[CANCER
RESEARCH
45, 6113-6118,
December 1985]
Possible Role for Thymine Glycol in the Selective Inhibition of DMA Synthesis
on Oxidized DMA Templates1 *'**
Patricia Rouet2 and John M. Essigmann3
Laboratory of Toxicology, Department of Applied Biological Sciences, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
ABSTRACT
Single-stranded DMA of coliphage M13mp8 was treated with
the oxidizing agent, KMn04, under conditions that selectively
form c/'s-5,6-dihydro-5,6-dihydroxythymine
(thymine glycol).
Treatment of DMA with 0.7 and 1.4 HIM KMnO< introduced
approximately 200 and 400 thymine glycol residues, respectively,
per genome. When these DMAs were used to transform Escherichia coli, it was observed that phage survival was reduced in
a dose-dependent manner. In studies designed to investigate
the effect of DNA oxidation products on replication in vitro, a
complementary 15-mer oligodeoxynucleotide was annealed to
the oxidized template and extended with the Klenow fragment
of DNA polymerase I from E. coli. It was observed that lesions
in oxidized DNA strongly inhibited DNA elongation and that DNA
synthesis was stopped opposite thymine residues. This is taken
as suggestive evidence that the thymine glycol is inhibitory to
DNA replication.
INTRODUCTION
Chemicals and radiation damage cellular macromolecules, and
increasing evidence has implicated these reactions, especially
those involving modification of DNA, in the mutagenic and car
cinogenic processes (1-3). Ionizing and UV radiations induce the
formation of a wide variety of DNA lesions, including strand
breaks, modified base residues, and abasic sites (4). One of the
major forms of DNA damage caused by radiation is the modifi
cation of thymine bases to form ring-saturated derivatives.
Among these derivatives is the modified base, 5,6-dihydro-5,6dihydroxythymine (thymine glycol), which is the most readily
formed base modification when aqueous solutions of DNA are
treated with ionizing radiation (5). The presumed mechanism of
formation of this and several other radiation-induced lesions
involves reaction of the isolated double bond of thymine with
hydroxyl radicals or reactive oxygen species. Generally it is
thought that such reactive species can arise through irradiation
of water molecules (6) or, to a lesser extent, through chemical
interaction of reactive species generated during metabolism (7,
8).
Thymine glycol and related ring-saturated pyrimidines have
been detected in the DNAs of cells treated with ionizing radiation
(9,10). Numerous studies have shown that, in response to this
type of damage, both prokaryotic and eukaryotic cells have
evolved DNA repair systems that can remove these lesions by a
variety of different routes (11-17). In recent work, Cathcart ef
Received 1/14/85; revised 7/17/85; accepted 8/28/85.
1This work was supported by Grant CA33821 from the NIH and by a fellowship
to P. R. from Ministère de la Recherche et de l'Industrie, Paris, France.
2 Present address: Laboratoire de Biophysique, Institute de Biologie Moléculaire
et Cellulaire, G. N. R. S., 15 rue Descartes, 67084 Strasbourg Cedex, France.
3To whom requests for reprints should be addressed.
CANCER
RESEARCH
al. (18) have shown that thymine glycol and thymidine glycol are
excreted in the urine of humans and rats. They propose that
normal cellular metabolism generates the reactive oxygen spe
cies that form this modified base and suggest that it is removed
from the genome by enzymatic repair. Excretion of detectable
levels of this base in urine provides a means to indirectly assess
the background level of thymine glycol damage from endogeneous sources and, in principle, can also be used to indicate in
vivo dosimetry of radiation damage from environmental sources.
In view of the fact that the genomes of animals and humans
contain significant quantities of thymine glycol and possibly other,
related DNA oxidation products, we have begun an examination
of the genotoxic effects of these lesions. In this work DNA was
treated in vitro with an oxidizing agent, KMnO4, which produces
thymine glycol as the almost exclusive DNA lesion (19). Our
results indicate that the modifications induced in DNA only mod
estly reduced the survival of a single-stranded bacteriophage. In
contrast, it was observed that oxidation created DNA lesions
highly inhibitory to the activity of the Klenow subunit of DNA
polymerase I in an in vitro DNA replication system. Oligonucleotide chain elongation was inhibited opposite potential sites of
modified thymines in the template strand. These results suggest
a possible role for thymine glycol as the DNA lesion responsible
for these effects and, in a broader sense, pose a question as to
the possible role that such lesions may play in the induction of
mutation and cancer.
