatttgc cgaagcccagcccggccaact gaggcaccaagttgggcatgaacga acagagtttattgaggtgcccc tattggaacatggcctctggat agacatcgcactgactgagaac gaagcccagcacatcaaaag ggatgattccaaatgcaagg cggctcactggtttaactcc agacatcgcactgactgagaac gctgcctggtggaataagaa agatcttgacctgcgtggac ccctcagcttgctttttaggag acaccttccctccagcagtt atcagtcatgcacagggttg gtgatctccttctgcattcggt gtctgtgcccagcttggggtc gggctggttcttcttcaatgggc ccgagtagatgggcaggtgt tctgggtgcatctccctagt gcagatgccagttttccagt cgcttgaacttcccacggaggt bp, Base pairs; Ta, annealing temperature. For an explanation of the abbreviations of the marker genes, see the main text of the paper. skeletal muscle, and a human skeletal myoblast cell line before and after myotube formation were also subjected to RT-PCR to provide positive controls and to determine the specificity of the marker genes. PCRs carried out with water instead of cDNA served as negative controls. 2.7. Immunofluorescence microscopy For immunostaining, hMSCs were transduced with hAd5/ F50.CMV.myocL or hAd5/F50.empty and plated on glass coverslips coated with fibronectin (Sigma-Aldrich) at a density of 3 103 cells/cm2. Seven days later, the cells were processed for IFM as described in the data supplement. The cells were labeled with mouse monoclonal antibodies (MAbs) directed against sarcomeric a-actin, sarcomeric a- actinin, sarcoplasmic reticulum Ca(2+)-ATPase 2a (SERCA2a), or atrial natriuretic peptide precursor A (ANF) and polyclonal antisera specific for slow skeletal troponin I (ssTnI), smMHC [18], or GATA4 and stained with AlexaFluor488-, AlexaFluor555-, or AlexaFluor568-conjugated secondary antibodies (Table 4). Nuclei were stained with Hoechst 33342 (Molecular Probes). Double labeling experiments were performed in a similar manner except that the coverslips were simultaneously incubated with the rabbit anti-smMHC antiserum in combination with the anti-sarcomeric a-actin, anti-sarcomeric a-actinin, antiSERCA2a, or anti-ANF MAbs. To visualize the primary antibodies, the cells were incubated with a mixture of the aforementioned secondary antibodies. 2.8. Cell viability assay Table 4 Antibodies used for the detection of cardiac and smooth muscle proteins Antigen Vendor Clone (Iso)type Label Species Sarcomeric a-actin Sarcomeric a-actinin SERCA2a ANF ssTnI smMHC GATA4 Rabbit IgG Mouse IgG Goat IgG SA SA AB CH SC – SC MP MP MP IgM IgG1 IgG2a IgG1 – – – – – – Mouse Mouse Mouse Mouse Rabbit Rabbit Goat Goat Goat Rabbit 5C5 EA-53 2 A7-A1 23/1 – – – – – – – – – – – – – Alexa568 Alexa488 Alexa555 SA, Sigma-Aldrich; AB, Affinity BioReagents; CH, Chemicon; SC, Santa Cruz; MP, Molecular Probes. The smMHC-specific monoclonal antibody was a gift of R.S. Adelstein [3]. Propidium iodide and Hoechst 33342 stainings were used to study apoptosis and necrosis, essentially as described by Darzynkiewicz et al. [19]. 3. Results 3.1. Expression of human myocardin The currently available data indicate that there are at least three alternatively spliced variants of human myocardin, tentatively designated myocardin-A, myocardin-B, and myocardin-C [5]. The two largest splice variants of myocardin were detected in human atrial, ventricular, and J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 249 Fig. 1. RT-PCR analysis of myocardin expression. (A) Schematic representation of myocardin splice variants. Myocardin-B consists of 14 exons and myocardin-A contains 13 exons. The position of the forward (F) and reverse (R) primers used for RT-PCR as well as the expected lengths of the PCR products are indicated. The myocardin-A-specific PCR fragment is 144 bp smaller than the amplification product of myocardin-B due to the lack of exon 11. (B) Left panels: RT-PCR analysis of myocardin expression in untreated (U) hMSCs and hFFBs and in hAd5/F50.empty (E)-or hAd5/F50.CMV.myocL (M)-infected cells using total RNA extracted 7 days after vector addition. Right panels: myocardin expression in atrium (AT), smooth muscle (SM), ventricle (VE), skeletal myoblasts (MB), skeletal myotubes (MT), and skeletal muscle (SK). PCRs carried out with water instead of cDNA served as negative control (NC). smooth