Biochem. J. (2012) 446, 477–488 (Printed in Great Britain)
477
doi:10.1042/BJ20120634
Low temperature highlights the functional role of the cell wall integrity
pathway in the regulation of growth in Saccharomyces cerevisiae
Isaac CÓRCOLES-SÁEZ*, Lı́dia BALLESTER-TOMAS*, Maria A. DE LA TORRE-RUIZ†, Jose A. PRIETO* and
Francisca RANDEZ-GIL*1
*Department of Biotechnology, Instituto de Agroquı́mica y Tecnologı́a de los Alimentos, Consejo Superior de Investigaciones Cientı́ficas, Avda. Agustı́n Escardino, 7. 46980-Paterna,
Valencia, Spain, and †Departament de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Montserrat Roig 2, 25008-Lleida, Spain
Unlike other stresses, the physiological significance and
molecular mechanisms involved in the yeast cold response are
largely unknown. In the present study, we show that the CWI
(cell wall integrity) pathway plays an important role in the
growth of Saccharomyces cerevisiae at low temperatures. Cells
lacking the Wsc1p (wall integrity and stress response component
1) membrane sensor or the MAPKs (mitogen-activated protein
kinases) Bck1p (bypass of C kinase 1), Mkk (Mapk kinase)
1p/Mkk2p or Slt2p (suppressor of lyt2) exhibited cold sensitivity.
However, there was no evidence of either a cold-provoked
perturbation of the cell wall or a differential cold expression
program mediated by Slt2p. The results of the present study
suggest that Slt2p is activated by different inputs in response
to nutrient signals and mediates growth control through TORC1
(target of rapamycin 1 complex)–Sch9p (suppressor of cdc25)
and PKA (protein kinase A) at low temperatures. We found that
absence of TOR1 (target of rapamycin 1) causes cold sensitivity,
whereas a ras2 mutant shows increased cold growth. Lack of
Sch9p alleviates the phenotype of slt2 and bck1 mutant cells,
as well as attenuation of PKA activity by overexpression of BCY1
(bypass of cyclase mutations 1). Interestingly, swi4 mutant cells
display cold sensitivity, but the phenotype is neither mediated
by the Slt2p-regulated induction of Swi4p (switching deficient
4)-responsive promoters nor influenced by osmotic stabilization.
Hence, cold signalling through the CWI pathway has distinct
features and might mediate still unknown effectors and targets.
INTRODUCTION
increases the synthesis of glycerol and determines freeze survival
in yeast cells [8]. Nevertheless, Hog1-mediated signalling is
required only for the expression of a subset of cold-induced genes.
Typical cold marker genes such as OLE1 (oleic acid requiring 1),
TIP1 (temperature shock-inducible protein 1) and NSR1 (nuclear
localization sequence-binding protein), are fully induced at low
temperatures independently of MAPK Hog1p activity [8], thus
supporting the notion that additional cold-signal transduction
pathways are operative in S. cerevisiae.
The CWI pathway provides a means to fortify and repair
damage to the cell wall in order to withstand stressful
environments [9]. Perturbations on the cell surface and
environmental signals are generally detected by a small set
of plasma membrane-spanning sensors, the Wsc (wall integrity
and stress response component) family members Mid2p (mating
pheromone-induced death 2) and Mtl1p (mid-two like 1) [10],
which transmit signals to Rom2p (Rho1 multicopy suppressor 2),
a GEF (guanine-nucleotide-exchange factor) of the GTP-binding
protein Rho1. Rho1p then activates the Pkc1 (protein kinase C1)
protein kinase which in turn, activates an MAPK module [11];
Pkc1p phosphorylates Bck1p (bypass of C kinase 1), a Mkk
(MAPK kinase) kinase, which transmits the signal to both Mkk1p
All eukaryotic cells employ MAPKs (mitogen-activated protein
kinases) to relay extracellular signals and to activate the
appropriate cell response [1]. Specifically, in Saccharomyces
cerevisiae there are five central MAPKs, Fus3p Fus3 (cell fusion
3), Kss1p [kinase suppressor of Sst2 (supersensitive 2) mutations],
Hog (high osmolarity glycerol response) 1p, Slt2p (suppressor
of lyt2) and Smk1p (sporulation-specific MAPK), which control
mating, filamentous growth, HOG, CWI (cell wall integrity) and
sporulation pathways respectively [2,3]. From them, there is no
signal transduction pathway or transcription factor known to
respond exclusively to low temperatures. Although the existence
of such a pathway cannot be ruled out, the available data show that
known signal transduction mechanisms, operating in response to
other kinds of stimuli, may also be triggered by cold stress [4].
Traditionally, the HOG pathway has been considered to be
involved only in the genetic response to hyperosmotic stress [5].
However, it is now clear that the HOG pathway responds to various
extracellular stimuli, and that it is required to activate a wide range
of cellular responses [5–7]. In particular, cold activation of Hog1p
triggers a specific transcriptional program at low temperatures,
Key words: cAMP–protein kinase A (PKA), cold, cell wall
integrity pathway (CWI pathway), HOG (high osmolarity glycerol
response) pathway, mitogen-activated protein kinase signalling
(MAPK signalling), protein kinase C1 (PKC1), suppressor of
lyt2 (SLT2), switching deficient 4 (SWI4), target of rapamycin
complex 1 (TORC1), wall integrity and stress response component
1 (WSC1), yeast.
Abbreviations used: Bck1p; bypass of C kinase 1; Bcy1; bypass of cyclase mutations 1; CFW; calcofluor white; CWI, cell wall integrity; FKS2; FK506
sensitivity protein 2; Fus3; cell fusion 3; GEF; guanine-nucleotide-exchange factor; HA; haemagglutinin; HOG; high osmolarity glycerol response; IRA2;
inhibitory regulator of the RAS–cAMP pathway 2; Kss1p; kinase suppressor of supersensitive 2; MAPK; mitogen-activated protein kinase; Mid2; mating
pheromone-induced death 2; Mkk; MAPK kinase; MAPKKK; Mkk kinase; Mtl1p; mid-two like 1; OLE1; oleic acid requiring 1; ONPG; o -nitrophenyl β-Dgalactopyranoside; PKA; protein kinase A; Pkc1; protein kinase C1; Rom2; Rho1 multicopy suppressor 2; SBF; Swi4/6 cell cycle box-binding factor; SCH9,
suppressor of cdc25; Slt2p; suppressor of lyt2; SMK1, sporulation-specific MAPK; Swi4; switching deficient 4; Tat; tyrosine and tryptophan amino acid
transporter; TOR; target of rapamycin; TORC1; TOR complex 1; TPK1; Takashi’s protein kinase 1; Wsc; wall integrity and stress response component; wt;
wild-type; YPD; 1 % (w/v) yeast extract/2 % (w/v) peptone/2 % (w/v) glucose.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society
478
I. Córcoles-Sáez and others
and Mkk2p. These finally activate the last member of the cascade,
Slt2p/Mpk1p. Despite there being slight differences, the CWI
function of maintaining cell integrity is conserved between fungi,
and CWI pathway activation is not restricted to an individual
stimulus, but can be elicited in response to cell wall stress
compounds, oxidative stress or heat shock, among others [9].
Indeed, heat stress triggers the increased phosphorylation of the
MAPK Slt2p [12], and null mutants in many pathway components
display cell lysis defects when cultivated at high temperatures
[11]. In addition, loss of PKC1 results in osmoremedial cell lysis
at all growth temperatures, suggesting a general function of the
CWI pathway or alternate CWI pathway branches in thermal
stress. However, there is no evidence of this role at low growth
temperatures.
The variety of different stimuli that activate the CWI pathway
suggests that a common stress is generated by all of the activating
conditions. There is accumulating evidence that the plasma
membrane stretch is the underlying physical stress that leads to
activation of CWI signalling [12]. Nevertheless, Slt2p activation
might proceed through additional inputs, and mediate different
effectors and parallel MAPK pathways [9]. Recently, the Sho1
branch of the HOG pathway has been identified as being required
for the full activation of the CWI pathway in response to
zymolyase treatment [13]. There is also evidence that the HOG
and CWI pathways are not mutually exclusive [14,15], indicating
that, although pathway specificity is necessary, the HOG and CWI
MAPK pathways can also be positively co-ordinated.
The CWI pathway might also respond to and be stimulated
by other signals. Previous studies have suggested that nutrient
starvation might be on the basis of some phenotypic features
of cold-shocked cells [16,17]. Consistently with this, mutants in
various elements of the TOR (target of rapamycin) and cAMPdependent PKA (protein kinase A) signalling pathways, the
two major pathways transmitting nutrient signals to regulate
cell growth [18,19], show a cold-growth defect. Furthermore,
a recent work has indicated that the TORC1 (TOR complex 1)
activates PKA by preventing the Slt2p-mediated activation of
Bcy1p (bypass of cyclase mutations 1) [20], the PKA regulatory
subunit. In turn, PKA in yeast controls the activity of the stressinducible transcription factors Msn2p/Msn4p, among others [21].
In the present study, we have investigated the implication
of different MAPKs in the cold stress response. Our results
provide clear evidence for the first time of the implication of the
CWI pathway in the cold-adaptive response in S. cerevisiae and
identify Slt2p as an essential mediator of cell growth, probably
by modulating the TORC1–cAMP–PKA signalling network.
The significance of the present study is further highlighted by the
finding that Swi4p (switching deficient 4) is a Slt2p-independent
regulator of cold growth.
MATERIALS AND METHODS
Media and culture conditions
Yeast cells were cultured at 30 ◦ C in defined media, YPD
[1 % (w/v) yeast extract/2 % (w/v) peptone/2 % (w/v) glucose]
medium, SD medium [0.17 % yeast nitrogen base without amino
acids (Difco), 0.5 % ammonium sulphate and 2 % glucose) or
SCD [SD medium supplemented with the appropriate amino
acid drop-out mixture; Formedium]. S. cerevisiae transformants
carrying geneticin- (kanMX4), nourseothricin- (natMX4) or the
hygromycin- (hphMX4) resistant module were selected on YPD
agar plates containing 200 mg/l of G-418 (Sigma), 50 mg/l
of nourseothricin (clonNAT, WERNER Bioagents) or 300 mg/l of
hygromycin B (Formedium) respectively [22,23]. Escherichia
c The Authors Journal compilation c 2012 Biochemical Society
coli cells was grown in LB (Lurai–Bertani) medium supplemented
with ampicillin (50 mg/l).
Stress sensitivity tests
For the cold stress experiments, cells were grown to midexponential phase at 30 ◦ C, collected, transferred to fresh
medium and incubated at 12 or 15 ◦ C. In some experiments,
NaCl or CFW (calcofluor white)-containing YPD was used for
testing growth under osmotic or wall-damage stress conditions
respectively. Plate phenotype experiments were done by diluting
the cultures to D600 = 1.0 and spotting (3 μl) 10-fold serial
dilutions. Unless indicated, colony growth was inspected after
2–4 days of incubation at 30 ◦ C or after 8–10 days at 12 ◦ C.