MATERIALS AND METHODS
Chemicals. [/nef/)y/-3H]Thymidine (6.7 Ci/mmol) and [«-"PJdATP(600
Ci/mmol) were purchased from New England Nuclear, Boston, MA.
Biogel P-6DG and Affigel 601 were obtained from Bio-Rad Laboratories.
The M13 DNA sequencing kit was obtained from P. L. Biochemicals, Inc.
Potassium permanganate (reagent grade) was purchased from J. T.
Baker. Thymine glycol and thymidine glycol were synthesized according
to Frenkel ef a/. (20) and were a gift of Dr. F. Jacobson and Dr. B. Ames.
Microbiological media were as described (21).
Bacterial Strains and Bacteriophage. Escherichia coli strain JM103
and coliphage M13mp8 were provided by H. N. Munro (Massachusetts
Institute of Technology). E. coli MM294A was provided by K. Backman
(Biotechnia).
DNA Isolation. An exponentially growing culture of JM103 cells (6 x
10°cells/ml) was infected with M13mp8 at a multiplicity of infection of
1.0. Four h after infection, cells were pelleted by centrifugation, and the
bacteriophage in the supernatant was precipitated with polyethylene
glycol (22). Phage DNA was extracted twice with phenol and ether and
then precipitated with ethanol (23). The single-stranded DNA preparation
was analyzed by electrophoresis on a 0.8% agarose gel (23) and was
found to be essentially free of contaminating DNA forms.
DNA Treatment. Labeling of phage DNA was achieved with [methyl3H]thymidine. JM103 cells were infected with M13mp8; after 90 min,
[3H]thymidine was added to the medium (final specific activity, 25 ¿iCi/
ml), and the cells were incubated for 4-5 h (24). Single-stranded DNA
VOL. 45 DECEMBER
1985
6113
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
INHIBITION
OF DNA SYNTHESIS
was prepared as described above. The specific activity of the DNA
preparation was 18,000 cpm/^g. DNA concentration was measured
spectrophotomethcally,
using the relation 1 A^ unit = 40 ^g of singlestranded DNA per ml.
Oxidation with KMnO4. Single-stranded DNA (either labeled or unlabeled) was dissolved in 0.3 M NH4CI-NH4OH, pH 8.6, and treated with
0.7 or 1.4 rriM KMnO4. Oxidation was carried out at 37°C for 5 min.
Samples were cooled rapidly and maintained on ice for 30 min (25), and
subsequently the oxidized DNAs were desalted by chromatography on
a Biogel P-6DG column (15 x 1.5 cm) eluted with 150 mw KCI:100 mw
potassium phosphate: 1 rriM disodium EDTA (pH 8). Following ethanol
precipitation, oxidized DNAs were resuspended in 1 rriM Tris-HCI:0.1
mw EDTA (pH 8).
HPLC Analysis. DNAs were hydrolyzed to deoxynucleosides by using
DNAse I, snake venom phosphodiesterase, and alkaline phosphatase
(Sigma) sequentially as described previously (26). Hydrolysates contain
ing unmodified and modified nucleosides were submitted to chromatog
raphy on a polyacrylamide:phenyl boronate column (0.5 x 15 cm; Affigel601), which had been preequilibrated with 0.25 M ammonium acetate,
pH 8.8. Nucleosides possessing vicinal c/s-glycol functionalities were
retained under these conditions, and they subsequently were eluted with
1 M ammonium acetate (pH 8.8). Fractions containing the thymine glycol
were evaporated to dryness under vacuum. The residue was resus
pended in water and analyzed by HPLC.4 HPLC analysis was performed
as previously described by Frenkel ef al. (20).
Transfection
Assay. Introduction of phage DNA into competent
MM294A cells was performed as described by Mandel and Higa (27).
DNA [1 /¿gin 100 pi of 10 HIM Tris-HCI:1 mM EDTA (pH 8)] that had
been either treated or not treated with KMnO4 was added to competent
cells (200 n\), which were then heat shocked for 90 s at 42°C. Subse
quently, 2 ml of Luria Broth medium were added, and the mixture was
incubated for 30 min at 37°C with gentle shaking. Aliquots of 0.1 ml
were removed and added either directly or after appropriate dilution in
Luria Broth to 2.5 ml of liquified top agar containing 40 ^l of 5-bromo-4chloro-3-indoyl-fl-D-galactopyranoside
(Sigma; 20 mg/ml), 20 ^l of isopropyl-£!-D-thiogalactopyranoside (Sigma; 12 mg/ml), and 0.1 ml of an
overday JM103 culture. The transformation mixture was plated on
minimum M9 plates (21) and incubated for 16-18 h at 37°C.Transformants were screened by enumeration of blue plaques. Transfection effi
ciency was expressed as the number of plaques per pg of DNA, and
these data were used to calculate relative surviving fractions.
DNA Synthesis. Single-stranded M13mp8 DNA (treated or untreated
with KMnO4) was mixed with a pentadecamer oligonucleotide primer
(templateiprimer ratio, 0.25 ^g:2.5 ng), and the reaction was adjusted to
a total volume of 10 M! and a buffer composition of 10 mM Tris-HCI (pH
7.5):10 HIM NaCI. The primer was hybridized to the template by heating
at 85°Cfor 5 min, followed by cooling at room temperature for 45 min.
Dithiothreitol and MgCI2 were added to final concentrations of 1 mM and
10 mw, respectively. Primed DNA (3 /il) was combined with an equal
volume of a solution containing DNA synthesis precursors and 2 units
(approximately 0.5 ¿il)
of the Klenow fragment of E. coli DNA polymerase
I (Bethesda Research Laboratories); the final composition of the reaction
included 30 pmol of [«-32P]dATPand 25 MMeach of dATP, dGTP, dCTP,
and dTTP. The reaction was allowed to progress for 0, 1, 2, 5, 10, 15,
30, or 60 min at 24°Cand then stopped by addition of 10 /alof deionized
formamide containing 0.3% xylene cyanol FF, 0.3% bromophenol blue,
and 0.37% disodium EDTA (pH 7). DNA samples were heated for 3 min
before electrophoresis.
Electrophoresis of 2 M' of sample was accomplished by using an 8%
polyacrylamide gel containing 8 M urea at 1200 V for 4 h. Gels were
fixed with a solution of 10% acetic acid before exposure. Autoradiograms
were created by exposure of the gel at room temperature for 12-16 h
to Kodak XAR-5 films. DNA was sequenced by the M13 dideoxy chain
termination method (28).
4 The abbreviation used is: HPLC. high-pressure liquid chromatography.
CANCER
ON OXIDIZED TEMPLATES
RESULTS
The goal of this study was to investigate some of the genotoxic
properties of the thymine glycol, which is one of the many DNA
lesions induced by ionizing radiation (5) and also apparently a
modification that normally forms in vivo (18). Because ionizing
radiation causes such a broad spectrum of different DNA modi
fications (29), we elected to take the relatively simple approach
of using a chemical oxidizing agent, KMn04, to selectively form
thymine glycol in the genome of the single-stranded bacteriophage M13mp8. This oxidizing reagent can form other DNA
modifications (e.g., altered cytosine residues), but under the
conditions used here, thymine glycol has been reported to be
formed almost exclusively (19,25). We cannot, however, exclude
the possibility that minor DNA modifications could contribute to
the effects we have observed.
The conditions of DNA oxidation used resulted in dose-de
pendent formation in the M13mp8 genome of a molecule chromatographically identical to authentic thymidine glycol (Chart 1).
These conditions are similar to those used initially by lida and
Hayatsu (19) and later by Frenkel ef al. (20), who developed the
analytical system we used to determine the level of modification
of the phage genome. Using KMnO4 doses of 0.7 and 1.4 mw,
we found levels of thymine glycol corresponding to approximately
200 and 400 adducts per M13mp8 genome, respectively. Phage
DNA was analyzed for thymine glycol content no more than 2
days after introduction of [3H]thymidine into the phage genome
by in vivo labeling. We minimized the time this radionuclide was
present in DNA because, in early experiments, we found that
prolonged storage of DNA containing [mefAiy/-3H]thymidine cre
ated lesions inhibitory to DNA synthesis in vitro (data not shown).
Teebor ef a/. (30) recently discovered that this radionucleoside
transmutâtes readily to 5-hydroxymethyl-2'-deoxyuridine,
and
possibly a related radiochemical reaction was the cause of the
DNA synthesis effects we observed.
The effects of the lesions induced by KMnO4 on DNA replica
tion in vitro were investigated in the experiment shown in Fig. 1.
The doses and conditions of KMnO4 treatment were identical to
those described above, but the DNA was not labeled with [3H]thymidine. In this experiment a pentadecamer oligodeoxyribonucleotide primer was annealed to a defined site on the viral (+)
strand of oxidized M13mp8 DNA. Addition of the Klenow subunit
of E coli DNA polymerase I and DNA synthesis precursors
(including [«-32P]dATP) resulted in elongation of the primer.
Subsequently the DNA synthesis mixture was denatured and
analyzed on a denaturing polyacrylamide gel. After electropho
resis to resolve the products of DNA synthesis on the basis of
size, the gel was subjected to autoradiography to visualize bands
at the positions of inhibited oligodeoxynucleotide chain elonga
tion. In parallel, a control DNA sample was analyzed; this DNA
was treated identically, except for the step involving KMn04
oxidation, which was omitted. The exact positions of chain
elongation inhibition were determined by reference to the sites
of inhibition of elongation by dideoxynucleosides, as used in the
DNA sequencing technique of Sanger ef al. (28).
The result of this experiment indicated that oligonucleotide
chain elongation was inhibited on oxidized, but not on control,
templates (Fig. 1). Specifically, bands were observed almost
exclusively at the positions corresponding to the sites of adenines in the newly synthesized DNA strand. The most direct
RESEARCH VOL. 45 DECEMBER
1985
6114
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
INHIBITION
OF DNA SYNTHESIS
tion observed on the oxidized templates (Lanes b and c for DNAs
modified at 0.7 and 1.4 mw KMn04, respectively). We conclude
from this experiment that the inhibitory effects of the lesion(s) in
the template are strong in this DNA synthesis system. We did
not investigate whether altering the conditions of DNA synthesis
(e.g., by exchanging Mg2+ for Mn2*) would permit bypass of the
CHj
HN
300
E
u
ON OXIDIZED TEMPLATES
OH
OH
inhibitory lesion(s).
There is an additional noteworthy effect that is evident from
the data presented in Fig. 1. Whereas sites of inhibition corre
sponded to T-residues in the template, the intensity of the bands
varied at different positions in the sequence. This may reflect a
sequence dependence in the formation of the DNA-inhibitory
lesions, determined perhaps by localized differences in the sec
ondary structure of this area of the genome. Alternatively this
effect could have been due to sequence-dependent inhibition of
DNA polymerase activity, or to sequence-dependent
readthrough of lesions in the template, although these explanations
seem less likely.
In view of the inhibitory effect of putative modified thymines
on DNA synthesis in vitro, it was of interest to investigate to
what extent this effect was reflected in vivo. To examine the
effect of DNA modification on the ability of the template to
function in vivo, DNAs treated with KMnO4 as in the previous
experiment were used to transfect E. coli MM294A cells. The
results of this experiment (Chart 2) indicate that oxidation re
duced the ability of modified DNA to produce progeny phage,
and that the level of reduction in survival was dose dependent
for the two doses evaluated. At the higher dose (1.4 mw), a 50%
reduction in survival was observed.
200
IOO
0
0.5
5 7
IO
Retention
Time (min)
DISCUSSION
Chart 1. HPLC analysis of vicinal c/s-dihydroxythymines produced by oxidation
of phage DNA. In A, the single-stranded genome of bacteriophage M13mp8 was
radiolabeled in vivo using [3H]thymidine and, after isolation, treated with 1.4 mw
KMnO«for 5 min to form thymine glycol DNA was hydrolyzed enzymatically and
then submitted to chromatography on a phenyl coronate column to isolate c/sglycols. The fraction from the boronate column containing c/s-glycols was resubmitted to Chromatographie analysis on a reversed-phase HPLC column; the profile
of radioactivity from this column is shown above. B, UV chromatogram indicating
positions of elution of synthetic standards of thymine and thymidine glycols. Under
these conditions of elution, [3H]thymidine eluted at approximately 20 min; this
nucleoside was not detected, because it was not retained on the phenyl boronate
column.
explanation of this sequence-specific effect is that the thymine
residue in the complementary, KMn04-treated strand was mod
ified in some molecules, and that this modification was inhibitory
to DNA synthesis under the conditions used. Given the specificity
of KMnO4 for formation of thymine glycol, we suggest that this
lesion was responsible for these effects. We note that careful
examination of the autoradiogram in Fig. 1 reveals a site (position
39) at which inhibition of synthesis may not have been associated
with the formation of thymine glycol in the template. The reason
for this alteration from the pattern seen elsewhere in the se
quence is not known at present.
As part of this experiment we investigated whether the inhibi
tory effects of the putative thymine lesion could be overcome by
increasing the time available for DNA synthesis. Incubations were
conducted for times ranging from 0-60 min. A progressive
increase in the size of fragments was produced on control
(untreated) templates (Lane a for each time point). However, in
contrast, no significant change occurred in the pattern of inhibi
CANCER
RESEARCH
Ionizing radiation creates a broad spectrum of lesions within
the structure of DNA (29, 31). Among these are ring-saturated
thymine derivatives, including the thymine glycol. In this work a
chemical reagent, KMnO4, has been used to introduce into DNA
a limited range of lesions of the type known to be induced by
ionizing radiation. The conditions of DNA treatment and subse
quent storage we used (pH 8.6) have been reported to produce
thymine glycol almost exclusively (16, 22) and are optimal for
preserving its structural integrity. Exposure of modified DNAs to
more acidic and more alkaline conditions was avoided in view of
their adverse effect on the stability of thymine glycol (19). In
addition, [5-mef/jy/-3H]thymine was not used in experiments that
could be affected by its transmutation to 5-hydroxymethyluracil
(30); radioactive thymine-labeled phage DNAs were used only to
quantitate levels of thymine glycol produced under defined con
ditions of oxidation with KMn04.
The lethal effect of the putative thymine glycol on M13mp8
DNA was smaller than that observed by Hariharan and Cerutti
(10), who investigated this phenomenon using the genome of
another single-stranded phage, 0X174. These workers found
that approximately two ring-saturated thymine lesions, created
by osmium tetroxide treatment, reduced survival by 50% in the
0X174 system, whereas our data indicate that at least 400
permanganate-induced lesions would be required to achieve this
reduction in survival with M13mp8. This discrepancy could be
due in part to differences in the chemical reagent used to oxidize
the DNA, to differences in the analytical techniques used to
measure levels of genome modification, or to differences in the
VOL. 45 DECEMBER
1985
6115
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
INHIBITION
OF DNA SYNTHESIS
ON OXIDIZED TEMPLATES
5'CCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAA
3' Template
......
i i i i i i i
v!dl
3,TGCAGCACTGACCCT5,
primer
CHASE (min)
0alieIII1afc1
A C G T
160at>c1
110a>cII15bc1
130allcII
1
12a)c15abc1
f I ft
(lili
Fig. 1. Polyacrylamide gel analysis of the
products ot DNA synthesis on oxidized DMA
templates. The single-stranded genome of
M13mp8 was treated with either 0, 0.7, or 1.4
mm KMnO4 (Lanes a, o, and c, respectively) and
then primed for DNA synthesis with a comple
mentary 15-mer oligonucleotide. After addition
of the Klenow subunit of DNA polymerase I of
E. coli, the mixture was incubated for 0, 1,2,
5, 10, 15, 30, or 60 min. The flanking lanes of
the gel (A C, G, T) indicate the positions of
oligonucleotide chain inhibition caused by dideoxynucleotides, as in the DNA sequencing
technique of Sanger (28).
; :
t l t
••«
. . •.
Hind III
inherent sensitivities of the respective cell types used to replicate
oxidized DNA. The moderate effect on phage survival of ringsaturated thymines contrasts with the more profound effects of
the abasic site, A/-acetoxy-A/-acetylaminofluorene adducts, and
the cyclobutyl thymine dimer. A single unrepaired DNA lesion of
each type is lethal to the genomes of single-stranded phage
replicated in cells uninduced for SOS functions (32-34).
Our data on in vitro replication of oxidized DNAs indicate that
a lesion or lesions present in these templates are strongly
inhibitory to the activity of the Klenow fragment of DNA polymer
ase I from E. coli (Fig. 1). Since inhibition of oligodeoxynucleotide
chain elongation occurred opposite thymine residues, it is our
working hypothesis that a thymine lesion was responsible for
these effects. In view of the marked selectivity of KMn04 to
introduce thymine glycol residues into single-stranded templates,
we suggest that this lesion or perhaps a related ring-saturated
thymine was involved in causing these effects. The data also
suggest that the replication blocks effected by this lesion are
strong, as evidenced by the apparent inability of DNA polymerase
to bypass the lesions under conditions of prolonged reaction
time.
The observation that oligodeoxynucleotide chain elongation
was inhibited directly opposite thymines in the template strand
differs somewhat from what has been seen on the effects of
other forms of DNA damage on in vitro replication. Under condi
tions similar to those we used, other workers have observed
that most DNA lesions inhibit DNA synthesis one base before
the position of hypothesized modification. This has been ob
served for the DNA adducts of A/-acetoxy-A/-acetylaminofluorene
(35-37), benzo(a)pyrene diol-epoxide (38), UV damage (39), and
psoralen (40). The same effect has been observed for apurinic
and apyrimidinic sites (41). Only with 4-hydroxyaminoquinoline
1-oxide has significant inhibition been observed directly opposite
the positions of suspected DNA modification (42), and even in
this case, the predominant positions of inhibition were one base
before putative lesions. Our observation that the Klenow subunit
of DNA polymerase can approach closer to putative ring-satu
rated thymines than it can to other forms of DNA damage
CANCER RESEARCH VOL. 45 DECEMBER
1985
6116
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
INHIBITION OF DNA SYNTHESIS
100
0.7
1.4
( mM)
Chart 2. Effect of oxidation on phage survival. The single-strandedgenome of
bacteriophageM13mp8 was treated with 0, 0.7, or 1.4 mu KMnCv After desalting
by steric exclusion chromatography, DNA was precipitated with ethanol, dissolved
in 10 HIMTris-HCI:1 mu EDTA (pH 8), and used to transfect competent E. coli
MM294A cells. Survival was determined as the percentage of progeny phage
derived from KMnCvtreated DNA, as compared to untreated DNA. Points, mean
of four different experiments; bars, SO.
possibly is due to a relatively minor effect of ring saturation on
DNA conformation. However, our data also indicate that the
structural effects of ring-saturated thymines are not so subtle as
to allow polymerase to bypass the modification, as evidenced by
the lack of elongation beyond positions of modifications indicated
in Fig. 1.
Although it is our working hypothesis that the thymine glycol
is the most likely lesion to be responsible for the inhibitory effects
observed during in vitro replication of oxidized templates, we
cannot rule out the possibility that these effects are attributable,
wholly or in part, to minor products formed either directly by
oxidization, or as secondary products during the preparation of
primed, oxidized templates (e.g., strand breaks, abasic sites,
urea residues). There are some data, however, that argue against
the significant contribution of several of these lesions to the
observed effects. Strand breaks are unlikely to be responsible
for the effects on inhibition of DNA synthesis in vitro, because
their formation would be expected to result in a larger reduction
in survival in vivo than was observed in Chart 2 (a single chain
scission event is lethal to single-stranded phage DNA). In addi
tion, as indicated above, the pattern of inhibition of DNA synthe
sis seen for oxidized templates differs from that seen for tem
plates containing abasic sites (41), where inhibition generally has
been observed before the position of the lesion. An apyrimidinic
site is one of the possible degradation products of thymine glycol
and other ring-saturated pyrimidines (43). Because the pattern
we observed did not match that of partially depurinated/depyrimidinated templates (with the possible exception of the local effect
noted at position 39 of Fig. 2), we feel that we can rule out the
possibility that the abasic site contributes in a significant way to
the effects observed in Fig. 1. However, we cannot exclude the
possibility that other known ring-saturated pyrimidine breakdown
products, such as deoxyribosyl urea (5), contribute to the ob
served pattern of DNA synthesis inhibition.
A question that remains to be resolved is how the thymine
CANCER
RESEARCH
ON OXIDIZED TEMPLATES
glycol can be responsible for such profound blocks to replication
in vitro, while its effects on phage survival in vivo are compara
tively minor. One possible rationalization of this result is that the
replication blocks observed in the in vitro system with DNA
polymerase I either do not occur or occur to a lesser extent in
vivo. In the cell, it is possible that bypass of modified thymine
residues occurs, although perhaps at low efficiency, and that the
duplex region thereby created is subject to efficient repair by the
multiple pathways available for these lesions (44). It would be of
interest to determine whether a replication complex that approx
imates more closely the in vivo system involving polymerase III
would be blocked by the DNA modifications investigated in this
study.
In view of the ability of the lesion(s) under investigation in this
work to inhibit replication in vitro, it is of interest to investigate
mutagenic consequences that could result from their in vivo
processing. Most of the agents listed above that, upon modifi
cation of DNA, inhibit replication in this assay are mutagenic in
vivo. Activation of the SOS system almost invariably is required
to demonstrate the mutagenic activity of these lesions (45). In
related work to be described elsewhere,5 we have used a forward
mutation assay (46) to investigate the mutagenic processing of
a bacterial plasmid oxidized, as described herein for M13mp8,
to selectively create ring-saturated thymine lesions. These stud
ies have revealed that a lesion or lesions present in this DNA are
mutagenic in vivo and that induction of the umuC, D system in
cells replicating these plasmids results in a 100-fold increase in
mutagenic activity. Current efforts are directed toward sitespecific incorporation of thymine glycol in M13mp8 to investigate
the question of whether this lesion alone can cause the pattern
of DNA synthesis inhibition and mutagenesis we have observed
for oxidized DNA.
ACKNOWLEDGMENTS
For their contributions to this work, the authors gratefully acknowledge Edward
Loechler, Elaine Fahci. Kim Bond Schaefer, Linda Couto, Ashis Basu, and Dana
Lasko.
REFERENCES
1. Little, J. B. Biologicalconsequencesof X-ray induced DNA damage in relation
to cell killing and carcinogenesis.In: P. C. Hanawalt, E. C. Friedberg, and C.
F. Fox (eds.), DNA Repair Mechanisms, pp. 701-711. New York. Academic
Press, Inc., 1978.
2. Matanoski, G. M., Sartwell, P., Elliott, E., Tonasela, J., and Steinberg, A.
Cancer risks in radiobiologists and radiation workers. In: J. D. Boice, Jr., and
J. F. Fraumeni (eds.). Radiation Carcinogenesis:Epidemiology and Biologica)
Significance,pp. 83-105. New York: Raven Press, 1984.
3. Schull, W. J., Otake, M., and Neel, J. V. Genetic effects of the atomic bomb:
a reappraisal.Science(Wash. DC), 273.-1220-1227,1981.
4. Urbach, F. Evidence and epidemiology of ultraviolet-inducedcancer in man.
Nati. Cancer Inst. Monogr. 50: 5-10. 1978.
5. Teoule, R., Bonicel, A., Bert, C., Cadet. J., and Polverelli,M. Identification of
radioproducts resulting from breakage of the thymine moiety by gamma
irradiation of E. coli DNA in an aerated aqueous solution. Radiât.Res., 57:
46-58, 1974.
6. Teoule, R., and Cadet. J. Radiolysisof thymine in aerated aqueous solutions.
J. Chem. Soc. Chem. Commun., 20: 1269-1270, 1971.
7. Smith, R. L., and Weidemann, M. J. Reactive oxygen production associated
with arachidonic acid metabolism by peritoneal macrophages. Biochem. Biophys. Res. Commun., 97. 973-980,1980.
8. Tien. M., and Aust, S. 0. Comparative aspects of several model lipid peroxydation systems. In: K. Yagi (ed.), Lipid Peroxidesin Biology and Medicine,pp.
23-29. New York: Academic Press, