Cardiovascular Research 67 (2005) 245 – 255
www.elsevier.com/locate/cardiores
Activation of cardiac and smooth muscle-specific genes in primary human
cells after forced expression of human myocardin
John van Tuyna,b, Shoshan Knaän-Shanzerb, Marloes J.M. van de Wateringb,
Michelle de Graaf a,b,c, Arnoud van der Laarsea, Martin J. Schalija, Ernst E. van der Walla,
Antoine A.F. de Vriesb, Douwe E. Atsmaa,*
a
Department of Cardiology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA, P.O. Box 9600, 2300 RC Leiden, the Netherlands
b
Department of Molecular Cell Biology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL, Leiden, the Netherlands
c
Interuniversity Cardiology Institute of the Netherlands, Catharijnesingel 52, 3511 GC, Utrecht, the Netherlands
Received 22 October 2004; received in revised form 11 March 2005; accepted 5 April 2005
Available online 23 May 2005
Time for primary review 17 days
Abstract
Objective: Myocardin is a recently discovered transcriptional regulator of cardiac and smooth muscle development. Its ability to
transactivate smooth muscle-specific genes has been firmly established in animal cells but its effect on heart muscle genes has been
investigated less extensively and the consequences of ectopic myocardin expression in human cells are unknown.
Methods: In this study, primary human mesenchymal stem cells and foreskin fibroblasts were transduced with human adenovirus vectors
expressing the longest splice variant of the human myocardin gene (hAd5/F50.CMV.myocL) or with control vectors. One week later, the
expression of muscle-restricted genes in these cells was analyzed by reverse transcription-polymerase chain reactions and immunofluorescence microscopy.
Results: Forced expression of myocardin induced transcription of cardiac and smooth muscle genes in both cell types but did not lead to
activation of skeletal muscle-specific genes. Double labeling experiments using monoclonal antibodies directed against striated (i.e.
sarcomeric a-actin and sarcomeric a-actinin) and cardiac (i.e. natriuretic peptide precursor A) muscle-specific proteins together with a
polyclonal antiserum specific for smooth muscle myosin heavy chain revealed that hAd5/F50.CMV.myocL-transduced cells co-express heart
and smooth muscle-specific genes.
Conclusions: These data indicate that the myocardin protein is a strong inducer of both smooth and cardiac muscle genes, but that additional
factors are necessary to fully commit cells to either cardiac or smooth muscle cell fates.
D 2005 European Society of Cardiology. Published by Elsevier B.V. All rights reserved.
Keywords: Cell differentiation; Myocardin; Myocyte; Smooth muscle; Stem cells
This article is referred to in the Editorial by C. Ventura
(pages 182 – 183) in this issue.
1. Introduction
The differentiation of cardiac, skeletal, and smooth
muscle cells is characterized by the transactivation of
* Corresponding author. Tel.: +31 71 5262020; fax: +31 71 5266809.
E-mail address: [email protected] (D.E. Atsma).
overlapping but distinct sets of muscle-restricted genes.
Cardiovascular and neuromuscular diseases are often
associated with alterations in the differentiation state of
muscle cells. Accordingly, studying the factors that orchestrate the genetic program of cardiac and smooth muscle cells
is important for understanding cardiac disease and to guide
the development of novel treatment modalities aiming at the
formation of new blood vessels and cardiomyocytes in
infarcted myocardium.
Myocardin is a recently discovered transactivator of the
ubiquitous transcription factor (TF) serum response factor
0008-6363/$ - see front matter D 2005 European Society of Cardiology. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.cardiores.2005.04.013
246
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
[1], which regulates the expression of many growth-related
and muscle-restricted genes by binding to CC(A/T)6GG
and closely related nucleotide sequence motifs (also known
as CArG boxes) in their promoters [2]. In situ hybridization, Northern blot, and reverse transcription-polymerase
chain reaction (RT-PCR) analyses have shown that myocardin expression is (largely) restricted to cardiac and
smooth muscle tissue both during embryogenesis and in
adults [1,3 – 6]. The repression of muscle protein-coding
genes in the heart anlage, but not in the developing somites
of Xenopus laevis embryos after microinjection in 8-cell
blastomeres of mRNA encoding a dominant negative form
of myocardin, yielded further evidence for a specific role of
myocardin in cardiac muscle development [1]. Moreover,
expression of a recombinant gene coding for a dominant
negative version of myocardin in murine teratocarcinoma
cells blocked their in vitro differentiation into cardiomyocytes [7]. Dominant negative myocardin mutants also
inhibited the activity of the smooth muscle a-actin
(ASMA), smooth muscle myosin heavy chain (smMHC),
and transgelin (SM22) promoters but did not affect
transcription of the smoothelin and aortic carboxypeptidase-like protein genes in various in vitro assay systems
[1,4,6,8,9]. Failing human and porcine myocardium contained significantly more myocardin mRNA than heart
muscle from healthy individuals [5]. Targeted degradation
of myocardin transcripts in rat aortic smooth muscle cells
by RNA interference technology inhibited expression of
recombinant luciferase genes placed under the control of
smooth muscle gene-specific promoters [4,6]. In addition,
myocardin has been shown to activate promoters of both
cardiac and smooth muscle genes in transfection assays
based on the use of reporter gene constructs [1,3,4,6 – 12].
However, transgenic mice lacking exons 8 and 9 of the
myocardin gene displayed no obvious defects in cardiac
morphogenesis but failed to form smooth muscle cells and
died at embryonic day 10.5 with severe vascular abnormalities [13]. These results suggest that the smooth muscle
developmental program critically depends on myocardin
but that its function in heart muscle formation can be taken
over by other TFs. Moreover, whereas forced expression of
myocardin in non-human cells consistently induced the
transcription of multiple smooth muscle genes, the activation of cardiomyocyte-specific genes was much less usual
[4,6 –12].