Strains and plasmids
The S. cerevisiae strains and plasmids used in the present
study are listed in Supplementary Tables S1 and S2
(at http://www.BiochemJ.org/bj/446/bj4460477add.htm) respectively. The Trp + prototrophic derivative of the S. cerevisiae EG123
wt (wild-type) strain (trp1-1) was obtained by transforming with
the YIplac212 integrative vector [24]. The TRP1, SLT2, BCK1,
WSC1, WSC2, WSC3, MID2 and MSN4 deletion strains were
constructed by PCR-based gene replacement using the kanMX4,
natMX4 and hphMX4 disruption modules contained in plasmids
pFA6a-kanMX4 [22], pAG25 or pAG32 [23] respectively,
and synthetic oligonucleotides (Supplementary Table S3
at http://www.BiochemJ.org/bj/446/bj4460477add.htm). Gene
disruptions were confirmed by diagnostic PCR (Supplementary
Table S3). S. cerevisiae strains were transformed by the
lithium acetate method [25]. E. coli cells (DH10B strain) were
transformed by electroporation.
Microarray experiments and data analysis
Wt and slt2 mutant cells were grown in SCD medium at
25 ◦ C to a final D600 = 0.5 and transferred to 12 ◦ C conditions
for 3 h. Total RNA was extracted from 100 ml of each culture
by mechanical disruption following the instructions for the
RNeasy Midi kit manufacturer (Qiagen). RNA concentration
was measured at 260 nm and sample quality was checked
in a 2100B Bioanalyzer (Agilent Technologies). Under these
experimental conditions (wt and slt2 strain), three microarray
experiments corresponding to three biological replicates were
processed and analysed. Total RNA (250 ng) were labelled using
the 3 IVT express kit (Affymetrix) following the manufacturer’s
instructions. The biotin-labelled cRNA obtained was fragmented
and hybridized to the Affymetrix GeneChip® Yeast Genome 2.0
array for 16 h at 45 ◦ C. Hybridized microarrays were washed
and stained with a streptavidin–phycoerythrin conjugate in a
GeneChip® Fluidics Station 450. All of these procedures were
carried out as suggested by the manufacturer. The corresponding
fluorescence signal of the hybridization was acquired in a
GeneChip® 3000 7G scanner. After scanning, numerical data were
obtained and processed with the Expression Console software
(Affymetrix) and the RMA (robust means analysis) algorithm.
Signal ratios were obtained as a quotient between the means of
normalized signal data for each biological replicate. P values
were obtained with the limma algorithm on the Babelomics site
(http://babelomics.bioinfo.cipf.es/). The genes with a signal ratio
<0.75 were selected and are displayed in Supplementary Table S4
(at http://www.BiochemJ.org/bj/446/bj4460477add.htm).
MAPK Slt2p mediates a cold response
479
Western blotting
Whole-cell extracts for Hog1p and Slt2p detection, protein
separation by SDS/PAGE (8% gel) and electroblotting were
carried out as described previously [7]. Dual phosphorylated
Hog1p was detected by an antibody specific against
phosphorylated p38 MAPK (catalogue number 9215, Cell
Signaling, Technology). A rabbit polyclonal antibody raised
against a recombinant protein corresponding to the C-terminus
(residues 221–435) of S. cerevisiae Hog1p was used as
a loading control (catalogue number sc-9079, Santa Cruz
Biotechnology). Antisera were applied at dilution of 1:1000
(phosphorylated and total Hog1p). The phosphorylated form of
Slt2p was detected with an anti-[phospho-p44/42 MAPK (Erk1/2)
(Thr202 /Tyr204 )] antibody (1:1000 dilution; catalogue number
4370, Cell Signaling Technology). A rabbit polyclonal antibody
raised against HA (haemagglutinin) protein (1:2000 dilution;
catalogue number sc-805, Santa Cruz Biotechnology) was used
for the detection of HA-tagged Slt2p. The secondary antibody
used was horseradish peroxidase-conjugated goat anti-rabbit
antibody (catalogue number 7074, Cell Signaling Technology)
applied at 1:2000 or 1:5000 dilutions (HA). The blots were
performed and images captured as described previously [7].
Actin staining
Cells were stained with rhodamine–phalloidin as described
previously [26]. For quantification, we counted 1000 budded
cells in which the bud was smaller than the mother cell. We
considered that cells were depolarized when no actin cables
were microscopically detected. We repeated this experiment three
times.
β-Galactosidase assay
The β-galactosidase activity was determined at 30 ◦ C using
cell extracts and the substrate ONPG (o-nitrophenyl β-Dgalactopyranoside) as described previously [7]. The definition
of 1 unit was the amount of enzyme that is able to convert
1 nmol of ONPG per min under the assay conditions. The values
provided represent the average of three independent experiments
each conducted in triplicate.
RESULTS
Absence of the MAPK Slt2p has a great impact on cell growth
at low temperature
We investigated the effects of the absence of FUS3, KSS1, HOG1,
SLT2 or SMK1, the genes encoding for the five MAPKs known
in yeast, on growth at low temperatures. As expected, hog1
mutant cells of the BY4741 wt strain displayed a slight growth
defect in SCD medium at 12 ◦ C (Figure 1A), in agreement with
the previously reported functional role of the HOG pathway
under these conditions [8]. No significant effect at 12 ◦ C was
found by deleting FUS3, KSS1 or SMK1. However, lack of
Slt2p, the MAPK of the CWI pathway, caused a severe coldgrowth defect, which was less pronounced in rich YPD medium
(Figure 1A). This strain also exhibited a slight growth defect at
30 ◦ C, which could be associated with its inositol auxotrophy
(the Ino − phenotype), a feature previously reported in mutants
of the CWI pathway [27]. As seen, the absence of inositol
(SCD-INO, Figure 1A) intensified the growth defect of the
slt2 mutant cells at 30 ◦ C, as compared with that observed in
standard SCD medium. Conversely, the addition of excess inositol
Figure 1
Absence of the MAPK Slt2p impairs growth at low temperature
(A) The wt cells of the BY4741 strain and the corresponding hog1, kss1, fus3 , slt2 and smk1 mutants were assayed for growth at low temperatures. (B) Growth was examined in
the cells of wt EG123 and the corresponding slt2 mutant strain. In all of the cases, cultures
were grown at 30 ◦ C until the exponential phase and were adjusted to D 600 = 1.0. Then, serial
dilutions (1–10 − 3 ) of the cultures were spotted (3 μl) on to YPD, SCD, SCD lacking inositol
(SCD-INO) or on to SCD medium supplemented with 75 μM of inositol (SCD-INO + 75 μM
INO), and incubated at 30 ◦ C for 2–4 days or at 12 ◦ C for 8–10 days. A representative experiment
is shown.
(75 μM final concentration) rescued its growth at 30 ◦ C to wt
levels. However, the cold-sensitivity phenotype of slt2 cells
was evident regardless of the absence or the presence of inositol
c The Authors Journal compilation c 2012 Biochemical Society
480
Figure 2
I. Córcoles-Sáez and others
Membrane sensor Wsc1p and the MAPK module of the CWI pathway are required to provide cold-growth ability in S. cerevisiae
(A) Scheme of the CWI pathway components. (B) The wt cells of the BY4741 and the corresponding wsc1, wsc2 , wsc3 , mtl1, mid2 , rom2 , bck1, mkk1, mkk2 , slt2 and
mkk1 mkk2 mutant strains were assayed for cold growth. Cells were pregrown, diluted, plated in SCD medium and incubated as described in Figure 1. A representative experiment is shown.
(Figure 1A). Finally, the growth defect at low temperatures was
not strain-dependent since a slt2 mutant of the S. cerevisiae
EG123 wt strain showed a similar behaviour (Figure 1B),
and was observed only in a medium of low osmotic strength.
Indeed, the cold-sensitive phenotype of slt2 cells was prevented
in the presence of 0.8 M sorbitol (Supplementary Figure S1 at
http://www.BiochemJ.org/bj/446/bj4460477add.htm), a response
frequently displayed by cell wall mutants.
Adaptation to cold requires membrane sensor Wsc1p and a
functional MAPK module of the CWI pathway
Attempts were made to dissect the implication of different
elements of the yeast CWI pathway of the cold response.
Growth of mutant strains lacking elements upstream of Slt2p
(see Figure 2A for an overview of the pathway) was tested
at 30 ◦ C and 12 ◦ C (Figure 2B). We first analysed the
functional role of membrane sensors Wsc1p–3p, Mid2p and
Mtl1p, and GEF Rom2p, all of which act upstream of Pkc1p
(Figure 2A). Neither Rom2p (Figure 2B) or its homologue
Rom1p (results not shown) displayed a cold-sensitivity phenotype
and only Wsc1p appeared to play a role in yeast cell
growth at 12 ◦ C (Figure 2B). Nevertheless, we investigated
the possibility of a partial redundancy among sensors. Nine
double disruption mutants from the ten possible combinations
and one triple mutant, wsc3 wsc2 wsc1, were constructed and tested for growth at 12 ◦ C (Supplementary Figure S2 at
http://www.BiochemJ.org/bj/446/bj4460477add.htm). We were
unable to obtain a mid2 wsc1 double mutant, suggesting that
the simultaneous absence of these sensors in the BY4741 yeast
background is lethal, which is in agreement with previous reports
[28]. It was observed that the WSC1 deletion mutants showed a
cold-growth defect phenotype in all of the cases, thus confirming
the major role of this sensor at low temperatures. Nevertheless,
Wsc2p and Wsc3p played a particular function as shown by the
more severe cold-growth defect of the double and triple mutants
as compared with the single wsc1 mutant (Supplementary
Figure S2).
c The Authors Journal compilation c 2012 Biochemical Society
We then checked if a MAPK module was necessary (Figure 2B).
Growth at low temperatures was clearly diminished by the
deletion of BCK1, the MAPKKK (Mkk kinase) of the pathway.
Lack of the redundant MAPKKs Mkk1p and Mkk2p had no
apparent effect, although the double mkk1 mkk2 mutant
displayed a clear cold-growth defect (Figure 2B). As expected,
these phenotypes, as well as those found for the wsc1
mutants, were rescued either fully or partly by the use of the
osmotic stabiliser sorbitol (Supplementary Figures S1 and S2).
Hence, yeast growth at low temperatures requires the activity
of proteins that sense and respond to cell wall and membrane
damage.
Cold is unable to trigger the signalling activity of Pkc1p and its
overproduction provides no advantages for cold growth
The MAPK cascade for the CWI pathway is initiated by Pkc1p
which, in turn, is stimulated by the action of the GEFs Rho1p,
Rom1p and Rom2p [11]. However, we were unable to show
a cold-growth defect in single mutants of the tested GEFs
(Figure 2B). Nevertheless, different Rho1p effectors may be
active in response to different types of cell-wall stress, including
low temperature. Consequently, we attempted to obtain further
evidence of cold-instigated signalling through the CWI pathway.
Since loss of PKC1 is lethal, we measured the activation of
the protein kinase in cold-shocked cells. In response to several
stresses that perturb the cell wall, the actin cytoskeleton undergoes
a transient depolarization followed by repolarization [29], a
dynamic process that depends on the GTPase Rho1 and Pkc1p,
the latter controlling the actin depolarization, and Slt2p, which is
responsible for actin repolarization [30]. As shown in Figure 3(A),
the actin cytoskeleton remained insensitive to a downward shift
in temperature. Similar results were observed after 6 h at 12 ◦ C
(Figure 3A) and even at 8 ◦ C (results not shown).