muscle tissue by RT-PCR using forward and reverse primers targeting exons 10 and 13, respectively (Fig. 1). A similar result was obtained using RNA extracted from human skeletal muscle as template although the relative yield of the myocardin-specific PCR fragments was much lower than for the other muscle tissues (Fig. 1). The preponderance of the largest splice variant of myocardin (i.e. myocardin-B) in cardiac and smooth muscle tissue from human adults (Fig. 1) fits with previous observations in the mouse [7]. It is possible that the myocardin transcripts in the skeletal muscle specimen are derived from vascular smooth muscle cells. We therefore also investigated the presence of myocardin mRNA in human skeletal myoblasts [16] before and after differentiation into myotubes. No myocardin expression was detected in these samples, corroborating earlier claims that skeletal muscle cells do not express myocardin [1,3,6,10]. 3.2. Efficient transduction of hMSCs and hFFBs by hAd5F50 vectors We tested the wild-type and fiber-modified hAd5 vectors hAd5/F5.CMV.eGFP and hAd5/F50.CMV.eGFP for their ability to transduce hMSCs and hFFBs. Cells were infected with different vector doses and analysed by flow cytometry. hAd5/F50.CMV.eGFP transduced both hMSCs and hFFBs far more efficiently than hAd5/ F5.CMV.eGFP (Fig. 2). A dose of 100 IU of hAd5/ F50.CMV.eGFP per cell was found optimal as it resulted in high-level eGFP expression in virtually 100% of the cells without noticeable toxicity. On the basis of the aforementioned results, a hAd5/F50 vector expressing the largest splice variant of myocardin was generated. Transduction of hMSCs or hFFBs with 100 Fig. 2. Flow cytometric analysis of hMSCs and hFFBs infected with hAd5/F5.CMV.eGFP (F5) or hAd5/F50.CMV.eGFP (F50). The percentage of eGFP-positive cells and the mean fluorescence intensity (arbitrary units) of the cells are plotted against the vector dose. Values are given as means T standard deviation (n = 4). 250 J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 IU/cell of this so-called hAd5/F50.CMV.myocL vector resulted in high-level expression of myocardin-B as determined by RT-PCR (Fig. 1). Interestingly, relatively low amounts of myocardin-A and -B transcripts were also detected in untreated hMSCs and hFFBs cells and in cells infected with the negative control vector hAd5/F50.empty (Fig. 1). Analysis of nuclear morphology and propidium iodide and Hoechst 33342 uptake revealed that transduction of hMSCs with hAd5/F50.CMV.myocL or hAd5/F50.empty did not result in increased cell death by either apoptosis or necrosis as compared to untreated hMSCs (Figs. 4, 5, and data not shown). 3.3. Forced myocardin expression activates heart muscle genes We first investigated the ability of myocardin to induce in hMSCs and hFFBs the transcription of genes that are active in human cardiomyocytes (Fig. 3A). Mock- or hAd5/F50.empty-transduced hMSCs and hFFBs did not express detectable amounts of the genes encoding cardiac troponin I (cTnI), cardiac troponin T (cTnT), the atrial and ventricular forms of myosin light chain 2 (Mlc2a and Mlc2v, respectively), cardiac a-and h-myosin heavy chain (aMHC and hMHC, respectively), eHand, GATA4, Nkx2.5, ANF, and SERCA2a. Transduction of hMSCs and hFFBs with hAd5/F50.CMV.myocL, however, resulted in the activation of all these genes with the exception of cTnI and Nkx2.5. Interestingly, we found that both hMSCs and hFFBs naturally express the genes encoding dHand, Mef2C, and connexin 43 (Cx43). Cx43 expression in hMSCs and hFFBs has been previously reported [20,21]. 