Since until now the transcription-enhancing activity of
myocardin has only been studied in animal cells, we
investigated the effect of ectopically expressed human
myocardin on the expression of muscle-specific genes in
human mesenchymal stem cells (hMSCs) isolated from
bone marrow (BM) and in human fibroblasts derived from
foreskin (hFFBs). hMSCs were chosen for this study
because: (i) hMSCs are a readily obtainable source of
autologous cells with the ability to generate bone, cartilage,
fat, ligament, stroma, tendon, and under special conditions
also muscle. (ii) hMSCs can be greatly expanded ex vivo
using ordinary cell culture systems. (iii) Differentiation of
hMSCs into cardiomyocytes has been reported both in vitro
and in vivo, which makes these cells potentially useful for
repairing heart muscle damage (see Ref. [14] and references therein). The hFFBs were included as previous in
vitro studies on myocardin were mostly performed in
fibroblasts.
RT-PCR analyses of total RNA extracted from cultures of
these two primary human cell types showed that myocardin
activates genes encoding cardiomyocyte-specific TFs, sarcomeric components, and pore-forming proteins as well as
smooth muscle cell-specific contractile proteins and thin
filament regulatory proteins but does not induce expression
of skeletal muscle-restricted genes. Immunofluorescence
microscopy (IFM) revealed that myocardin initiated
muscle-specific gene expression in 5– 15% of the hMSCs.
These particular cells stained positive for cardiac as well as
smooth muscle cell markers. Our findings underscore that
myocardin is an important activator of the smooth muscle
genetic program and show for the first time its ability to
transactivate multiple endogenous heart muscle-specific
genes in vitro. Furthermore, the acquisition of both heart
and smooth muscle characteristics by the myocardinresponsive hMSCs suggests that other factors are necessary
to fully commit these cells to either smooth or cardiac muscle
cell fates.
2. Methods
2.1. Primary human cells and human cell lines
hMSCs were purified from BM samples of adult patients
as described [14]. All human materials were obtained after
informed consent of the donors and experiments with the
human specimens were carried out according to the official
guidelines of the Leiden University Medical Center. Both
hMSCs and hFFBs (VH10 cells [15]) were cultured in
Dulbecco’s modified Eagle’s medium (DMEM) containing
10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100
Ag/ml streptomycin. The generation and propagation of
conditionally immortalized euploid myoblasts derived from
a patient with Duchenne muscular dystrophy has been
described elsewhere [16]. These cells are phenotypically
indiscernible from their nonimmortalized predecessors in
various assays and can form myotubes in vitro. All cells
were cultured at 37 -C in a humidified air—10% CO2
atmosphere except for the skeletal myoblasts, which were
kept at 5% CO2.
2.2. Characterization of hMSCs
The hMSCs were characterized by their surface antigen
profile using a FACSort flow cytometer, CellQuest software
(both from Becton Dickinson), and the antibodies specified
in Table 1. The surface antigen profile of the hMSCs (for
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
Table 1
Antibodies used for the immunophenotypic characterization of hMSCs
Antigen
Source Clone
(Iso)type Label
Species
CD1a
CD10
BD
CLB
IgG2b
IgG2a
–
PE
mouse
mouse
CD14
CLB
IgG2a
PE
mouse
CD19
CD34
CD44
CD45
BD
BD
BD
CLB
IgG1
IgG1
IgG2b
IgG1
PE
FITC
PE
PE
mouse
mouse
mouse
mouse
CD46
CD56
CD61
CD62P
BD
CLB
BD
CLB
IgG2a
IgG1
IgG1
IgG1
FITC
PE
FITC
PE
mouse
mouse
mouse
mouse
CD71
CD90
CD105
CD106
CXCR-4 (fusin)
HLA-ABC
HLA-DR
CLB
BD
DC
BD
BD
BD
CLB
IgG1
IgG1
IgG1
IgG1
IgG2a
IgG1
IgG1
PE
PE
–
PE
PE
FITC
FITC
mouse
mouse
mouse
mouse
mouse
mouse
mouse
VEGFR-2 (Flk-1)
KLH
KLH
Mouse IgG1
Mouse IgG
SC
BD
BD
BD
BD
IgG1
IgG1
IgG2a
IgG1
–
–
PE/FITC
PE
PE
FITC
mouse
mouse
mouse
rat
goat
SK9
CLB-CALLA/1,
4F9
CLB-mon/I,
8G3
4G7
8G12
G44-26 (C26)
CLB-T200/1,
15D9
E4.3
B159
RUU-PL7F12
CLB-tromb/6,
C2
RVS10
5E10
SN6h
51-10C9
12G5
G46-2.6
CLB-HLA-Dr,
1E5
A-3
X40
X39
X56
–
The immunoglobulins directed against keyhole limpet hemocyanin (KLH)
were used as isotype-matched control antibodies. BD, Becton Dickinson;
CLB, Sanquin; DC, DakoCytomation; SC, Santa Cruz; PE, phycoerythrin;
FITC, fluorescein isothiocyanate. All antibody preparations were used at
the concentrations recommended by the suppliers.
details see online supplement) matches previously published
data [14]. In contrast to the hFFBs, the hMSCs differentiated
into adipocytes and osteoblasts after proper stimulation
confirming their multipotent nature (data not shown).
2.3. RNA extraction
Total cellular RNAwas extracted from tissues and cultured
cells using TRIzol reagent (Invitrogen). Human atrial RNA
was derived from pooled right atrial appendices excised
during cardiac surgery of adult patients; human ventricular
RNA was obtained from an individual who underwent partial
left ventriculectomy. Skeletal muscle RNA was extracted
from a specimen of vastus lateralis muscle removed during
orthopedic surgery. Arteries from human umbilical cords
served as a source of vascular smooth muscle RNA.
2.4. Cloning of human myocardin cDNA
The genomic sequence for human myocardin was
identified in a tblastn search of the GenBank database
using murine myocardin (GenBank accession number:
AAK71683.2) as query. The gene for a protein with 78%
amino acid sequence identity to murine myocardin was found
247
on human chromosome 17. The gene encoding human
myocardin was cloned using RT-PCR (for more information
see online supplement). Nucleotide sequence analysis using
the primers listed in Table 2 revealed that the largest splice
variant (splice variant B [5]) of the human myocardin gene
had been cloned. The assembled nucleotide sequence has
been deposited in GenBank (http://www.ncbi.nih.gov/) under
accession number AY764180.
2.5. First-generation adenovirus vectors
Fiber-modified human adenovirus serotype 5 (hAd5)
vectors (hAd5/F50 vectors) encoding human myocardin
(hAd5/F50.CMV.myocL) or without heterologous expression cassette (hAd5/F50.empty) were generated as described
[17]. The vectors hAd5/F5.CMV.eGFP and hAd5/
F50.CMV.eGFP, expressing the enhanced green fluorescent
protein (eGFP) gene and carrying human adenovirus
serotype 5 and 50 fiber domains, respectively, have been
documented elsewhere [17]. To determine the optimal
vector (doses) for hMSCs and hFFBs, these cell types were
transduced with 0, 12.5, 25, 50, 100, or 200 infectious units
(IU) of hAd5/F5.CMV.eGFP or hAd5/F50.CMV.eGFP per
cell and seeded in 2-cm2 wells at a concentration of 104 cell/
cm2. At 72 h postinfection, the cells were subjected to flow
cytometric analyses.
2.6. Reverse transcription-polymerase chain reaction
analysis
hMSCs and hFFBs were either mock-infected or infected
with 100 IU/cell of hAd5/F50.CMV.myocL or hAd5/
F50.empty and plated at a density of 4 103 cells/cm2. At
24 h postinfection, the inoculum was replaced by fresh
medium. Total cellular RNA was extracted from the cells 7
days after transduction. To detect cardiac, skeletal, and
smooth muscle-specific mRNAs, cDNA was then synthesized and subjected to PCR (details available in online
supplement). The forward primer in each set always targeted
another exon than the reverse primer (Table 3). As internal
controls for the quantity and quality of the RNA specimens,
RT-PCR amplifications targeting transcripts of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) were performed in parallel. Total RNA samples
derived from human atrium, ventricle, smooth muscle,
Table 2
Primers used for nucleotide sequence analysis of human myocardin cDNA
ctccattggtcttccatagcactg
cgggatccggcagcctatgacatca
atccacgctgttttga
gctgcaataaacaagtt
acgccactgagcaatacc
tcataggatggaggctgt
ggtccattccaactgctcagatgaag
cagtggcgttgaagaagagttt
Primer sequences are given in the 5V– 3Vdirection.
248
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
Table 3
Primer sequences and PCR conditions used for RT-PCR analysis
Product (size in bp)
Ta
Cycles
Forward primer (5V– 3V)
Reverse primer (5V– 3V)
GAPDH (302)
Myocardin (1141, 997)
cTnI (250)
cTnT (150)
Mlc2a (381)
Mlc2v (382)
aMHC (413)
hMHC (118)
dHand (258)
eHand (342)
GATA4 (475)
Mef2C (300)
Nkx2.5 (279)
ANF (406)
Cx43 (232)
SERCA2a (186)
ASMA (965)
CNN1 (671)
SM22 (928)
smMHC (479)
fsTnI (201)
skMHC (167)
ssTnI (310)
62
63
61
61
61
60
61
55
60
60
61
60
60
63
60
60
60
60
60
60
60
60
64
25
35
35
32
35
40
35
35
35
40
35
35
40
35
35
25
30
30
30
24
38
28
35
agccacatcgctcagacacc
ggactgctctggcaacccagtgc
ccctgcaccagccccaatcaga
ggcagcggaagaggatgctgaa
aaggtgaagtgtcccagagg
ggtgctgaaggctgattacgtt
gtcattgctgaaaccgagaatg
gatcaccaacaacccctacg
ccgacgtgaaagaggagaag
ggagacgcactgagagcatt
gacgggtcactatctgtgcaac
ctgggaaaccccaacctatt
tctatccacgtgcctacagc
gaaccagaggggagagacagag
aggcgtgaggaaagtaccaa
ggtgctgaaaatctccttgc
ccagctatgtgtgaagaagagg
gagtgtgcagacggaacttcagcc
cgcgaagtgcagtccaaaatcg
cagatccgagctcgccat
cctgaagcaggtcaagaagg
gaaattacttctggcaaaatacagg
aacccaagatcactgcctcccg
gtactcagcgccagcatcg
catctgctgactccgggtcatttgc
cgaagcccagcccggccaact
gaggcaccaagttgggcatgaacga
acagagtttattgaggtgcccc
tattggaacatggcctctggat
agacatcgcactgactgagaac
gaagcccagcacatcaaaag
ggatgattccaaatgcaagg
cggctcactggtttaactcc
agacatcgcactgactgagaac
gctgcctggtggaataagaa
agatcttgacctgcgtggac
ccctcagcttgctttttaggag
acaccttccctccagcagtt
atcagtcatgcacagggttg
gtgatctccttctgcattcggt
gtctgtgcccagcttggggtc
gggctggttcttcttcaatgggc
ccgagtagatgggcaggtgt
tctgggtgcatctccctagt
gcagatgccagttttccagt
cgcttgaacttcccacggaggt
bp, Base pairs; Ta, annealing temperature. For an explanation of the abbreviations of the marker genes, see the main text of the paper.
skeletal muscle, and a human skeletal myoblast cell line
before and after myotube formation were also subjected to
RT-PCR to provide positive controls and to determine the
specificity of the marker genes. PCRs carried out with water
instead of cDNA served as negative controls.
2.7. Immunofluorescence microscopy
For immunostaining, hMSCs were transduced with hAd5/
F50.CMV.myocL or hAd5/F50.empty and plated on glass
coverslips coated with fibronectin (Sigma-Aldrich) at a
density of 3 103 cells/cm2. Seven days later, the cells were
processed for IFM as described in the data supplement. The
cells were labeled with mouse monoclonal antibodies
(MAbs) directed against sarcomeric a-actin, sarcomeric a-
actinin, sarcoplasmic reticulum Ca(2+)-ATPase 2a (SERCA2a), or atrial natriuretic peptide precursor A (ANF) and
polyclonal antisera specific for slow skeletal troponin I
(ssTnI), smMHC [18], or GATA4 and stained with AlexaFluor488-, AlexaFluor555-, or AlexaFluor568-conjugated
secondary antibodies (Table 4). Nuclei were stained with
Hoechst 33342 (Molecular Probes). Double labeling
experiments were performed in a similar manner except
that the coverslips were simultaneously incubated with the
rabbit anti-smMHC antiserum in combination with the
anti-sarcomeric a-actin, anti-sarcomeric a-actinin, antiSERCA2a, or anti-ANF MAbs. To visualize the primary
antibodies, the cells were incubated with a mixture of the
aforementioned secondary antibodies.
2.8. Cell viability assay
Table 4
Antibodies used for the detection of cardiac and smooth muscle proteins
Antigen
Vendor Clone
(Iso)type Label
Species
Sarcomeric a-actin
Sarcomeric a-actinin
SERCA2a
ANF
ssTnI
smMHC
GATA4
Rabbit IgG
Mouse IgG
Goat IgG
SA
SA
AB
CH
SC
–
SC
MP
MP
MP
IgM
IgG1
IgG2a
IgG1
–
–
–
–
–
–
Mouse
Mouse
Mouse
Mouse
Rabbit
Rabbit
Goat
Goat
Goat
Rabbit
5C5
EA-53
2 A7-A1
23/1
–
–
–
–
–
–
–
–
–
–
–
–
–
Alexa568
Alexa488
Alexa555
SA, Sigma-Aldrich; AB, Affinity BioReagents; CH, Chemicon; SC, Santa
Cruz; MP, Molecular Probes. The smMHC-specific monoclonal antibody
was a gift of R.S. Adelstein [3].
Propidium iodide and Hoechst 33342 stainings were used
to study apoptosis and necrosis, essentially as described by
Darzynkiewicz et al. [19].
3. Results
3.1. Expression of human myocardin
The currently available data indicate that there are at least
three alternatively spliced variants of human myocardin,
tentatively designated myocardin-A, myocardin-B, and
myocardin-C [5]. The two largest splice variants of
myocardin were detected in human atrial, ventricular, and
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
249
Fig. 1. RT-PCR analysis of myocardin expression. (A) Schematic representation of myocardin splice variants. Myocardin-B consists of 14 exons and
myocardin-A contains 13 exons. The position of the forward (F) and reverse (R) primers used for RT-PCR as well as the expected lengths of the PCR products
are indicated. The myocardin-A-specific PCR fragment is 144 bp smaller than the amplification product of myocardin-B due to the lack of exon 11. (B) Left
panels: RT-PCR analysis of myocardin expression in untreated (U) hMSCs and hFFBs and in hAd5/F50.empty (E)-or hAd5/F50.CMV.myocL (M)-infected
cells using total RNA extracted 7 days after vector addition. Right panels: myocardin expression in atrium (AT), smooth muscle (SM), ventricle (VE), skeletal
myoblasts (MB), skeletal myotubes (MT), and skeletal muscle (SK). PCRs carried out with water instead of cDNA served as negative control (NC).
smooth muscle tissue by RT-PCR using forward and reverse
primers targeting exons 10 and 13, respectively (Fig. 1). A
similar result was obtained using RNA extracted from human
skeletal muscle as template although the relative yield of the
myocardin-specific PCR fragments was much lower than for
the other muscle tissues (Fig. 1). The preponderance of the
largest splice variant of myocardin (i.e. myocardin-B) in
cardiac and smooth muscle tissue from human adults (Fig. 1)
fits with previous observations in the mouse [7]. It is possible
that the myocardin transcripts in the skeletal muscle specimen are derived from vascular smooth muscle cells. We
therefore also investigated the presence of myocardin mRNA
in human skeletal myoblasts [16] before and after differentiation into myotubes. No myocardin expression was
detected in these samples, corroborating earlier claims that
skeletal muscle cells do not express myocardin [1,3,6,10].
3.2. Efficient transduction of hMSCs and hFFBs by
hAd5F50 vectors
We tested the wild-type and fiber-modified hAd5
vectors hAd5/F5.CMV.eGFP and hAd5/F50.CMV.eGFP
for their ability to transduce hMSCs and hFFBs. Cells
were infected with different vector doses and analysed by
flow cytometry. hAd5/F50.CMV.eGFP transduced both
hMSCs and hFFBs far more efficiently than hAd5/
F5.CMV.eGFP (Fig. 2). A dose of 100 IU of hAd5/
F50.CMV.eGFP per cell was found optimal as it resulted in
high-level eGFP expression in virtually 100% of the cells
without noticeable toxicity.
On the basis of the aforementioned results, a hAd5/F50
vector expressing the largest splice variant of myocardin
was generated. Transduction of hMSCs or hFFBs with 100
Fig. 2. Flow cytometric analysis of hMSCs and hFFBs infected with hAd5/F5.CMV.eGFP (F5) or hAd5/F50.CMV.eGFP (F50). The percentage of eGFP-positive
cells and the mean fluorescence intensity (arbitrary units) of the cells are plotted against the vector dose. Values are given as means T standard deviation (n = 4).
250
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
IU/cell of this so-called hAd5/F50.CMV.myocL vector
resulted in high-level expression of myocardin-B as
determined by RT-PCR (Fig. 1). Interestingly, relatively
low amounts of myocardin-A and -B transcripts were also
detected in untreated hMSCs and hFFBs cells and in cells
infected with the negative control vector hAd5/F50.empty
(Fig. 1). Analysis of nuclear morphology and propidium
iodide and Hoechst 33342 uptake revealed that transduction
of hMSCs with hAd5/F50.CMV.myocL or hAd5/F50.empty
did not result in increased cell death by either apoptosis or
necrosis as compared to untreated hMSCs (Figs. 4, 5, and
data not shown).
3.3. Forced myocardin expression activates heart muscle
genes
We first investigated the ability of myocardin to induce
in hMSCs and hFFBs the transcription of genes that are
active in human cardiomyocytes (Fig. 3A). Mock- or
hAd5/F50.empty-transduced hMSCs and hFFBs did not
express detectable amounts of the genes encoding cardiac
troponin I (cTnI), cardiac troponin T (cTnT), the atrial and
ventricular forms of myosin light chain 2 (Mlc2a and
Mlc2v, respectively), cardiac a-and h-myosin heavy chain
(aMHC and hMHC, respectively), eHand, GATA4,
Nkx2.5, ANF, and SERCA2a. Transduction of hMSCs
and hFFBs with hAd5/F50.CMV.myocL, however, resulted
in the activation of all these genes with the exception of
cTnI and Nkx2.5.
Interestingly, we found that both hMSCs and hFFBs
naturally express the genes encoding dHand, Mef2C, and
connexin 43 (Cx43). Cx43 expression in hMSCs and hFFBs
has been previously reported [20,21].
3.4. Forced myocardin expression induces smooth muscle
genes
To evaluate the induction of smooth muscle gene
expression by myocardin, the RNA samples were
analyzed using primer pairs specific for the ASMA,
smooth muscle calponin (CNN1), SM22, and smMHC
genes (Fig. 3B). Each of these genes was expressed in
arterial smooth muscle from umbilical cord. Low amounts
of CNN1-, SM22-, and smMHC-specific transcripts were
also detected in the myocardial samples, most likely due
to the presence of blood vessels in these clinical specimens. No evidence for ASMA expression in heart muscle
was obtained. However, ASMA-encoding transcripts were
clearly present in the three samples representative of
skeletal muscle. The SM22 gene was expressed in
Fig. 3. RT-PCR analysis of muscle marker genes in hMSCs, hFFBs, and control tissues. Total RNA extracted from mock (-)-, hAd5/F50.empty (E)-, or hAd5/
F50.CMV.myocL (M)-transduced cells 7 days after (mock)-infection was subjected to RT-PCR using cardiac (A), smooth (B), and skeletal (C) muscle genespecific primers. The abbreviations of the marker genes are explained in the main text.
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
cultured myoblasts and myotubes. No SM22-specific
mRNA was found in vastus lateralis skeletal muscle
consistent with the reported expression of SM22 in
developing but not mature striated muscles [22]. Analysis
of the RNA extracted from the mock-treated hMSCs
revealed that expression of the relatively widely expressed
ASMA, CNN1, and SM22 genes but not of the highly
specific smooth muscle marker gene smMHC [22] is
intrinsic to these cells. Transduction of the hMSCs with
hAd5/F50.CMV.myocL led to the accumulation of
smMHC-specific transcripts in these cells. With the
251
hFFBs somewhat different results were obtained. Of the
four selected smooth muscle marker genes, these cells
naturally expressed only CNN1 and SM22. Forced
myocardin expression in the hFFBs resulted in the
synthesis of ASMA and smMHC mRNA.
3.5. Forced myocardin expression does not activate skeletal
muscle genes
Finally, we examined whether myocardin could also
transactivate skeletal muscle genes in hMSCs and hFFBs.
Fig. 4. Immunofluorescent staining of hMSCs transduced with hAd5/F50.CMV.myocL or hAd5/F50.empty. Blue, nuclei; green, sarcomeric a-actin (A),
sarcomeric a-actinin (B), SERCA2a (C), or ANF (D); red, ssTnI (E) or smMHC (F).
252
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
To this end, RT-PCR amplifications were carried out with
primers specific for the fast-twitch skeletal troponin I
(fsTnI), skeletal myosin heavy chain 2a (skMHC), and
slow-twitch skeletal troponin I (ssTnI) genes (Fig. 3C).
Whereas in humans the expression of the fsTnI and skMHC
genes is restricted to skeletal muscle, the ssTnI gene is
active not only in skeletal muscle but also in embryonic,
fetal, and neonatal myocardium [23]. Each of these genes
was expressed in the vastus lateralis skeletal muscle, the
myotubes, and the myoblasts. The RT-PCR analyses of the
myocardial RNA samples showed that the right atrium and
left ventricle contain ssTnI- but not fsTnI- or skMHCencoding transcripts. The smooth muscle specimen, on the
other hand, did not yield fsTnI-, skMHC-, or ssTnI-specific
RT-PCR fragments. Infection of hMSCs and hFFBs with
hAd5/F50.CMV.myocL induced the expression of ssTnI,
but not of the fsTnI or skMHC genes.
3.6. Myocardin activates both cardiac and smooth muscle
genes in single cells
To confirm the induction of cardiac and smooth muscle
genes at the protein level, hAd5/F50.CMV.myocL-transduced hMSCs were analyzed by IFM using antibodies
specific for sarcomeric a-actin, sarcomeric a-actinin,
SERCA2a, ANF, ssTnI, smMHC (Fig. 4), and GATA4
(see Fig. 1 of the data supplement). As mentioned above and
shown in Fig. 3B, the smMHC protein is a highly specific
marker for smooth muscle cells. The sarcomeric a-actin and
a-actinin proteins have been found in both skeletal and
cardiac but not in smooth muscle [24]. We (Fig. 3C) and
others (vide supra) have shown that the expression of the
ssTnI gene is also confined to striated muscle. In contrast,
SERCA2a molecules are found in all three muscle types
[25], while the ANF and GATA4 genes are expressed in
cardiac but not in smooth or skeletal muscle (Fig. 3). The
immunostainings revealed that approximately 10% of the
infected hMSCs stained positive for each of these proteins,
while none of the mock- (data not shown) or hAd5/
F50.empty-transduced cells exhibited specific labeling with
any of the antibodies (Fig. 4). The number of fluorescent
cells was comparable at 1, 2, and 3 weeks after infection
with Ad5/F50.CMV.myocL. The hMSCs that expressed the
aforementioned proteins did not develop well-organized
sarcomeres and did not display spontaneous beating within
the period of observation.
The results of the single antibody staining experiments
raised the question whether cardiac and smooth muscle
marker genes are expressed by the same or different cells in
the hAd5/F50.CMV.myocL-treated hMSCs cultures. To
investigate this issue, we performed double labeling experiments with MAbs directed against sarcomeric a-actin,
sarcomeric a-actinin, SERCA2a, or ANF in combination
with polyclonal antibodies recognizing smMHC (Fig. 5).
These experiments showed that the smMHC-specific antibodies labeled all hMSCs that stained positive for sarco-
meric a-actin, sarcomeric a-actinin, SERCA2a, or ANF. We
hence conclude that these cells had acquired characteristics
of both cardiac and smooth muscle cells.
4. Discussion
In this paper, we have demonstrated that forced
expression of human myocardin is sufficient to induce the
expression of a broad range of cardiac and smooth muscle
genes in human adult stem cells and primary human
fibroblasts. These findings support the concept that myocardin plays an important role in cardiomyogenesis and
vasculogenesis and are consistent with the cardiac and
smooth muscle-restricted expression of myocardin [1,3 – 7].
Furthermore, IFM studies revealed that under our experimental conditions myocardin simultaneously activates (in
single cells) both heart and smooth muscle genes. Accordingly, other factors are required to delimit the cardiac and
smooth muscle transcriptomes.
While in our experiments myocardin acted as a potent
inducer of both cardiomyocyte- and smooth musclespecific genes, two previous papers only reported on the
ability of myocardin to regulate smooth muscle gene
expression [4,6]. Furthermore, in a detailed study carried
out with murine embryonic fibroblasts (i.e. 10T1/2 cells)
ectopic myocardin expression caused the activation of
smooth muscle genes as well as the skeletal a-actin gene
but not of cardiomyocyte-specific genes [11]. In yet
another study, forced expression of myocardin in A404
cells, which are derived from mouse embryonic teratocarcinoma cells and readily differentiate into smooth muscle
cells, resulted in the accumulation of cardiac and skeletal
a-actin mRNAs besides smooth muscle gene-specific
transcripts but did not lead to GATA4 expression [9].
There are several possible explanations why we found
ample evidence for the activation of endogenous cardiac
genes by myocardin whereas others did not: (i) In the
studies of Du et al. [4] and Yoshida et al. [6] the activation
of cardiac muscle genes was not investigated. (ii) We are
the first to test the effects of human myocardin in human
cells. Species-related differences in myocardin activity may
hence account for the observed differences in target gene
specificity. (iii) In none of the previous studies the
transactivating potential of the myocardin isoform encoded
by splice variant B of myocardin [5] was investigated.
Perhaps, the additional 48 amino acid residues encoded by
this isoform make it a stronger inducer of cardiomyocytespecific genes than the myocardin-A-encoded protein.
Moreover, as far as we could deduce, in all previous
studies focusing on the ability of myocardin to switch on
endogenous genes, an amino-terminally truncated version
of the protein has been used. The amino terminus of
myocardin contains RPEL motifs. For MAL (also known
as BSAC, MLK1, and MRTF-A), a protein closely related
to myocardin, these motifs have been shown to control its
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
253
Fig. 5. Immunofluorescent double staining of hMSCs transduced with hAd5/F50.CMV.myocL or hAd5/F50.empty. Blue, nuclei; green, sarcomeric a-actin,
sarcomeric a-actinin, SERCA2a, or ANF; red, smMHC.
254
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
intracellular distribution and therefore its transcriptional
activity through their interaction with G actin [26]. It is
conceivable that the RPEL domains of myocardin are also
involved in the regulation of its function. (iv) The
developmental options of a cell are limited by the
methylation pattern and chromatin structure of its DNA
and by the identity, concentration, and activity of its
transcriptional regulators. Accordingly, the cell type in
which the myocardin gene is expressed may have a large
impact on the outcome of the experiments. Human adult
stem cells and primary human fibroblasts may have an
epigenetic make-up that allows them to enter into a
cardiomyocyte-specific gene expression pattern much
easier than some other (immortal) cell types.
In Figs. 4 and 5, we showed that after infection of
hMSCs with 100 IU of hAd5/F50.CMV.myocL per cell, a
vector dose sufficient to transduce the entire cell population
(Fig. 2), only approximately 10% expresses cardiac and
smooth muscle genes. Although the reason of this apparent
discrepancy is unclear, we have some preliminary results
showing that the phenomenon is cell type-dependent (data
not shown).
To determine the extent to which myocardin induces
the differentiation of hMSCs and hFFBs into cardiac,
skeletal, or smooth muscle cells, we analyzed the
expression of marker genes for each of these muscle
lineages. A limitation of this approach is the considerable
overlap between the gene expression profiles of cardiac,
skeletal, and smooth muscle cells. Most of the genes that
have been used as smooth muscle markers, are for
instance, also expressed in developing heart and skeletal
muscle (see Fig. 3A – C and [22]) and many myofibrillar
proteins are present in the sarcomeres of both cardiac and
skeletal muscle [24]. Another confounding factor may be
the effect of tissue culture on the cells. Fibroblasts and
mesenchymal stem cells have been reported to adopt a
myofibroblast- or smooth muscle cell-like phenotype
during in vitro culture [27 – 30]. This would explain the
presence of ASMA-specific transcripts in hMSCs and
CNN1 and SM22 mRNAs in hMSCs and hFFBs (Fig.
3B). The consequences of the adaptation of these cells to
the in vitro culture conditions for their ability to form
cardiac, skeletal, or smooth muscle cells are unknown.
Nonetheless, smMHC can be considered as a highly
specific marker for smooth muscle cells [22]. Likewise,
cTnI-, Mlc2a-, GATA4-, and ANF-specific transcripts have
not been detected in either skeletal or smooth muscle. In
addition, fsTnI and skMHC expression are truly confined
to skeletal muscle. The fact that the latter two genes are
not switched on in hAd5/F50.CMV.myocL-transduced
hMSCs and hFFBs, while expression of Mlc2a, GATA4,
ANF, and smMHC is clearly induced, leaves us with no
other conclusion than that myocardin transactivates both
cardiac and smooth muscle genes but not (genuine)
skeletal muscle genes. This conclusion is at variance
with that of Yoshida et al. [9] who interpreted the
myocardin-dependent activation of the cardiac and
skeletal a-actin genes in A404 cells as evidence for the
inappropriate induction by myocardin of cardiac and
skeletal CArG box-dependent genes in cultured smooth
muscle cells. However, since the skeletal a-actin gene is
expressed in murine and rat hearts in a developmentally
regulated fashion with a rapid decrease of the amount of
skeletal a-actin-specific transcripts in this organ after birth
[24], the activation by myocardin of an embryonic heart
muscle expression program may provide an alternative
explanation for the results of Yoshida et al. [9]. This
would also explain our finding that in hAd5/
F50.CMV.myocL-transduced hMSCs and hFFBs ssTnI
instead of cTnI gets activated (Fig. 3C). The ASMA,
CNN1, and SM22 genes have been shown to be
(transiently) expressed in the developing heart of mammals as well [22]. The activation of these genes after
infection of hFFBs with hAd5/F50.CMV.myocL could
therefore be another indication for the transactivation of
early cardiac muscle genes by myocardin. The co-labeling
of hAd5/F50.CMV.myocL-transduced hMSCs with antibodies directed against the most explicit smooth muscle
marker smMHC and with antibodies specific for sarcomeric a-actin, sarcomeric a-actinin, or ANF is, however,
hard to reconcile with myocardin’s activity being
restricted to genes expressed in embryonic cardiomyocytes. We hence favor the idea that myocardin is a
transcriptional (co)activator of both cardiac and smooth
muscle genes but does not regulate skeletal musclespecific gene expression and propose that myocardin
cooperates with other factors to establish either a heart of
smooth muscle phenotype.
As shown in Fig. 3A, we could not detect Nkx2.5specific transcripts in hAd5/F50.CMV.myocL-transduced
hMSCs or hFFBs, although the Nkx2.5 promoter is
activated by myocardin in reporter gene assays [1] and
the Nkx2.5 protein is involved in the regulation of
myocardin expression [7]. Whether Nkx2.5 plays a role
in limiting the transcription-enhancing activity of myocardin to heart muscle-specific genes remains to be
investigated.
The ability of myocardin to selectively activate
cardiomyocyte- and smooth muscle-specific genes may
allow for its therapeutic application. There is currently a
large interest in the use of hMSCs to replenish
cardiomyocytes that have been lost during an ischemic
insult and to improve myocardial vascularization in
patients suffering from coronary artery disease [14].
Previous studies have shown that the spontaneous differentiation of transplanted BM-derived stem cells into
cardiomyocytes is inefficient [14,31] and that differentiation into potentially undesirable cell types such as
fibroblasts occurs [31,32]. We envision that treatment of
hMSCs with hAd5/F50.CMV.myocL before transplantation may enhance their propensity to differentiate into
cardiac and smooth muscle cells in vivo.
J. van Tuyn et al. / Cardiovascular Research 67 (2005) 245 – 255
Acknowledgements
The authors are indebted to Binie Klein for supplying the
VH10 cells, Didier Trono for making available the conditionally immortalized dystrophin-negative human myoblasts,
and Pieter Doevendans, Robbert Klautz, and Rob Nelissen
for providing left over surgical material. We also thank
Robert Adelstein for donating the smMHC-specific rabbit
antiserum and Marie-José Goumans for supplying the
hMHC-specific primers. Finally, Crucell N.V. is gratefully
acknowledged for sharing their adenovirus vector production
system. Part of this work was financed by the Netherlands
Organisation for Health Research and Development
(ZonMw).
Appendix A. Supplementary Data
Supplementary data associated with this article can be
found, in the online version, at 10.1016/j.cardiores.
2005.04.013.
References
[1] Wang D-Z, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E,
et al. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell 2001;105:851 – 62.
[2] Miano JM. Serum response factor: toggling between disparate
programs of gene expression. J Mol Cell Cardiol 2003;35:577 – 93.
[3] Wang D-Z, Li S, Hockemeyer D, Sutherland L, Wang Z, Schratt G,
et al. Potentiation of serum response factor activity by a family of
myocardin-related transcription factors. Proc Natl Acad Sci U S A
2002;99:14855 – 60.
[4] Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, et al. Myocardin is a
critical serum response factor cofactor in the transcriptional program
regulating smooth muscle cell differentiation. Mol Cell Biol 2003;23:
2425 – 37.
[5] Torrado M, López E, Centeno A, Medrano C, Castro-Beiras A,
Mikhailov AT. Myocardin mRNA is augmented in the failing
myocardium: expression profiling in the porcine model and human
dilated cardiomyopathy. J Mol Med 2003;81:566 – 77.
[6] Yoshida T, Sinha S, Dandré F, Wamhoff BR, Hoofnagle MH, Kremer
BE, et al. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res 2003;
92:856 – 64.
[7] Ueyama T, Kasahara H, Ishiwata T, Nie Q, Izumo S. Myocardin
expression is regulated by Nkx2.5, and its function is required for
cardiomyogenesis. Mol Cell Biol 2003;23:9222 – 32.
[8] Du KL, Chen M, Li J, Lepore JJ, Mericko P, Parmacek MS.
Megakaryoblastic leukemia factor-1 transduces cytoskeletal signals
and induces smooth muscle cell differentiation from undifferentiated
embryonic stem cells. J Biol Chem 2004;279:17578 – 86.
[9] Yoshida T, Kawai-Kowase K, Owens GK. Forced expression of
myocardin is not sufficient for induction of smooth muscle differentiation in multipotential embryonic cells. Arterioscler Thromb Vasc
Biol 2004;24:1596 – 601.
[10] Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component
of a molecular switch for smooth muscle differentiation. J Mol Cell
Cardiol 2002;34:1345 – 56.
[11] Wang Z, Wang D-Z, Pipes GCT, Olson EN. Myocardin is a master
regulator of smooth muscle gene expression. Proc Natl Acad Sci U S A
2003;100:7129 – 34.
255
[12] Wang Z, Wang D-Z, Hockemeyer D, McAnally J, Nordheim A, Olson
EN. Myocardin and ternary complex factors compete for SRF to
control smooth muscle gene expression. Nature 2004;428:185 – 9.
[13] Li S, Wang D-Z, Wang Z, Richardson JA, Olson EN. The serum
response factor coactivator myocardin is required for vascular smooth
muscle development. Proc Natl Acad Sci U S A 2003;100:9366 – 70.
[14] Pittenger MF, Martin BJ. Mesenchymal stem cells and their potential
as cardiac therapeutics. Circ Res 2004;95:9 – 20.
[15] Klein B, Pastink A, Odijk H, Westerveld A, van der Eb AJ.
Transformation and immortalization of diploid xeroderma pigmentosum fibroblasts. Exp Cell Res 1990;191:256 – 62.
[16] Cudré-Mauroux C, Occhiodoro T, König S, Salmon P, Bernheim L,
Trono D. Lentivector-mediated transfer of Bmi-1 and telomerase in
muscle satellite cells yields a Duchenne myoblast cell line with longterm genotypic and phenotypic stability. Hum Gene Ther 2003;14:
1525 – 33.
[17] Knaän-Shanzer S, van der Velde I, Havenga MJE, Lemckert AA, de
Vries AAF, Valerio D. Highly efficient targeted transduction of
undifferentiated human hematopoietic cells by adenoviral vectors
displaying fiber knobs of subgroup B. Hum Gene Ther 2001;12:
1989 – 2005.
[18] Kawamoto S, Adelstein RS. Characterization of myosin heavy chains
in cultured aorta smooth muscle cells. A comparative study. J Biol
Chem 1987;262:7282 – 8.
[19] Darzynkiewicz Z, Bruno S, Del Bino G, Gorczyca W, Hotz MA,
Lassota P, et al. Features of apoptotic cells measured by flow
cytometry. Cytometry 1992;13:795 – 808.
[20] Krenacs T, Rosendaal M. Connexin43 gap junctions in normal,
regenerating, and cultured mouse bone marrow and in human
leukemias: their possible involvement in blood formation. Am J
Pathol 1998;152:993 – 1004.
[21] Guo H, Acevedo P, Parsa FD, Bertram JS. Gap-junctional protein
connexin 43 is expressed in dermis and epidermis of human skin:
differential modulation by retinoids. J Invest Dermatol 1992;99:460 – 7.
[22] Miano JM. Mammalian smooth muscle differentiation: origins,
markers and transcriptional control. Results Probl Cell Differ 2002;
38:39 – 59.
[23] Murphy AM. Contractile protein phenotypic variation during development. Cardiovasc Res 1996;31:E25 [Spec No].
[24] Schiaffino S, Reggiani C. Molecular diversity of myofibrillar proteins:
gene regulation and functional significance. Physiol Rev 1996;76:
371 – 423.
[25] Lytton J, Zarain-Herzberg A, Periasamy M, MacLennan DH.
Molecular cloning of the mammalian smooth muscle sarco(endo)plasmic reticulum Ca2+-ATPase. J Biol Chem 1989;264:7059 – 65.
[26] Miralles F, Posern G, Zaromytidou A-I, Treisman R. Actin dynamics
control SRF activity by regulation of its coactivator MAL. Cell 2003;
113:329 – 42.
[27] Silva Jr WA, Covas DT, Panepucci RA, Proto-Siqueira R, Siufi JLC,
Zanette DL, et al. The profile of gene expression of human marrow
mesenchymal stem cells. Stem Cells 2003;21:661 – 9.
[28] Masur SK, Dewal HS, Dinh TT, Erenburg I, Petridou S. Myofibroblasts differentiate from fibroblasts when plated at low density. Proc
Natl Acad Sci U S A 1996;93:4219 – 23.
[29] Cai D, Marty-Roix R, Hsu H-P, Spector M. Lapine and canine bone
marrow stromal cells contain smooth muscle actin and contract a
collagen – glycosaminoglycan matrix. Tissue Eng 2001;7:829 – 41.
[30] Kinner B, Zaleskas JM, Spector M. Regulation of smooth muscle actin
expression and contraction in adult human mesenchymal stem cells.
Exp Cell Res 2002;278:72 – 83.
[31] Wang J-S, Shum-Tim D, Chedrawy E, Chiu RC-J. The coronary
delivery of marrow stromal cells for myocardial regeneration:
pathophysiologic and therapeutic implications. J Thorac Cardiovasc
Surg 2001;122:699 – 705.
[32] Wu GD, Nolta JA, Jin Y-S, Barr ML, Yu H, Starnes VA, et al.
Migration of mesenchymal stem cells to heart allografts during chronic
rejection. Transplantation 2003;75:679 – 85.