We then analysed the effects on growth at 12 ◦ C of a high
copy number expression of PKC1. As Figure 3(B) shows, the
overexpression of PKC1 in wt strain cells caused no effects on
growth at either 30 ◦ C or 12 ◦ C. We then checked whether a high
MAPK Slt2p mediates a cold response
Figure 3
481
Pkc1 plays no apparent role in the cold response
(A) The SCD-grown cells of the BY4741 wt strain were transferred from 30 ◦ C to 12 ◦ C and at the indicated times, samples were removed, fixed and processed for actin staining as described in the
Materials and methods section. (B) The transformants overexpressing PKC1 or SLT2 were tested for growth at 30 ◦ C or 12 ◦ C. The cells carrying an empty plasmid (vector) were used as controls.
Cells were pregrown, diluted, plated in SCD-Ura medium and incubated as described in Figure 1. A representative experiment is shown.
expression level of PKC1 could overcome the cold phenotype of
slt2 mutant cells. Again, the overexpression of PKC1 had no
effect on yeast growth at 12 ◦ C, and was even clearly detrimental
at 30 ◦ C (Figure 3B). Thus it seems that Slt2p exerts an inhibitor
effect on Pkc1p activity, as indicated under other conditions [30],
and that an excess of protein kinase encoded by PKC1 is negative
for yeast growth.
Cell exposure at low temperature results in Slt2p phosphorylation,
which depends on the upstream elements of the CWI pathway
The above results question the signalling through the CWI
pathway in response to a downward shift in temperature. To
clarify this issue, we monitored the activation by phosphorylation
of Slt2p at 12 ◦ C. Exponentially growing cells of pSLT2-HA
transformants of the slt2 mutant were transferred from 25 ◦ C to
12 ◦ C and at different times samples were taken for Western blot
analysis. A downward shift in temperature was shown to increase
the signal of phospho-Slt2p, which peaked after 2 h of cold
exposure (Figure 4A). Later the level of phospho-Slt2p started
to decrease, although the phosphorylation of MAPK was still
evident even after 3 h at 12 ◦ C (Figure 4A). These changes were
not the result of increased abundance of Slt2p, which scarcely
varied as judged by the HA signal (Figure 4A). Furthermore,
increased phosphorylation of Slt2p at low temperatures was
absolutely dependent on the presence of a functional Bck1 protein
(Figure 4A).
Deletion of WSC1 decreased the increased phosphorylation
of Slt2p at 12 ◦ C, whereas the combined deletion of all the
WSC members abrogated the response (Figure 4A). The ratio
of the Slt2p phosphorylation signal after 120 min at 12 ◦ C to
the corresponding signal at 25 ◦ C (time 0) was approximately
5, 2 and 1 for the wt, the single wsc1 mutant and the triple
mutant respectively (Figure 4A), thus confirming the role of WSC
family sensors in the activation of the MAPK at low temperatures.
Consistently with this, the cold-growth defect of wsc1 mutants,
either the single wsc1 or the triple wsc3 wsc2 wsc1 mutant,
was alleviated by the expression of a hyperactive allele of BCK1,
BCK1-20 [31]. Quite remarkably, the effect of BCK1-20 was
specific as it was unable to suppress the phenotype of the slt2
mutant strain (Figure 4B). We also noted that lack of WSC1
increased the basal level of phospho-Slt2p in cells grown at 25 ◦ C
(time 0, Figure 4A), an effect that was abolished when mutant
cells were transformed with a plasmid containing the WSC1 gene
(results not shown). We can offer an obvious explanation for this
result, but it could indicate a role of Wsc1p in a down-regulation
mechanism of CWI signalling.
Cold growth requires the kinase activity of Slt2p
We wondered if Slt2p requires its protein kinase activity in
providing cold adaptation. To address this issue, slt2 mutant
cells were transformed with the plasmid pSLT2-km, which
contains a mutant form of Slt2p (K54R) lacking catalytic activity
[30]. As a control, the cells were transformed with plasmid
pSLT2 carrying a wt form of the MAPK-encoding gene [30].
As shown, the mutant allele failed to complement the coldgrowth defect of the slt2 mutant, whereas the allele encoding a
c The Authors Journal compilation c 2012 Biochemical Society
482
Figure 4
I. Córcoles-Sáez and others
Slt2p is activated by phosphorylation and exerts its function through a catalytic mechanism
(A) The protein extracts of the slt2 , bck1, wsc1 and wsc3 wsc2 wsc1 transformants carrying plasmid pSLT2-HA were analysed by Western blotting. The cells were pregrown in SCD-Ura
medium at 25 ◦ C until the early exponential phase (D 600 ∼ 0.5) and were then cold shocked at 12 ◦ C. At the indicated times, the cells were harvested and processed as described in the Materials
and methods section. Samples from cells grown at 25 ◦ C (time 0) and then treated with CFW were used as positive controls and cells lacking Slt2p (slt2 ) used as negative controls. The histogram
shows the relative signal level of phospho-Slt2p (signal after 120 min at 12 ◦ C divided by the signal at 25 ◦ C, time 0) for the analysed strains. (B) Growth of the wt, slt2 , wsc1 and wsc3 wsc2 wsc1 (wsc3,2,1) cells carrying an empty plasmid (pRS316) or the BCK1-20 allele (pBCK1-20) was analysed at 30 ◦ C or 12 ◦ C. (C) Growth of slt2 and bck1 cells carrying a plasmid
with a native (pSLT2) or a kinase inactive form of the MAPK Slt2p (pSLT2-km) was analysed at 30 ◦ C or 12 ◦ C. The wt, slt2 and bck1 cells transformed with an empty plasmid (YEplac112,
TRP1) were used as controls. In all cases, cells were pregrown, diluted, plated in SCD-Ura (B) or SCD-Trp (C) medium and incubated as described in Figure 1. A representative experiment is shown.
native Slt2 protein completely restored the wt phenotype at 12 ◦ C
(Figure 4C). We then analysed the overexpression of SLT2 to see
if it could alleviate the growth defect of a bck1 mutant strain
at low temperatures. However, this was not the case (Figure 4C).
Hence, our results indicate that Slt2p is activated by increased
phosphorylation and exerts its function through a catalytic
mechanism.
Cold does not induce an Slt2p-dependent transcriptional response,
but a functional MAPK is necessary to ensure the full expression of
a subset of genes
The above results confirmed the existence of cold-instigated
signalling through the MAPK module of the CWI pathway and
the need for a catalytically active Slt2 protein. We therefore
examined whether this event induces the transcription mediated
by known Slt2p-dependent transcription factors (Figure 5A
shows a schematic representation). We first checked the Rlm1pinduced expression at 12 ◦ C by using a plasmid (p2XRlm1-lacZ)
containing two Rlm1p-binding sites fused to the E. coli lacZ gene.
As shown in Figure 5(B), the short promoter with the Rlm1pbinding boxes was able to promote β-galactosidase production
c The Authors Journal compilation c 2012 Biochemical Society
in the presence of 40 μg/ml of CFW. However, the up-regulation
of the reporter was missing at low temperatures, a result that
well matches the absence of a cold-growth defect in the rlm1
mutant (Figure 5A). We also noted that Slt2p activity was required
for the basal expression of the reporter at either 25 ◦ C or 12 ◦ C
(Figure 5B). We then tested if the increased phosphorylation of
Slt2p at 12 ◦ C induced the expression of FKS2 (FK506 sensitivity
protein 2; pFKS2-lacZ, Figure 5B), which encodes one of two
alternative catalytic subunits of 1,3-β-glucan synthase. A previous
study showed that the expression of this target is regulated through
SBF [SCB (Swi4/6 cell cycle box)-binding factor] in response to
cell wall damage [32], and we had observed that the deletion of
SWI4 or SWI6 results in cold sensitivity (Figure 5A). However, we
were unable to detect the cold-provoked up-regulation of FKS2
(Figure 5B), although, once again, the absence of Slt2p decreased
the reporter’s basal expression.
We then compared the transcriptome of the wt and slt2
mutant cells at 12 ◦ C. The data obtained from the microarray
assays revealed few differences in the mRNA levels under this
condition (Supplementary Table S4). Nevertheless, 55 genes were
found to be less expressed in the mutant strain, of which, 27 %
encoded cell wall proteins (GO accession number GO:0071554,
P value = 2.44E − 10 ). Thus Slt2p is required to maintain the basal
MAPK Slt2p mediates a cold response
Figure 5
483
Epistatic effects on the cold growth of SLT2, SWI4 and SWI6, and Slt2p-mediated transcriptional activity at low temperatures
(A) Schematic representation of the output components of the CWI–MAPK module and growth at 30 ◦ C and 12 ◦ C of the wt BY4741 strain and the corresponding rlm1, swi4 and swi6 mutants. (B) The activity of two CWI pathway reporters, RLM1–lacZ and FKS2–lacZ, was assayed in wt (grey bars) and slt2 mutant cells (black bars), exposed to 12 ◦ C, 40 μg/ml CFW or 39 ◦ C.
Data represent the mean value of three independent experiments. (C) Cold sensitivity was assayed in wt cells, and the bck1, slt2 , swi4 , swi4 bck1, swi4 slt2 , swi6 , swi6 bck1
and swi6 slt2 mutant strains. In all of the cases, cells were pregrown, diluted, plated in SCD medium and incubated as described in Figure 1. A representative experiment is shown.
expression of a subset of genes at low temperatures, a function in
which Rlm1p, Swi4p or Swi6p could play a role. However, the
transcription factors do not seem to be targets of the cold-provoked
phosphorylation of Slt2p, and this activation does not appear
to trigger a cold-specific and Slt2p-dependent transcriptional
program.
bck1 and swi4 slt2 mutants at 30 ◦ C was rescued by the
presence of 75 μM inositol, whereas the phenotype at 12 ◦ C
was maintained under these conditions (Supplementary Figure
S3 at http://www.BiochemJ.org/bj/446/bj4460477add.htm). In
contrast, the phenotype of the swi6 mutants was insensitive to
the presence of larger amounts of inositol in the culture medium,
or even proved detrimental (Supplementary Figure S3).
SWI4 plays a specific role in the growth of yeast cells at low
temperatures
The effect of Slt2p at low temperatures is independent of Hog1p
The experiments shown in Figure 5(A) revealed that the lack of
Swi4p was inhibitory for the cold growth of S. cerevisiae. We
also observed that the Swi6 was required for growth; however,
this appeared to be independent of the ambient temperature. To
further clarify the functional connection of these proteins with the
MAPK module of the CWI pathway, BCK1 or SLT2 were deleted
in the swi4- or swi6-null mutant backgrounds and the resulting
double mutants were tested for growth at 30 ◦ C and 12 ◦ C. As
Figure 5(C) shows, all of the mutants displayed an evident growth
defect at 30 ◦ C and especially so at 12 ◦ C. Furthermore, the
phenotype appeared to be the sum of the phenotypes observed
for the single mutants, which suggests the absence of genetic
interactions. We also noted that the growth defect of swi4
We checked whether the growth defect of slt2 mutant cells at
12 ◦ C could be influenced by the activity of the HOG pathway.
Previous work has shown that MAPK Hog1p is phosphorylated
in cold-exposed cells [8], and there is evidence of a cross-talk
between the HOG and the CWI pathways [6,14]. Accordingly,
we first analysed the phosphorylation state of Hog1p at 12 ◦ C
in a Slt2p-deficient strain. Exposure of yeast cells to either low
temperatures [8] or NaCl [33] triggers a quick and transient
phosphorylation of the MAPK. However, absence of Slt2p
extended the time window of Hog1p increased phosphorylation
upon cold or osmotic stress (Figure 6A). This result fits
well with a model in which Slt2p inhibits the cold-instigated
phosphorylation of Hog1p. Similarly, the lack of Hog1p altered
c The Authors Journal compilation c 2012 Biochemical Society
484
Figure 6
I. Córcoles-Sáez and others
Interaction between the CWI and the HOG pathways
(A) YPD-grown slt2 mutant cells were transferred to prechilled YPD medium (12 ◦ C) or to the same medium containing 0.4 M NaCl. At the indicated times, the cells were harvested, processed
and the crude protein extracts were analysed by Western blotting. Hog1p was revealed with either an anti-phospho-p38 antibody, which cross-reacts with the dual phosphorylated form of Hog1p
(P-Hog1p), or an anti-Hog1p antibody as the loading control (Hog1p). (B) The phosphorylation of Slt2p was analysed in the slt2 and hog1 slt2 strains, which express HA-tagged Slt2p
(pSLT2-HA). The cells were pre-grown in SCD-Ura medium, refreshed in the same medium at 25 ◦ C and then either the temperature was changed to 12 ◦ C or they were moved to a plate containing
the same medium containing 40 μg/ml CFW. Protein samples were prepared and treated as above, except that the anti-(phospho-p44/42 MAPK) or the anti-HA antibodies (loading control) were
used. (C) The wt hog1, slt2 and hog1 slt2 cells of the BY4741 yeast strain were spotted on to SCD or YPD medium lacking or containing 0.4 M NaCl or 20 μg/ml CFW, and was incubated
2–3 days at 30 ◦ C or 10 days at 12 ◦ C. A representative experiment is shown. Independent experiments revealed similar results.
the phosphorylation kinetics of Slt2p in response to a lowering
of the temperature, with the CWI pathway MAPK being activated
earlier, an effect which was observed more clearly in CFWexposed cells (Figure 6B).
We then analysed the epistatic effects of HOG1 and SLT2 on
cold growth. As shown in Figure 6(C), disruption of HOG1 in a
slt2 strain had no major effect on the cold growth of the single
mutant. Likewise, the double slt2 hog1 mutant displayed
the same growth defect on NaCl as the single hog1 strain.
Conversely, absence of Hog1p in a slt2 background provided
cell protection against CFW (Figure 6C). Altogether, our results
demonstrate the existence of a cross communication between
the CWI and HOG pathways. This phenomenon appears to be
important in the adaptive response of yeast cells to CFW. However,
our data are inconsistent with a simple model in which coldactivated Slt2p mediates yeast growth at low temperatures by
modulating the activity of the HOG pathway.
pathway mutant lacking the sensor MTL1 [34]. The deletion
of MSN2, MSN4 or the knockout of both genes, had very
small or no effect on cold growth (Figure 7B). Furthermore,
the overexpression of MSN2 provided only a slight cold-growth
improvement of both the bck1 and slt2 mutant strains
(Figure 7C). Finally, we measured the activation of a STRE
(stress-response element)–lacZ reporter in both the wt and
slt2 mutant cells at 12 ◦ C. As shown in Supplementary Figure
S4 (at http://www.BiochemJ.org/bj/446/bj4460477add.htm), no
significant increase in β-galactosidase activity was detected upon
cold shock. In contrast, clear inductions were observed in glucosestarved cells (Supplementary Figure S4). Altogether, our results
suggest that the Slt2p-mediated attenuation of PKA activity
might be relevant in yeast cells’ adaptation to low temperatures.
However, Msn2p/Msn4p play a minor role, if any, in this response,
suggesting that PKA might control unknown targets of relevance
in the adaptive cold response.
The PKA pathway is a downstream effector of the cold-activated
CWI MAPK module
The TORC1 and the RAS–cAMP signalling cascade
As mentioned above, recent work has demonstrated the
existence of a molecular link between TORC1 and PKA via
the CWI pathway [20]. In particular, TORC1 inhibits Bcy1p
phosphorylation, the regulatory subunit of PKA, via Sch9p
(suppressor of cdc25) and Slt2p [20]. As shown in Figure 7(A),
the overexpression of BCY1 or TPK1 (Takashi’s protein kinase 1),
the latter encoding a PKA catalytic subunit, had no effect on the
growth of the wt BY4741 strain. The slt2 strain also remained
insensitive to high expression levels of TPK1. However, an extra
copy of BCY1 partially alleviated the growth defect of the MAPK
mutant at 12 ◦ C (Figure 7A), a result that was not observed in a
swi4 strain, thus confirming, the specific role of this protein at
low temperatures.
We then analysed the roles of the transcription factors MSN2
and MSN4. The overexpression of MSN2 has been found to
reverse the sensitivity phenotype to oxidative stress of a CWI
c The Authors Journal compilation c 2012 Biochemical Society
We further investigated the role of regulatory proteins upstream
of PKA. The deletion of either TOR1 or SCH9 did not alter the
growth of wt BY4741 at low temperatures. Nevertheless,
the absence of the latter alleviated the phenotype of slt2 and
bck1 mutant cells (Figure 8A). SCH9 deletion has been reported
to diminish the activity of PKA [35] and the PKA-dependent
phosphorylation of several targets, including MSN2 and MAF1
[36–38]. Furthermore, the lack of a functional Tor1p caused a
growth defect at 12 ◦ C in cells of the CML128 strain (Figure 8B).
Unlike BY4741, this yeast strain is auxotrophic for tryptophan
which increases its cold sensitivity. In good agreement with this,
a ras2 mutant strain showed a cold-resistant phenotype in a Trp −
background (Figure 8B), which was reversed to a wt behaviour
by integration of plasmid YIplac204 (TRP1). RAS2 encodes a
positive regulator of adenylate cyclase and, consequently, cells
lacking this gene displayed low PKA activity [19]. Moreover, cells
lacking IRA2 (inhibitory regulator of the RAS–cAMP pathway
MAPK Slt2p mediates a cold response
485
molecular link between both proteins [20]. Accordingly, Slt2p
was phosphorylated in cold-shocked cells of the sch9 mutant
strain (Figure 8C).
DISCUSSION
Figure 7
Implication of PKA effectors and targets on cold growth
(A) Cold growth was examined in the wt, slt2 and swi4 transformants carrying an extra copy
of TPK1 (pTPK1) or BCY1 (pBCY1). The cells transformed with the empty plasmid YCplac33
(YCp33) were used as controls. (B) Single msn2 , msn4 or double msn2 msn4 mutant strains were tested for growth at 30 and 12 ◦ C. (C) The effects on the cold growth
of the overexpression of MSN2 (pMSN2) were analysed in the wt, stl2 and bck1 cells.
The transformants containing the empty vector YCplac111 (YCp111) were used as controls. In
all of the cases, cells were pregrown, diluted, plated on SCD-Ura (A), SCD (B) or SCD-Leu
(C) medium and incubated as described in Figure 1. A representative experiment is shown.
2), a negative regulator of the pathway [39], exhibited a coldgrowth defect even in the BY4741 wt strain (results not shown).
Hence, the proteins that indirectly regulate the activity of the PKA
pathway influence, in turn, growth at low temperatures.
Lastly, we analysed if cold-induced Slt2p phosphorylation was
altered by the absence of Sch9p. Previous work has shown
that the MAPK is phosphorylated and activated by rapamycin
treatment upon the deletion of SCH9, suggesting an indirect
The present study has uncovered the functional role of the CWI
pathway in the response of yeast cells to cold stress. The results
show the existence of signalling through the CWI pathway in
response to a downward shift in temperature and the need for
some cell surface sensors, elements of the CWI–MAPK module
and transcription factors for cold growth. However, there is no
evidence for either a cold-provoked perturbation of the cell wall
or a differential cold-expression program mediated by MAPK
Slt2p. Hence, the cold activation of this pathway may respond to
specific mechanisms and mediate certain outputs.
CWI signalling is triggered in response to a variety of chemicals
and environmental conditions that induce cell wall damage
[9–11]. Thus Slt2p activation at 12 ◦ C suggests a cold-provoked
deficiency in cell wall integrity and/or functionality. However, we
were unable to detect a cold-stimulated up-regulation of the lacZ
reporters driven by Rlm1p- and Swi4/Swi6-responsive promoters,
the main known output of the CWI pathway [11]. Moreover, Slt2p
activity was required for basal expression at low temperatures,
but the list of down-regulated genes did not include the key genes
required for cell wall remodelling [40]. To support this view, we
found that cold shock has no effect on the sensitivity of yeast
cells to zymolyase treatment, whereas long-term cold exposure
increases resistance to this agent in either wt or slt2 mutant cells
(results not shown).
Alternatively, the cold activation of the CWI pathway might be
triggered by perturbations in the plasma membrane, as suggested
for other sources of stress [10,41]. Indeed, a downward shift in
temperature causes a significant drop in membrane fluidity [42]
and this change appears to be detected by the Sln1p cell surface
cold sensor as the primary signal for HOG pathway activation [8].
However, the cold-stimulated phosphorylation of MAPK Hog1p
peaks at around 5 min after the onset of stress, whereas Slt2p
activation peaks after 120–180 min. Thus this result suggests that
the CWI pathway does not directly sense a drop in temperature,
but a secondary effect provoked by this change, a mechanism that
has already been suggested to operate under heat-stress conditions
[43].
The most widely recognised change in cell membranes at
low temperatures is the unsaturation of lipid acyl chains [44].
Phospholipids with unsaturated fatty acids have a lower melting
point and exhibit more flexibility than phospholipids with
saturated acyl chains. In S. cerevisiae, this adaptation involves
the induction of OLE1 [45], the yeast gene for fatty acid
desaturase, which raises the unsaturation index and fluidity of
the plasma membrane [42]. A low ambient temperature may
also alter the repertoire of membrane proteins, as recently shown
for transporters like Gap1 (general amino acid permease 1), Tat
(tyrosine and tryptophan amino acid transporter) 1p or Tat2p [46].
Consistent with this, several of the 106 mutants displaying growth
defects at low temperatures [47] are affected in ribosomal proteins
and translation, pre-rRNA processing for ribosome biogenesis
or assembly, and protein folding. Interestingly, unfolded protein
stress activates CWI signalling and Slt2p is an important
determinant of ER (endoplasmic reticulum) stress survival [48].
Thus low temperatures are expected to cause a drastic change in
the microenvironment of plasma membrane sensors, which could
ultimately induce CWI signalling.
c The Authors Journal compilation c 2012 Biochemical Society
486
Figure 8
I. Córcoles-Sáez and others
Genetic and biochemical evidence of the interactions among Sch9p, Tor1p and Slt2p in regulating growth at low temperatures
(A) Growth behaviour at 12 ◦ C of the BY4741 wt, tor1, ras2 , sch9 , slt2 , sch9 slt2 , bck1 and sch9 bck1 strains. (B) Trp + and Trp − derivatives of the CML128 wt , tor1 and
ras2 mutants were assayed for growth at 30 ◦ C, 15 ◦ C and 12 ◦ C. (C) Phosphorylation of Slt2p upon cold shock was analysed in the protein extracts of pSLT2-HA transformants of the sch9 slt2 strain. Samples were prepared and proteins were visualised as described in Figure 4. In (A) and (B), the cells were pregrown, diluted, plated in SCD medium and incubated as described in
Figure 1. In all of the cases, a representative experiment is shown.
Like heat stress, Wsc1p is seen to be the most important
sensor for the response of the CWI pathway to cold. A wsc1
mutant shows reduced Slt2p phosphorylation at 12 ◦ C and a
cold-growth defect, which is exacerbated by the simultaneous
loss of WSC2 and WSC3. Thus Wsc family sensors appear to
play a key role in activating the CWI pathway in response
to changes in ambient temperature. Nevertheless, activation by
cold and heat stress appears to differ in terms of the signalling
route. As we found, cold has no major effect on the growth of
yeast cells lacking Rom1p or Rom2p, two well-known upstream
effectors of PKC, which controls the CWI–MAPK module [11].
In addition, we were unable to observe depolarization of the actin
cytoskeleton in cold-exposed cells, a change promoted by heat
stress, among other factors [11], or cold growth effects through
the overexpression of PKC1. We also found that phosphorylation
of Slt2p was absolutely dependent on Bck1p, whereas the strains
lacking MAPKKK were still able to activate Slt2p in heat-shocked
cells [49]. Hence, how the cold signal inputs the MAPK module
from the Wsc1p–3p membrane sensors to Bck1p and the exact
need of Pkc1p in cold-instigated signalling remain unclear. In
agreement with this, cold signalling could mediate the activity of
the GTPase Rho1p, which controls Pkc1p-independent functions
in response to stress. Accordingly, the lack of SAC7, a GAP for
Rho1p GTPase, results in a cold-sensitivity phenotype [50].
c The Authors Journal compilation c 2012 Biochemical Society
Unusual activation mechanisms have been proposed for the
CWI pathway signalling promoted by zymolyase and caffeine
treatment. The former requires the Sho1p branch of the HOG
pathway, Pkc1p and the CWI–MAPK module [6,13]. The
existence of shared components and a cross-talk between the HOG
and the CWI pathways is well documented [9], as is the activation
of Hog1p in response to cold [4,8]. Caffeine signalling to Slt2p
involves the inhibition of Tor1p and is mediated through Rom2p
[51]. Although, we found evidence that the HOG and CWI
pathways are mutually regulated in response to a downward
shift in temperature, the results of the present study do not
support the view of a Hog1p-dependent signal being responsible
for Slt2p activation. However, our observations suggest that, as
for caffeine exposure, the cold-instigated phenotype might be
partially dependent on the inhibition of Tor1p-regulated cellular
functions.
Previous reports have demonstrated that the inactivation of
TORC1 by rapamycin treatment [26] or nitrogen starvation [52]
triggers Slt2p activation. TORC1, together with the cAMP–PKA
pathway, is the main controller of yeast cell growth in response
to nutrients [18,19]. TORC1 inhibition activates Slt2p via an
indirect mechanism mediated by Sch9p [20], a downstream target
of TORC1 signalling [53]. Slt2p then phosphorylates and activates
Bcy1p directly, which results in reduced PKA activity [20]. We
MAPK Slt2p mediates a cold response
found that the absence of TOR1 causes cold sensitivity, whereas a
ras2 mutant shows increased cold growth. We also observed that
the knockout of IRA2, which is a negative regulator of the cAMP–
PKA pathway [39], results in cold sensitivity (results not shown).
Moreover, a lack of Sch9p alleviates the phenotype of slt2 and
bck1 mutant cells, as well as attenuation of PKA activity by
the overexpression of BCY1. The simplest interpretation of these
results is that low temperatures inhibit the activity of membraneassociated proteins, including amino acid transporters [17], and
cause nutrient starvation, which then triggers the inactivation
of TORC1–PKA. Thus Slt2p appears to play a role in the coordinated regulation of these pathways, and this event is important
in the adaptive response of yeast cells to cold.
This result led us to hypothesize the role of Msn2p/Msn4p at
low temperatures. Active PKA is thought to regulate multiple
processes, including transcription, energy metabolism and cellcycle progression, by the phosphorylation of key substrates [19].
Regulated by PKA, the transcription factors Msn2p/Msn4p, which
control the general stress response [21], play a fundamental role
in the induction of a significant subset of cold-induced genes
[54]. Moreover, yeast has been show to exhibit an Msn2p/Msn4pdependent adaptive response, which sustains viability at nearfreezing temperatures [55]. However, our results are inconsistent
with a role of Msn2p/Msn4p at low, but still permissive,
temperatures.
Cold stress causes a growth defect in those cells lacking Swi4p
or Swi6p. This is somewhat surprising since, as we discussed, the
cold activation of Slt2p does not induce the expression regulated
by SBF. Cells of the mutant swi6 strain also displayed a
growth defect at 30 ◦ C. However, the growth defect of swi4
cells was observed specifically at 12 ◦ C and was not rescued by
osmotic stabilization. Swi4p is a key transcriptional regulator
of the yeast cell cycle [9–11]. Nevertheless, its function might
provide a link among nutrient acquisition, nutrient assimilation,
energy metabolism and cell-cycle control, as proposed previously
[56]. For example, previous results have shown that the cell-cycle
transcriptional regulation of genes is not directly linked to cell
cycle functions, like PMA1 (plasma membrane ATPase 1), MET
(methionine requiring) or PHO (phosphate metabolism) regulon
genes [57]. Thus a Swi4-dependent transcriptional program might
be critical to help cope with metabolic restrictions induced at low
temperatures. How this function is regulated and the exact targets
controlled by Swi4p in response to cold still await further analysis.
Known signalling pathways appear to mediate the genetic
response to cold. Nevertheless, cold sensitivity is often
associated with defects in protein–protein interactions [47] and,
consequently, cold stress may be exploited to uncover specific
signalling circuits and novel interactions.
AUTHOR CONTRIBUTION
Isaac Córcoles-Sáez performed the main research and analysed and interpreted data; Lı́dia
Ballester-Tomas performed some of the stress sensitivity tests and analysed data; Maria de
la Torre-Ruiz performed the actin staining experiments; Jose A. Prieto constructed some
of the mutants used, wrote the paper, contributed to discussion and reviewed/edited the
paper prior to submission; and Francisca Randez-Gil designed the research, interpreted
data and wrote the paper.
ACKOWLEDGEMENTS
We thank Dr David Engelberg (Hebrew University of Jerusalem, Jerusalem, Israel), Dr
Carl Mann (Saclay CEA, Paris France), Dr François Doignon (University of Bordeaux,
Bordeaux, France), Dr Kevin Morano (University of Texas Medical School, Houston, TX,
U.S.A.), Dr Michael Hall (University of Basel, Basel, Switzerland), Dr Yu Jiang (University of
Pittsburgh School of Medicine, Pittsburgh, PA, U.S.A.), Dr David Levin (Boston University,
487
Boston, MA, U.S.A.), Dr Francisco Estruch (University of Valencia, Valencia, Spain) and
Dr Matthias Rose (Frankfurt University, Frankfurt, U.S.A.) for providing plasmids and yeast
strains.
FUNDING
This work was supported by the Comisión Interministerial de Ciencia y Tecnologı́a project
(AGL2010-17516) from the Ministry of Economy and Competitiveness of Spain (MINECO).
I.C.-S. and L.B.-T. were supported by a predoctoral fellowship within the ‘FPI’ program.
REFERENCES
1 Cargnello, M. and Roux, P. P. (2011) Activation and function of the MAPKs and their
substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 75, 50–83
2 Qi, M. and Elion, E. A. (2005) MAP kinase pathways. J. Cell Sci. 118, 3569–3572
3 Chen, R. E. and Thorner, J. (2007) Function and regulation in MAPK signaling pathways:
lessons learned from the yeast Saccharomyces cerevisiae . Biochim. Biophys. Acta 1773,
1311–1340
4 Aguilera, J., Randez-Gil, F. and Prieto, J. A. (2007) Cold response in Saccharomyces
cerevisiae : new functions for old mechanisms. FEMS Microbiol. Rev. 31, 327–341
5 Hohmann, S. (2009) Control of high osmolarity signalling in the yeast Saccharomyces
cerevisiae . FEBS Lett. 583, 4025–4029
6 Bermejo, C., Rodrı́guez, E., Garcı́a, R., Rodrı́guez-Peña, J. M., Rodrı́guez de la
Concepción, M. L., Rivas, C., Arias, P., Nombela, C., Posas, F. and Arroyo, J. (2008) The
high osmotic response and cell wall integrity pathways cooperate to regulate
transcriptional responses to zymolyase-induced cell wall stress in Saccharomyces
cerevisiae . Mol. Biol. Cell 19, 1113–1124
7 Torres-Quiroz, F., Garcı́a-Marqués, S., Coria, R., Randez-Gil, F. and Prieto, J. A. (2010)
The activity of yeast Hog1 MAPK is required during endoplasmic reticulum stress
induced by tunicamycin exposure. J. Biol. Chem. 285, 20088–20096
8 Panadero, J., Pallotti, C., Rodrı́guez-Vargas, S., Randez-Gil, F. and Prieto, J. A. (2006) A
downshift in temperature activates the high osmolarity glycerol (HOG) pathway, which
determines freeze tolerance in Saccharomyces cerevisiae . J. Biol. Chem. 281, 4638–4645
9 Fuchs, B. B. and Mylonakis, E. (2009) Our paths might cross: the role of the fungal cell
wall integrity pathway in stress response and cross talk with other stress response
pathways. Eukaryot. Cell 8, 1616–1625
10 Rodicio, R. and Heinisch, J. J. (2010) Together we are strong-cell wall integrity sensors in
yeasts. Yeast 27, 531–540
11 Levin, D. E. (2011) Regulation of cell wall biogenesis in Saccharomyces cerevisiae : the
cell wall integrity signaling pathway. Genetics 189, 1145–1175
12 Kamada, Y., Jung, U. S., Piotrowski, J. and Levin, D. E. (1995) The protein kinase
C-activated MAP kinase pathway of Saccharomyces cerevisiae mediates a novel aspect of
the heat shock response. Genes Dev. 9, 1559–1571
13 Garcı́a, R., Rodrı́guez-Peña, J. M., Bermejo, C., Nombela, C. and Arroyo, J. (2009) The
high osmotic response and cell wall integrity pathways cooperate to regulate
transcriptional responses to zymolyase-induced cell wall stress in Saccharomyces
cerevisiae . J. Biol. Chem. 284, 10901–10911
14 Garcı́a-Rodrı́guez, L. J., Valle, R., Durán, A. and Roncero, C. (2005) Cell integrity signaling
activation in response to hyperosmotic shock in yeast. FEBS Lett. 579, 6186–6190
15 Casagrande, V., Del Vescovo, V., Militti, C., Mangiapelo, E., Frontali, L., Negri, R. and
Bianchi, M. M. (2009) Cesium chloride sensing and signaling in Saccharomyces
cerevisiae : an interplay among the HOG and CWI MAPK pathways and the transcription
factor Yaf9. FEMS Yeast Res. 9, 400–410
16 Schmidt, A., Hall, M. N. and Koller, A. (1994) Two FK506 resistance-conferring genes in
Saccharomyces cerevisiae , TAT1 and TAT2, encode amino acid permeases mediating
tyrosine and tryptophan uptake. Mol. Cell. Biol. 14, 6597–6606
17 Abe, F. and Horikoshi, K. (2000) Tryptophan permease gene TAT2 confers high-pressure
growth in Saccharomyces cerevisiae . Mol. Cell. Biol. 20, 8093–8102
18 Soulard, A., Cohen, A. and Hall, M. N. (2009) TOR signaling in invertebrates. Curr. Opin.
Cell Biol. 21, 825–836
19 Santangelo, G. M. (2006) Glucose signaling in Saccharomyces cerevisiae . Microbiol.
Mol. Biol. Rev. 70, 253–282
20 Soulard, A., Cremonesi, A., Moes, S., Schütz, F., Jenö, P. and Hall, M. N. (2010) The
rapamycin-sensitive phosphoproteome reveals that TOR controls protein kinase A toward
some but not all substrates. Mol. Biol. Cell 21, 3475–3486
21 Estruch, F. (2000) Stress-controlled transcription factors, stress-induced genes and
stress tolerance in budding yeast. FEMS Microbiol. Rev. 24, 469–486
22 Wach, A., Brachat, A., Pöhlmann, R. and Philippsen, P. (1994) New heterologous modules
for classical or PCR-based gene disruptions in Saccharomyces cerevisiae . Yeast 10,
1793–1808
c The Authors Journal compilation c 2012 Biochemical Society
488
I. Córcoles-Sáez and others
23 Goldstein, A. L. and McCusker, J. H. (1999) Three new dominant drug resistance
cassettes for gene disruption in Saccharomyces cerevisiae . Yeast 15, 1541–1553
24 Gietz, R. D. and Sugino, A. (1988) New yeast–Escherichia coli shuttle vectors constructed
with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74,
527–534
25 Ito, H., Jukuda, K., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells
treated with alkali cations. J. Bacteriol. 153, 163–168
26 Torres, J., Di Como, C. J., Herrero, E. and De La Torre-Ruiz, M. A. (2002) Regulation of
the cell integrity pathway by rapamycin-sensitive TOR function in budding yeast. J. Biol.
Chem. 277, 43495–43504
27 Nuñez, L. R., Jesch, S. A., Gaspar, M. L., Almaguer, C., Villa-Garcia, M., Ruiz-Noriega,
M., Patton-Vogt, J. and Henry, S. A. (2008) Cell wall integrity MAPK pathway is essential
for lipid homeostasis. J. Biol. Chem. 283, 34204–34217
28 Green, R., Lesage, G., Sdicu, A. M., Ménard, P. and Bussey, H. (2003) A synthetic
analysis of the Saccharomyces cerevisiae stress sensor Mid2p, and identification of a
Mid2p-interacting protein, Zeo1p, that modulates the PKC1–MPK1 cell integrity pathway.
Microbiology 149, 2487–2499.
29 De la Torre-Ruiz, M. A., Mozo-Vilları́as, A., Pujol, N. and Petkova, M. I. (2010) How
budding yeast sense and transduce the oxidative stress signal and the impact in cell
growth and morphogenesis. Curr. Protein Pept. Sci. 11, 669–679
30 Guo, S., Shen, X., Yan, G., Ma, D., Bai, X., Li, S. and Jiang, Y. (2009) A MAP kinase
dependent feedback mechanism controls Rho1 GTPase and actin distribution in yeast.
PLoS ONE 4, e6089
31 Lee, K. S. and Levin, D. E. (1992) Dominant mutations in a gene encoding a putative
protein kinase (BCK1) bypass the requirement for a Saccharomyces cerevisiae protein
kinase C homolog. Mol. Cell. Biol. 12, 172–182
32 Kim, K. Y., Truman, A. W. and Levin, D. E. (2008) Yeast Mpk1 mitogen-activated protein
kinase activates transcription through Swi4/Swi6 by a noncatalytic mechanism that
requires upstream signal. Mol. Cell. Biol. 28, 2579–2589
33 Van Wuytswinkel, O., Reiser, V., Siderius, M., Kelders, M. C., Ammerer, G., Ruis, H. and
Mager, W. H. (2000) Response of Saccharomyces cerevisiae to severe osmotic stress:
evidence for a novel activation mechanism of the HOG MAP kinase pathway. Mol.
Microbiol. 37, 382–397
34 Petkova, M. I., Pujol-Carrion, N., Arroyo, J., Garcı́a-Cantalejo, J. and De la Torre-Ruiz,
M. A. (2010) Mtl1 is required to activate general stress response through Tor1 and Ras2
inhibition under conditions of glucose starvation and oxidative stress. J. Biol. Chem.
285, 19521–19531
35 Zhang, A., Shen, Y., Gao, W. and Dong, J. (2011) Role of Sch9 in regulating Ras–cAMP
signal pathway in Saccharomyces cerevisiae . FEBS Lett. 585, 3026–3032
36 Trott, A., Shaner, L. and Morano, K. A. (2005) The molecular chaperone Sse1 and the
growth control protein kinase Sch9 collaborate to regulate protein kinase A activity in
Saccharomyces cerevisiae . Genetics 170, 1009–1021
37 Huber, A., Bodenmiller, B., Uotila, A., Stahl, M., Wanka, S., Gerrits, B., Aebersold, R. and
Loewith, R. (2009) Characterization of the rapamycin-sensitive phosphoproteome reveals
that Sch9 is a central coordinator of protein synthesis. Genes Dev. 23, 1929–1943
38 Lee, J., Moir, R. D. and Willis, I. M. (2009) Regulation of RNA polymerase III transcription
involves SCH9-dependent and SCH9-independent branches of the target of rapamycin
(TOR) pathway. J. Biol. Chem. 284, 12604–12608
39 Park, J. I., Grant, C. M. and Dawes, I. W. (2005) The high-affinity cAMP
phosphodiesterase of Saccharomyces cerevisiae is the major determinant of cAMP levels
in stationary phase: involvement of different branches of the Ras–cyclic AMP pathway in
stress responses. Biochem. Biophys. Res. Commun. 327, 311–319
40 Smits, G. J., Van den Emde, H. and Klis, F. M. (2001) Differential regulation of cell wall
biogenesis during growth and development in yeast. Microbiology 147, 781–794
Received 17 April 2012/18 June 2012; accepted 29 June 2012
Published as BJ Immediate Publication 29 June 2012, doi:10.1042/BJ20120634
c The Authors Journal compilation c 2012 Biochemical Society
41 Jendretzki, A., Wittland, J., Wilk, S., Straede, A. and Heinisch, J. J. (2011) How do I
begin? Sensing extracellular stress to maintain yeast cell wall integrity. Eur. J. Cell. Biol.
90, 740–744
42 Rodrı́guez-Vargas, S., Sánchez-Garcı́a, A., Martı́nez-Rivas, J. M., Prieto, J. A. and
Randez-Gil, F. (2007) Fluidization of membrane lipids enhances the tolerance of
Saccharomyces cerevisiae to freezing and salt stress. Appl. Environ. Microbiol. 73,
110–116
43 Mensonides, F. I., Brul, S., Klis, F. M., Hellingwerf, K. J. and Teixeira de Mattos, M. J.
(2005) Activation of the protein kinase C1 pathway upon continuous heat stress in
Saccharomyces cerevisiae is triggered by an intracellular increase in osmolarity due to
trehalose accumulation. Appl. Environ. Microbiol. 71, 4531–4538
44 Szalontai, B., Nishiyama, Y., Gombos, Z. and Murata, N. (2000) Membrane dynamics as
seen by Fourier transform infrared spectroscopy in a cyanobacterium, Synechocystis PCC
6803: the effects of lipid unsaturation and the protein-to-lipid ratio. Biochim. Biophys.
Acta 1509, 409–419
45 Nakagawa, Y., Sakumoto, N., Kaneko, Y. and Harashima, S. (2002) Mga2p is a putative
sensor for low temperature and oxygen to induce OLE1 transcription in Saccharomyces
cerevisiae . Biochem. Biophys. Res. Commun. 291, 707–713
46 Hernández-López, M. J., Garcı́a-Marqués, S., Randez-Gil, F. and Prieto, J. A. (2011)
Multicopy suppression screening of Saccharomyces cerevisiae identifies the
ubiquitination machinery as a main target for improving growth at low temperatures. Appl.
Environ. Microbiol. 77, 7517–7525
47 Hampsey, M. (1997) A review of phenotypes in Saccharomyces cerevisiae . Yeast 13,
1099–1133
48 Chen, Y., Feldman, D. E., Deng, C., Brown, J. A., De Giacomo, A. F., Gaw, A. F., Shi, G.,
Le, Q. T., Brown, J. M. and Koong, A. C. (2005) Identification of mitogen-activated protein
kinase signaling pathways that confer resistance to endoplasmic reticulum stress in
Saccharomyces cerevisiae . Mol. Cancer Res. 3, 669–677
49 Harrison, J. C., Zyla, T. R., Bardes, E. S. and Lew, D. J. (2004) Stress-specific
activation mechanisms for the ‘cell integrity’ MAPK pathway. J. Biol. Chem. 279,
2616–2622
50 Schmidt, A., Schmelzle, T. and Hall, M. N. (2002) The RHO1-GAPs SAC7, BEM2 and
BAG7 control distinct RHO1 functions in Saccharomyces cerevisiae . Mol. Microbiol. 45,
1433–1441
51 Kuranda, K., Leberre, V., Sokol, S., Palamarczyk, G. and François, J. (2006) Investigating
the caffeine effects in the yeast Saccharomyces cerevisiae brings new insights into the
connection between TOR, PKC and Ras/cAMP signalling pathways. Mol. Microbiol. 61,
1147–1166
52 Krause, S. A. and Gray, J. V. (2002) The protein kinase C pathway is required for viability
in quiescence in Saccharomyces cerevisiae . Curr. Biol. 12, 588–593
53 Urban, J., Soulard, A., Huber, A., Lippman, S., Mukhopadhyay, D., Deloche, O., Wanke,
V., Anrather, D., Ammerer, G., Riezman, H. et al. (2007) Sch9 is a major target of TORC1 in
Saccharomyces cerevisiae . Mol. Cell 26, 663–674
54 Schade, B., Jansen, G., Whiteway, M., Entian, K. D. and Thomas, D. Y. (2004) Cold
adaptation in budding yeast. Mol. Biol. Cell 15, 5492–5502
55 Kandror, O., Bretschneider, N., Kreydin, E., Cavalieri, D. and Goldberg, A. L. (2004) Yeast
adapt to near-freezing temperatures by STRE/Msn2,4-dependent induction of trehalose
synthesis and certain molecular chaperones. Mol. Cell 13, 771–781
56 Wittenberg, C. and Reed, S. I. (2005) Cell cycle-dependent transcription in yeast:
promoters, transcription factors, and transcriptomes. Oncogene 24, 2746–2755
57 Spellman, P. T., Sherlock, G., Zhang, M. Q., Iyer, V. R., Anders, K., Eisen, M. B., Brown,
P. O., Botstein, D. and Futcher, B. (1998) Comprehensive identification of cell
cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization.
Mol. Biol. Cell 9, 3273–3297
Biochem. J. (2012) 446, 477–488 (Printed in Great Britain)
doi:10.1042/BJ20120634
SUPPLEMENTARY ONLINE DATA
Low temperature highlights the functional role of the cell wall integrity
pathway in the regulation of growth in Saccharomyces cerevisiae
Isaac CÓRCOLES-SÁEZ*, Lı́dia BALLESTER-TOMAS*, Maria A. DE LA TORRE-RUIZ†, Jose A. PRIETO* and
Francisca RANDEZ-GIL*1
*Department of Biotechnology, Instituto de Agroquı́mica y Tecnologı́a de los Alimentos, Consejo Superior de Investigaciones Cientı́ficas, Avda. Agustı́n Escardino, 7. 46980-Paterna,
Valencia, Spain, and †Departament de Ciències Mèdiques Bàsiques, Facultat de Medicina, Universitat de Lleida, Montserrat Roig 2, 25008-Lleida, Spain
Figure S1 The presence of sorbitol alleviates the cold-growth defect of
mutants of the CWI pathway
The growth of the S. cerevisiae BY4741 wt strain and the corresponding mutants wcs1,
wcs2 , wcs3 , mtl1, mid2 , rom2 , bck1, mkk1, mkk2 , mkk1 mkk2 , slt2 ,
rlm1, swi4 and swi6 was assayed in the presence of 0.8 M sorbitol. The cells were grown
in SCD medium at 30 ◦ C until the exponential phase and adjusted to D 600 ∼ 1.0. Then serial
dilutions (1–10 − 3 ) of the cultures were spotted (3 μl) on to SCD plates containing sorbitol,
and incubated at 30 ◦ C or 12 ◦ C for 2 and 8 days respectively. A representative experiment is
shown.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society
I. Córcoles-Sáez and others
Figure S2
WSC family sensors play a functional role in the cold response
Mutant strains of the BY4741 yeast background lacking two or three cell-surface sensors as indicated were tested for growth at 30 ◦ C and 12 ◦ C in the presence or absence of the osmotic stabilizer
sorbitol. Cells were pregrown, diluted, plated in SCD medium and incubated as described in the Figure S1. A representative experiment is shown.
c The Authors Journal compilation c 2012 Biochemical Society
MAPK Slt2p mediates a cold response
Figure S4 Low temperatures do not trigger an STRE-mediated
transcriptional activation
The activity of a STRE-lacZ reporter was assayed in SCD-Ura-grown cells of the BY4741 wt
(grey bars), slt2 (black bars) and msn2 msn4 (white bars) strains exposed to 12 ◦ C for
the indicated times or transferred to a medium with 0.2 % glucose (0.2 % G) as a carbon source.
Results are means +
− S.E.M. for three independent experiments.
Figure S3 SWI4 mutants display cold sensitivity even in the presence of
high amounts of inositol
Wt, bck1, slt2 , swi4 , swi4 bck1 and swi4 slt2 mutant cells of the BY4741 yeast
strain were pregrown, diluted, plated on SCD-INO medium or the same medium supplemented
with 75 μM of inositol and incubated as described in Figure S1. A representative experiment is
shown.
c The Authors Journal compilation c 2012 Biochemical Society
I. Córcoles-Sáez and others
Table S1
S. cerevisiae strains used in the present study
Strain
Genotype
Reference or source
EG123
DL454
BY4741
BY4741 trp1
BY4741 hog1
BY4741 kss1
BY4741 fus3 BY4741 smk1
BY4741 slt2 BY4741 slt2 trp1
BY4741 wsc1
BY4741 wsc2 BY4741 wsc3 BY4741 mtl1
BY4741 mid2 BY4741 wsc2 wsc1
BY4741 wsc3 wsc1
BY4741 wsc3 wsc2 BY4741 wsc3 wsc2 wsc1
BY4741 mtl1 wsc1
BY4741 mtl1 wsc2 BY4741 mtl1 wsc3 BY4741 mid2 wsc2 BY4741 mid2 wsc3 BY4741 mid2 mtl1
BY4741 rom2 BY4741 bck1
BY4741 bck1 trp1
BY4741 mkk1
BY4741 mkk2 BY4741 mkk1 mkk2 BY4741 rlm1
BY4741 swi4 BY4741 swi4 bck1
BY4741 swi4 slt2 BY4741 swi6 BY4741 swi6 bck1
BY4741 swi6 slt2 BY4741 hog1 slt2 BY4741 bck1 slt2 BY4741 msn2 BY4741 msn4 BY4741 msn2 msn4 BY4741 ras2 BY4741 tor1
BY4741 sch9 BY4741 sch9 bck1
BY4741 sch9 slt2 CML128
CML128 Trp +
tor1
tor1 Trp +
ras2 ras2 Trp +
MATa leu-2-3,112 ura3-5 trp1-1 his4 can1r
EG123 slt2 ::TRP1
BY4741 MATa his3 1 leu2 met15 ura3 BY4741 trp1::natMX4
BY4741 hog1::kanMX4
BY4741 kss1::kanMX4
BY4741 fus3 ::kanMX4
BY4741 smk1::kanMX4
BY4741 slt2 ::kanMX4
BY4741 slt2 ::kanMX4 trp1::natMX4
BY4741 wsc1::hphMX4
BY4741 wsc2 ::hphMX4
BY4741 wsc3 ::kanMX4
BY4741 mtl11::kanMX4
BY4741 mid2 ::kanMX4
BY4741 wsc2 ::hphMX4 wsc1::kanMX4
BY4741 wsc3 ::kanMX4 wsc1::hphMX4
BY4741 wsc3 ::kanMX4 wsc2 ::hphMX4
BY4741 wsc3 ::kanMX4 wsc2 ::hphMX4 wsc1::natMX4
BY4741 mtl11::kanMX4 wsc1::hphMX4
BY4741 mtl11::kanMX4 wsc2 ::hphMX4
BY4741 mtl11::kanMX4 wsc3 ::hphMX4
BY4741 mid2 ::kanMX4 wsc2 ::hphMX4
BY4741 mid2 ::kanMX4 wsc3 ::hphMX4
BY4741 mid2 ::kanMX4 mtl1::hphMX4
BY4741 rom2 ::kanMX4
BY4741 bck1::kanMX4
BY4741 bck1::kanMX4 trp1::natMX4
BY4741 mkk1::kanMX4
BY4741 mkk2 ::kanMX4
BY4741 mkk1::kanMX4 mkk2 ::hphMX4
BY4741 rlm1::kanMX4
BY4741 swi4 ::kanMX4
BY4741 swi4 ::kanMX4 bck1::hphMX4
BY4741 swi4 ::kanMX4 slt2 ::hphMX4
BY4741swi6 ::kanMX4
BY4741swi6 ::kanMX4 bck1::hphMX4
BY4741swi6 ::kanMX4 slt2 ::hphMX4
BY4741 hog1::kanMX4 slt2 ::natMX4
BY4741 bck ::kanMX4 slt2 ::natMX4
BY4741 msn2 ::kanMX4
BY4741 msn4 ::kanMX4
BY4741 msn2 ::kanMX4 msn4 ::hphMX4
BY4741 ras2 ::kanMX4
BY4741 tor1::kanMX4
BY4741 sch9 ::kanMX4
BY4741 sch9 ::kanMX4 bck1::hphMX4
BY4741 sch9 ::kanMX4 slt2 ::hphMX4
MATα leu-2-3,112 ura3-52 trp1 his4 can1r
CML128 TRP1
(MML448) CML128 tor1::kanMX4
(MML448) CML128 tor1::kanMX4 TRP1
CML128 ras2 ::LUE2
CML128 ras2 ::LEU2 TRP1
[1]
[1]
EUROSCARF
The present study
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
EUROSCARF
The present study
The present study
The present study
EUROSCARF
EUROSCARF
EUROSCARF
The present study
The present study
The present study
The present study
The present study
The present study
The present study
The present study
The present study
The present study
EUROSCARF
EUROSCARF
The present study
EUROSCARF
EUROSCARF
The present study
EUROSCARF
EUROSCARF
The present study
The present study
EUROSCARF
The present study
The present study
The present study
The present study
EUROSCARF
EUROSCARF
The present study
EUROSCARF
EUROSCARF
EUROSCARF
The present study
The present study
[2]
The present study
[3]
The present study
[4]
The present study
c The Authors Journal compilation c 2012 Biochemical Society
MAPK Slt2p mediates a cold response
Table S2
Plasmids used in the present study
GFP, green fluorescent protein; ORF, open reading frame.
Plasmid
Description
Source or reference
p2XRlm1-lacZ
pFKS2-lacZ
pSTRE-lacZ
pBCY1
pWSC1
pTPK1
pSLT2
pSLT2-km
pSLT2-HA
pPKC1
pMSN2-GFP
Reporter plasmid (p1434) bearing a duplicated Rlm1-binding site from YIL117C (2XRlm1) fused to the CYC1 minimal promoter
Reporter plasmid (p2052) consisting of FKS2 residues − 540 to − 375 fused to the CYC1 minimal promoter
Reporter plasmid containing the stress-responsive element STRE from CTT1 promoter
BCY1 ORF cloned into shuttle vector p416GPD (URA3 , CEN )
WSC1 ORF cloned into the plasmid YEp352 (URA3 )
YCplac33-based plasmid (33pAGT) bearing GFP –TPK1 fusion under the control of a truncated ADH1 promoter
Plasmid (HA3 -MPK1-pRS424) containing 3× HA fused to the SLT2 ORF
Plasmid (HA3 -mpk1K54R -pRS424) containing 3× HA fused to the slt2 K54R kinase mutant gene
pFL44-based (2 μ, URA3 ) plasmid (pFL44-SLT2HA) containing a single HA sequence inserted in frame within the SLT2 gene
pSH24, PKC1 in pSEY18 (2 μ, URA3 )
Vector pEGFP-N3 (Clonetech) bearing the fusion MSN2 –GFP under the control of a fragment of the ADH1 promoter
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[11]
[12]
[13]
[14]
Table S3
Oligonucleotides used in the present study
Name
Sequence (5 →3 )
Use
BCK1-K1
BCK1-K2
BCK1-V1
BCK1-V2
SLT2-K1
SLT2-K2
SLT2-V1
SLT2-V2
MSN4-K1
MSN4-K2
MSN4-V1
MSN4-V2
TRP1-K1
TRP1-K2
TRP1-V1
WSC1-K1
WSC1-K2
WSC1-V1
WSC2-K1
WSC2-K2
WSC2-V1
WSC3-K1
WSC3-K2
WSC3-V1
MTL1-K1
MTL1-K2
MTL1-V1
MKK2-K1
MKK2-K2
MKK2-V1
CCCCGAGTTATTACTATGACAGAGTTTCCAATACTAATCCC GTACGCTGCAGGTCGAC
ACATTTCCAGAACGATGCATCCCAGAGACCATATATCAACCA TCGATGAATTCGAGCTC
GCTGCAATTCCAGATGATAC
ACTTCGCGAGTCTGGTAG
ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCC GTACGCTGCAGGTCG
TTCGTCAGCTGGATCATGCCATATAGACAAGTAAGGATGCA TCGATGAATTCGAGCTCG
AGACTGCGAAATGTTGGC
ATCATACTCTCTTGAGGTCG
TCTGCTACTTCTTCTAATGACAATTCTGCGAACAATAGCCGTAC GCTGCAGGTCGAC
CAAGTGCTCACTGCGTCTGAATGCCTTCTCACAGTCTTTACCA TCGATGAATTCGAGCTC
CTAGTCTTCGGACCTAATAG
CTTGTCATACCGTAGCTTG
ATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGCGTAC GCTGCAGGTCGAC
ATTGTTTTATCGTTTAAAGCAGTTTTTACGATTCTTTATCA TCGATGAATTCGAGCTCG
CAATCTCTCAACACTGAG
AGACCGAACAAAACAAGTCTGCTTCTGGCGTTATTATCCCGTAC GCTGCAGGTCGAC
AATGTTCCGTTACTTATTCTCCTTGAGTCGTCGAAAGGA TCGATGAATTCGAGCTCG
TGGAAATAACGCTGCATGG
CACCTAGATCTCATACACAAGTCCTTCATCTTAGTGTGCGTAC GCTGCAGGTCGAC
TGCATCATCGTAATCATCATCACCATCTGAGACATTACA TCGATGAATTCGAGCTCG
ACTATAGCTCAAAGCGTGG
TTTGCTATGTCAATCTCTGATTGGGCTGGTTAATGCTGCGTAC GCTGCAGGTCGAC
CAGGCTCGATTATGAGATACGGTACTAGATAATTCAGGA TCGATGAATTCGAGCTCG
AGCCGATTCGTTAGTAGG
GAACGATTCTCATGGCGTTAACAACACTACCGCTAAGTGCGTAC GCTGCAGGTCGAC
GCTTCGCTGTCATCATAAACACGATGAATGTTTTCATCGA TCGATGAATTCGAGCTCG
CGAAGGATACTGCTATTTAC
GTGAACGAAAGCCCATACTCCAACAATAGCACTTCAGCTAC GTACGCTGCAGGTCGAC
CTGCTGAAGTCGTACGCAGAAAGAAGTGTCGAGGGGTATGA TCGATGAATTCGAGCTCG
ACCAGAATCCAATAGGAGTC
Deletion BCK1
Deletion BCK1
Verification deletion BCK1
Verification deletion BCK1
Deletion SLT2
Deletion SLT2
Verification deletion SLT2
Verification deletion SLT2
Deletion MSN4
Deletion MSN4
Verification deletion MSN4
Verification deletion MSN4
Deletion TRP1
Deletion TRP1
Verification deletion TRP1
Deletion WSC1
Deletion WSC1
Verification deletion WSC1
Deletion WSC2
Deletion WSC2
Verification deletion WSC2
Deletion WSC3
Deletion WSC3
Verification deletion WSC3
Deletion MTL1
Deletion MTL1
Verification deletion MTL1
Deletion MKK2
Deletion MKK2
Verification deletion MKK2
c The Authors Journal compilation c 2012 Biochemical Society
I. Córcoles-Sáez and others
Table S4
Genes down-regulated at low temperature in the slt2 strain
eIF2α, eukaryotic translation initiation factor 2α; Gcn, general control nonderepressible; GPI, glycosylphosphatidylinositol; SNARE, soluble N -ethylmaleimide-sensitive fusion protein-attachment
protein receptor; Ypk1p, yeast protein kinase 1.
Open reading frame
Gene
Signal ratio slt2 :wt
Description
YIL176C
YER130C
YDR420W
YDL156W
YLR063W
YGR142W
YCR059C
YLR332W
YOL159C
YEL058W
YKL071W
YLR205C
YPR124W
YPL089C
YOL159C-A
YAL053W
YNL246W
YBL101W-A
YIL122W
YDR261C
YJL043W
YMR104C
YJL159W
YAR010C
YMR095C
YJL108C
YLR461W
YBR071W
YPL088W
YJL106W
YAL068C
YOR382W
YOR134W
YNL058C
YOR208W
YBR093C
YGR023W
YOR383C
YGR189C
YFL067W
YGL255W
YMR182C
YPR194C
YOL154W
YLR121C
YIL169C
YKL096W
YDR085C
YDR055W
YHR209W
YLR194C
YKL161C
YKL163W
YIL117C
YKR091W
YHR030C
PAU14
–
HKR1
–
–
BTN2
YIH1
MID2
–
PCM1
–
HMX1
CTR1
RLM1
–
FLC2
VPS75
–
POG1
EXG2
–
YPK2
HSP150
–
SNO1
PRM10
PAU4
–
–
IME2
PAU8
FIT2
BAG7
–
PTP2
PHO5
MTL1
FIT3
CRH1
–
ZRT1
RGM1
OPT2
ZPS1
YPS3
HPF1
CWP1
AFR1
PST1
CRG1
–
KDX1
PIR3
PRM5
SRL3
SLT2
0.75
0.75
0.75
0.75
0.74
0.74
0.74
0.74
0.74
0.74
0.73
0.73
0.72
0.72
0.71
0.71
0.71
0.71
0.71
0.71
0.70
0.70
0.70
0.70
0.69
0.69
0.69
0.68
0.68
0.67
0.67
0.67
0.67
0.67
0.66
0.66
0.65
0.65
0.65
0.64
0.63
0.62
0.62
0.62
0.60
0.59
0.59
0.54
0.53
0.44
0.43
0.41
0.24
0.23
0.21
0.01
Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau1p
Unknown function
Mucin family member that functions as an osmosensor in the Sho1p-mediated HOG pathway with Msb2p
Unknown function
Unknown function
v-SNARE binding protein that facilitates specific protein retrieval from a late endosome to the Golgi
Protein that inhibits activation of Gcn2p, an eIF2α subunit protein kinase, by competing for Gcn1p binding
O-glycosylated plasma membrane protein that acts as a sensor for cell wall integrity signalling and activates the pathway
Unknown function
Essential N -acetylglucosamine-phosphate mutase
Unknown function
ER localized haem oxygenase
High-affinity copper transporter of the plasma membrane
MADS box transcription factor, component of the protein kinase C-mediated MAPK pathway
Unknown function
Putative FAD transporter; required for uptake of FAD into endoplasmic reticulum; involved in cell wall maintenance
NAP family histone chaperone
Unknown function
Putative transcriptional activator that promotes recovery from pheromone induced arrest; SBF regulated
Exo-1,3-β-glucanase, involved in cell wall β-glucan assembly
Unknown function
Protein kinase with similarity to serine/threonine protein kinase Ypk1p
O-mannosylated heat shock protein that is secreted and covalently attached to the cell wall via β-1,3-glucan and disulfide bridges
Unknown function
Protein of unconfirmed function, involved in pyridoxine metabolism
Pheromone-regulated protein
Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions
Unknown function
Unknown function
Serine/threonine protein kinase involved in activation of meiosis
Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions
Mannoprotein that is incorporated into the cell wall via a GPI anchor
Rho GTPase-activating protein (RhoGAP), stimulates the intrinsic GTPase activity of Rho1p
Unknown function
Phosphotyrosine-specific protein phosphatase involved in the inactivation of MAPK
Repressible acid phosphatase (1 of 3)
Putative plasma membrane sensor
Mannoprotein that is incorporated into the cell wall via a GPI anchor
Chitin transglycosylase that functions in the transfer of chitin to β(1-6) and β(1-3) glucans in the cell wall
Unknown function
High-affinity zinc transporter of the plasma membrane
Putative transcriptional repressor with proline-rich zinc fingers
Oligopeptide transporter; member of the OPT family
Putative GPI-anchored protein; transcription is induced under low-zinc conditions
Aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance
Haze-protective mannoprotein
Cell wall mannoprotein that localizes specifically to birth scars of daughter cells
Protein required for pheromone-induced projection (shmoo) formation
Cell wall protein that contains a putative GPI-attachment site
Putative S -adenosylmethionine-dependent methyltransferase
Unknown function
Protein kinase implicated in the Slt2p MAPK signalling pathway
O-glycosylated covalently bound cell wall
Pheromone-regulated protein
Cytoplasmic protein that, when overexpressed, suppresses the lethality of a rad53 null mutation
Serine/threonine MAP kinase involved in regulating the maintenance of cell wall integrity and progression through the cell cycle
c The Authors Journal compilation c 2012 Biochemical Society
MAPK Slt2p mediates a cold response
REFERENCES
1 Lee, K. S., Irie, K., Gotoh, Y., Watanabe, Y., Araki, H., Nishida, E., Matsumoto, K. and
Levin, D. E. (1993) A pair of functionally redundant yeast genes (PPZ1 and PPZ2)
encoding type 1-related protein phosphatases function within the PKC1-mediated
pathway. Mol. Cell. Biol. 13, 3067–3075
2 Gallego, C., Garı́, E., Colomina, N., Herrero, E. and Aldea, M. (1997) The Cln3 cyclin is
down-regulated by translational repression and degradation during the G1 arrest caused
by nitrogen deprivation in budding yeast. EMBO J. 16, 7196–7206
3 Torres, J., Di Como, C. J., Herrero, E. and De La Torre-Ruiz, M. A. (2002) Regulation of
the cell integrity pathway by rapamycin-sensitive TOR function in budding yeast. J. Biol.
Chem. 277, 43495–43504
4 Petkova, M. I., Pujol-Carrion, N., Arroyo, J., Garcı́a-Cantalejo, J. and De la Torre-Ruiz,
M. A. (2010) Mtl1 is required to activate general stress response through Tor1 and Ras2
inhibition under conditions of glucose starvation and oxidative stress. J. Biol. Chem.
285, 19521–19531
5 Jung, U. S., Sobering, A. K., Romeo, M. J. and Levin, D. E. (2002) Regulation of the yeast
Rlm1 transcription factor by the Mpk1 cell wall integrity MAP kinase. Mol. Microbiol. 46,
781–789
6 Kim, K. Y., Truman, A. W. and Levin, D. E. (2008) Yeast Mpk1 mitogen-activated protein
kinase activates transcription through Swi4/Swi6 by a noncatalytic mechanism that
requires upstream signal. Mol. Cell. Biol. 28, 2579–2589
7 Stanhill, A., Schick, N. and Engelberg, D. (1999) The yeast ras/cyclic AMP pathway
induces invasive growth by suppressing the cellular stress response. Mol. Cell. Biol. 19,
7529–7538
8 Trott, A., Shaner, L. and Morano, K. A. (2005) The molecular chaperone Sse1 and the
growth control protein kinase Sch9 collaborate to regulate protein kinase A activity in
Saccharomyces cerevisiae . Genetics 170, 1009–1021
9 Fernandes, H., Roumanie, O., Claret, S., Gatti, X., Thoraval, D., Doignon, F. and
Crouzet, M. (2006) The Rho3 and Rho4 small GTPases interact functionally with
Wsc1p, a cell surface sensor of the protein kinase C cell-integrity pathway in
Saccharomyces cerevisiae . Microbiology 152, 695–708
10 Griffioen, G., Anghileri, P., Imre, E., Baroni, M. D. and Ruis, H. (2000) Nutritional control
of nucleocytoplasmic localization of cAMP-dependent protein kinase catalytic and
regulatory subunits in Saccharomyces cerevisiae . J. Biol. Chem. 275,
1449–1156
11 Guo, S., Shen, X., Yan, G., Ma, D., Bai, X., Li, S. and Jiang, Y. (2009) A MAP kinase
dependent feedback mechanism controls Rho1 GTPase and actin distribution in yeast.
PLoS ONE 4, e6089
12 Zarzov, P., Mazzoni, C. and Mann, C. (1996) The SLT2(MPK1) MAP kinase
is activated during periods of polarized cell growth in yeast. EMBO J. 15,
83–91
13 Helliwell, S. B., Howald, I., Barbet, N. and Hall, M. N. (1998) TOR2 is part of two related
signaling pathways coordinating cell growth in Saccharomyces cerevisiae . Genetics 148,
99–112
14 Görner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton,
B., Ruis, H. and Schüller, C. (1998) Nuclear localization of the C2 H2 zinc finger protein
Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12,
586–597
Received 17 April 2012/18 June 2012; accepted 29 June 2012
Published as BJ Immediate Publication 29 June 2012, doi:10.1042/BJ20120634
c The Authors Journal compilation c 2012 Biochemical Society