3.4. Forced myocardin expression induces smooth muscle genes To evaluate the induction of smooth muscle gene expression by myocardin, the RNA samples were analyzed using primer pairs specific for the ASMA, smooth muscle calponin (CNN1), SM22, and smMHC genes (Fig. 3B). Each of these genes was expressed in arterial smooth muscle from umbilical cord. Low amounts of CNN1-, SM22-, and smMHC-specific transcripts were also detected in the myocardial samples, most likely due to the presence of blood vessels in these clinical specimens. No evidence for ASMA expression in heart muscle was obtained. However, ASMA-encoding transcripts were clearly present in the three samples representative of skeletal muscle. The SM22 gene was expressed in Fig. 3. RT-PCR analysis of muscle marker genes in hMSCs, hFFBs, and control tissues. Total RNA extracted from mock (-)-, hAd5/F50.empty (E)-, or hAd5/ F50.CMV.myocL (M)-transduced cells 7 days after (mock)-infection was subjected to RT-PCR using cardiac (A), smooth (B), and skeletal (C) muscle genespecific primers. The abbreviations of the marker genes are explained in the main text. J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 cultured myoblasts and myotubes. No SM22-specific mRNA was found in vastus lateralis skeletal muscle consistent with the reported expression of SM22 in developing but not mature striated muscles [22]. Analysis of the RNA extracted from the mock-treated hMSCs revealed that expression of the relatively widely expressed ASMA, CNN1, and SM22 genes but not of the highly specific smooth muscle marker gene smMHC [22] is intrinsic to these cells. Transduction of the hMSCs with hAd5/F50.CMV.myocL led to the accumulation of smMHC-specific transcripts in these cells. With the 251 hFFBs somewhat different results were obtained. Of the four selected smooth muscle marker genes, these cells naturally expressed only CNN1 and SM22. Forced myocardin expression in the hFFBs resulted in the synthesis of ASMA and smMHC mRNA. 3.5. Forced myocardin expression does not activate skeletal muscle genes Finally, we examined whether myocardin could also transactivate skeletal muscle genes in hMSCs and hFFBs. Fig. 4. Immunofluorescent staining of hMSCs transduced with hAd5/F50.CMV.myocL or hAd5/F50.empty. Blue, nuclei; green, sarcomeric a-actin (A), sarcomeric a-actinin (B), SERCA2a (C), or ANF (D); red, ssTnI (E) or smMHC (F). 252 J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 To this end, RT-PCR amplifications were carried out with primers specific for the fast-twitch skeletal troponin I (fsTnI), skeletal myosin heavy chain 2a (skMHC), and slow-twitch skeletal troponin I (ssTnI) genes (Fig. 3C). Whereas in humans the expression of the fsTnI and skMHC genes is restricted to skeletal muscle, the ssTnI gene is active not only in skeletal muscle but also in embryonic, fetal, and neonatal myocardium [23]. Each of these genes was expressed in the vastus lateralis skeletal muscle, the myotubes, and the myoblasts. The RT-PCR analyses of the myocardial RNA samples showed that the right atrium and left ventricle contain ssTnI- but not fsTnI- or skMHCencoding transcripts. The smooth muscle specimen, on the other hand, did not yield fsTnI-, skMHC-, or ssTnI-specific RT-PCR fragments. Infection of hMSCs and hFFBs with hAd5/F50.CMV.myocL induced the expression of ssTnI, but not of the fsTnI or skMHC genes. 3.6. Myocardin activates both cardiac and smooth muscle genes in single cells To confirm the induction of cardiac and smooth muscle genes at the protein level, hAd5/F50.CMV.myocL-transduced hMSCs were analyzed by IFM using antibodies specific for sarcomeric a-actin, sarcomeric a-actinin, SERCA2a, ANF, ssTnI, smMHC (Fig. 4), and GATA4 (see Fig. 1 of the data supplement). As mentioned above and shown in Fig. 3B, the smMHC protein is a highly specific marker for smooth muscle cells. The sarcomeric a-actin and a-actinin proteins have been found in both skeletal and cardiac but not in smooth muscle [24]. We (Fig. 3C) and others (vide supra) have shown that the expression of the ssTnI gene is also confined to striated muscle. In contrast, SERCA2a molecules are found in all three muscle types [25], while the ANF and GATA4 genes are expressed in cardiac but not in smooth or skeletal muscle (Fig. 3). The immunostainings revealed that approximately 10% of the infected hMSCs stained positive for each of these proteins, while none of the mock- (data not shown) or hAd5/ F50.empty-transduced cells exhibited specific labeling with any of the antibodies (Fig. 4). The number of fluorescent cells was comparable at 1, 2, and 3 weeks after infection with Ad5/F50.CMV.myocL. The hMSCs that expressed the aforementioned proteins did not develop well-organized sarcomeres and did not display spontaneous beating within the period of observation. The results of the single antibody staining experiments raised the question whether cardiac and smooth muscle marker genes are expressed by the same or different cells in the hAd5/F50.CMV.myocL-treated hMSCs cultures. To investigate this issue, we performed double labeling experiments with MAbs directed against sarcomeric a-actin, sarcomeric a-actinin, SERCA2a, or ANF in combination with polyclonal antibodies recognizing smMHC (Fig. 5). These experiments showed that the smMHC-specific antibodies labeled all hMSCs that stained positive for sarco- meric a-actin, sarcomeric a-actinin, SERCA2a, or ANF. We hence conclude that these cells had acquired characteristics of both cardiac and smooth muscle cells. 4. Discussion In this paper, we have demonstrated that forced expression of human myocardin is sufficient to induce the expression of a broad range of cardiac and smooth muscle genes in human adult stem cells and primary human fibroblasts. These findings support the concept that myocardin plays an important role in cardiomyogenesis and vasculogenesis and are consistent with the cardiac and smooth muscle-restricted expression of myocardin [1,3 – 7]. Furthermore, IFM studies revealed that under our experimental conditions myocardin simultaneously activates (in single cells) both heart and smooth muscle genes. Accordingly, other factors are required to delimit the cardiac and smooth muscle transcriptomes. While in our experiments myocardin acted as a potent inducer of both cardiomyocyte- and smooth musclespecific genes, two previous papers only reported on the ability of myocardin to regulate smooth muscle gene expression [4,6]. Furthermore, in a detailed study carried out with murine embryonic fibroblasts (i.e. 10T1/2 cells) ectopic myocardin expression caused the activation of smooth muscle genes as well as the skeletal a-actin gene but not of cardiomyocyte-specific genes [11]. In yet another study, forced expression of myocardin in A404 cells, which are derived from mouse embryonic teratocarcinoma cells and readily differentiate into smooth muscle cells, resulted in the accumulation of cardiac and skeletal a-actin mRNAs besides smooth muscle gene-specific transcripts but did not lead to GATA4 expression [9]. There are several possible explanations why we found ample evidence for the activation of endogenous cardiac genes by myocardin whereas others did not: (i) In the studies of Du et al. [4] and Yoshida et al. [6] the activation of cardiac muscle genes was not investigated. (ii) We are the first to test the effects of human myocardin in human cells. Species-related differences in myocardin activity may hence account for the observed differences in target gene specificity. (iii) In none of the previous studies the transactivating potential of the myocardin isoform encoded by splice variant B of myocardin [5] was investigated. Perhaps, the additional 48 amino acid residues encoded by this isoform make it a stronger inducer of cardiomyocytespecific genes than the myocardin-A-encoded protein. Moreover, as far as we could deduce, in all previous studies focusing on the ability of myocardin to switch on endogenous genes, an amino-terminally truncated version of the protein has been used. The amino terminus of myocardin contains RPEL motifs. For MAL (also known as BSAC, MLK1, and MRTF-A), a protein closely related to myocardin, these motifs have been shown to control its J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 253 Fig. 5. Immunofluorescent double staining of hMSCs transduced with hAd5/F50.CMV.myocL or hAd5/F50.empty. Blue, nuclei; green, sarcomeric a-actin, sarcomeric a-actinin, SERCA2a, or ANF; red, smMHC. 254 J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 intracellular distribution and therefore its transcriptional activity through their interaction with G actin [26]. It is conceivable that the RPEL domains of myocardin are also involved in the regulation of its function. (iv) The developmental options of a cell are limited by the methylation pattern and chromatin structure of its DNA and by the identity, concentration, and activity of its transcriptional regulators. Accordingly, the cell type in which the myocardin gene is expressed may have a large impact on the outcome of the experiments. Human adult stem cells and primary human fibroblasts may have an epigenetic make-up that allows them to enter into a cardiomyocyte-specific gene expression pattern much easier than some other (immortal) cell types. In Figs. 4 and 5, we showed that after infection of hMSCs with 100 IU of hAd5/F50.CMV.myocL per cell, a vector dose sufficient to transduce the entire cell population (Fig. 2), only approximately 10% expresses cardiac and smooth muscle genes. Although the reason of this apparent discrepancy is unclear, we have some preliminary results showing that the phenomenon is cell type-dependent (data not shown). To determine the extent to which myocardin induces the differentiation of hMSCs and hFFBs into cardiac, skeletal, or smooth muscle cells, we analyzed the expression of marker genes for each of these muscle lineages. A limitation of this approach is the considerable overlap between the gene expression profiles of cardiac, skeletal, and smooth muscle cells. Most of the genes that have been used as smooth muscle markers, are for instance, also expressed in developing heart and skeletal muscle (see Fig. 3A – C and [22]) and many myofibrillar proteins are present in the sarcomeres of both cardiac and skeletal muscle [24]. Another confounding factor may be the effect of tissue culture on the cells. Fibroblasts and mesenchymal stem cells have been reported to adopt a myofibroblast- or smooth muscle cell-like phenotype during in vitro culture [27 – 30]. This would explain the presence of ASMA-specific transcripts in hMSCs and CNN1 and SM22 mRNAs in hMSCs and hFFBs (Fig. 3B). The consequences of the adaptation of these cells to the in vitro culture conditions for their ability to form cardiac, skeletal, or smooth muscle cells are unknown. Nonetheless, smMHC can be considered as a highly specific marker for smooth muscle cells [22]. Likewise, cTnI-, Mlc2a-, GATA4-, and ANF-specific transcripts have not been detected in either skeletal or smooth muscle. In addition, fsTnI and skMHC expression are truly confined to skeletal muscle. The fact that the latter two genes are not switched on in hAd5/F50.CMV.myocL-transduced hMSCs and hFFBs, while expression of Mlc2a, GATA4, ANF, and smMHC is clearly induced, leaves us with no other conclusion than that myocardin transactivates both cardiac and smooth muscle genes but not (genuine) skeletal muscle genes. This conclusion is at variance with that of Yoshida et al. [9] who interpreted the myocardin-dependent activation of the cardiac and skeletal a-actin genes in A404 cells as evidence for the inappropriate induction by myocardin of cardiac and skeletal CArG box-dependent genes in cultured smooth muscle cells. However, since the skeletal a-actin gene is expressed in murine and rat hearts in a developmentally regulated fashion with a rapid decrease of the amount of skeletal a-actin-specific transcripts in this organ after birth [24], the activation by myocardin of an embryonic heart muscle expression program may provide an alternative explanation for the results of Yoshida et al. [9]. This would also explain our finding that in hAd5/ F50.CMV.myocL-transduced hMSCs and hFFBs ssTnI instead of cTnI gets activated (Fig. 3C). The ASMA, CNN1, and SM22 genes have been shown to be (transiently) expressed in the developing heart of mammals as well [22]. The activation of these genes after infection of hFFBs with hAd5/F50.CMV.myocL could therefore be another indication for the transactivation of early cardiac muscle genes by myocardin. The co-labeling of hAd5/F50.CMV.myocL-transduced hMSCs with antibodies directed against the most explicit smooth muscle marker smMHC and with antibodies specific for sarcomeric a-actin, sarcomeric a-actinin, or ANF is, however, hard to reconcile with myocardin’s activity being restricted to genes expressed in embryonic cardiomyocytes. We hence favor the idea that myocardin is a transcriptional (co)activator of both cardiac and smooth muscle genes but does not regulate skeletal musclespecific gene expression and propose that myocardin cooperates with other factors to establish either a heart of smooth muscle phenotype. As shown in Fig. 3A, we could not detect Nkx2.5specific transcripts in hAd5/F50.CMV.myocL-transduced hMSCs or hFFBs, although the Nkx2.5 promoter is activated by myocardin in reporter gene assays [1] and the Nkx2.5 protein is involved in the regulation of myocardin expression [7]. Whether Nkx2.5 plays a role in limiting the transcription-enhancing activity of myocardin to heart muscle-specific genes remains to be investigated. The ability of myocardin to selectively activate cardiomyocyte- and smooth muscle-specific genes may allow for its therapeutic application. There is currently a large interest in the use of hMSCs to replenish cardiomyocytes that have been lost during an ischemic insult and to improve myocardial vascularization in patients suffering from coronary artery disease [14]. Previous studies have shown that the spontaneous differentiation of transplanted BM-derived stem cells into cardiomyocytes is inefficient [14,31] and that differentiation into potentially undesirable cell types such as fibroblasts occurs [31,32]. We envision that treatment of hMSCs with hAd5/F50.CMV.myocL before transplantation may enhance their propensity to differentiate into cardiac and smooth muscle cells in vivo. J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255 Acknowledgements The authors are indebted to Binie Klein for supplying the VH10 cells, Didier Trono for making available the conditionally immortalized dystrophin-negative human myoblasts, and Pieter Doevendans, Robbert Klautz, and Rob Nelissen for providing left over surgical material. We also thank Robert Adelstein for donating the smMHC-specific rabbit antiserum and Marie-José Goumans for supplying the hMHC-specific primers. Finally, Crucell N.V. is gratefully acknowledged for sharing their adenovirus vector production system. Part of this work was financed by the Netherlands Organisation for Health Research and Development (ZonMw). Appendix A. Supplementary Data Supplementary data associated with this article can be found, in the online version, at 10.1016/j.cardiores. 2005.04.013. References [1] Wang D-Z, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E, et al. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell 2001;105:851 – 62. [2] Miano JM. Serum response factor: toggling between disparate programs of gene expression. J Mol Cell Cardiol 2003;35:577 – 93. [3] Wang D-Z, Li S, Hockemeyer D, Sutherland L, Wang Z, Schratt G, et al. Potentiation of serum response factor activity by a family of myocardin-related transcription factors. Proc Natl Acad Sci U S A 2002;99:14855 – 60. [4] Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, et al. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol 2003;23: 2425 – 37. [5] Torrado M, López E, Centeno A, Medrano C, Castro-Beiras A, Mikhailov AT. Myocardin mRNA is augmented in the failing myocardium: expression profiling in the porcine model and human dilated cardiomyopathy. J Mol Med 2003;81:566 – 77. [6] Yoshida T, Sinha S, Dandré F, Wamhoff BR, Hoofnagle MH, Kremer BE, et al. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res 2003; 92:856 – 64. [7] Ueyama T, Kasahara H, Ishiwata T, Nie Q, Izumo S. Myocardin expression is regulated by Nkx2.5, and its function is required for cardiomyogenesis. Mol Cell Biol 2003;23:9222 – 32. [8] Du KL, Chen M, Li J, Lepore JJ, Mericko P, Parmacek MS. Megakaryoblastic leukemia factor-1 transduces cytoskeletal signals and induces smooth muscle cell differentiation from undifferentiated embryonic stem cells. J Biol Chem 2004;279:17578 – 86. [9] Yoshida T, Kawai-Kowase K, Owens GK. Forced expression of myocardin is not sufficient for induction of smooth muscle differentiation in multipotential embryonic cells. Arterioscler Thromb Vasc Biol 2004;24:1596 – 601. [10] Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component of a molecular switch for smooth muscle differentiation. J Mol Cell Cardiol 2002;34:1345 – 56. [11] Wang Z, Wang D-Z, Pipes GCT, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci U S A 2003;100:7129 – 34. 255 [12] Wang Z, Wang D-Z, Hockemeyer D, McAnally J, Nordheim A, Olson EN. Myocardin and ternary complex factors compete for SRF to control smooth muscle gene expression. Nature 2004;428:185 – 9. [13] Li S, Wang D-Z, Wang Z, Richardson JA, Olson EN. The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci U S A 2003;100:9366 – 70. [14] Pittenger MF, Martin BJ. Mesenchymal stem cells and their potential as cardiac therapeutics. Circ Res 2004;95:9 – 20. [15] Klein B, Pastink A, Odijk H, Westerveld A, van der Eb AJ. Transformation and immortalization of diploid xeroderma pigmentosum fibroblasts. Exp Cell Res 1990;191:256 – 62. [16] Cudré-Mauroux C, Occhiodoro T, König S, Salmon P, Bernheim L, Trono D. Lentivector-mediated transfer of Bmi-1 and telomerase in muscle satellite cells yields a Duchenne myoblast cell line with longterm genotypic and phenotypic stability. Hum Gene Ther 2003;14: 1525 – 33. [17] Knaän-Shanzer S, van der Velde I, Havenga MJE, Lemckert AA, de Vries AAF, Valerio D. Highly efficient targeted transduction of undifferentiated human hematopoietic cells by adenoviral vectors displaying fiber knobs of subgroup B. Hum Gene Ther 2001;12: 1989 – 2005. [18] Kawamoto S, Adelstein RS. Characterization of myosin heavy chains in cultured aorta smooth muscle cells. A comparative study. J Biol Chem 1987;262:7282 – 8. [19] Darzynkiewicz Z, Bruno S, Del Bino G, Gorczyca W, Hotz MA, Lassota P, et al. Features of apoptotic cells measured by flow cytometry. Cytometry 1992;13:795 – 808. [20] Krenacs T, Rosendaal M. Connexin43 gap junctions in normal, regenerating, and cultured mouse bone marrow and in human leukemias: their possible involvement in blood formation. Am J Pathol 1998;152:993 – 1004. [21] Guo H, Acevedo P, Parsa FD, Bertram JS. Gap-junctional protein connexin 43 is expressed in dermis and epidermis of human skin: differential modulation by retinoids. J Invest Dermatol 1992;99:460 – 7. [22] Miano JM. Mammalian smooth muscle differentiation: origins, markers and transcriptional control. Results Probl Cell Differ 2002; 38:39 – 59. [23] Murphy AM. Contractile protein phenotypic variation during development. Cardiovasc Res 1996;31:E25 [Spec No]. [24] Schiaffino S, Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev 1996;76: 371 – 423. [25] Lytton J, Zarain-Herzberg A, Periasamy M, MacLennan DH. Molecular cloning of the mammalian smooth muscle sarco(endo)plasmic reticulum Ca2+-ATPase. J Biol Chem 1989;264:7059 – 65. [26] Miralles F, Posern G, Zaromytidou A-I, Treisman R. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 2003; 113:329 – 42. [27] Silva Jr WA, Covas DT, Panepucci RA, Proto-Siqueira R, Siufi JLC, Zanette DL, et al. The profile of gene expression of human marrow mesenchymal stem cells. Stem Cells 2003;21:661 – 9. [28] Masur SK, Dewal HS, Dinh TT, Erenburg I, Petridou S. Myofibroblasts differentiate from fibroblasts when plated at low density. Proc Natl Acad Sci U S A 1996;93:4219 – 23. [29] Cai D, Marty-Roix R, Hsu H-P, Spector M. Lapine and canine bone marrow stromal cells contain smooth muscle actin and contract a collagen – glycosaminoglycan matrix. Tissue Eng 2001;7:829 – 41. [30] Kinner B, Zaleskas JM, Spector M. Regulation of smooth muscle actin expression and contraction in adult human mesenchymal stem cells. Exp Cell Res 2002;278:72 – 83. [31] Wang J-S, Shum-Tim D, Chedrawy E, Chiu RC-J. The coronary delivery of marrow stromal cells for myocardial regeneration: pathophysiologic and therapeutic implications. J Thorac Cardiovasc Surg 2001;122:699 – 705. [32] Wu GD, Nolta JA, Jin Y-S, Barr ML, Yu H, Starnes VA, et al. Migration of mesenchymal stem cells to heart allografts during chronic rejection. Transplantation 2003;75:679 – 85.
© Copyright 2026 Paperzz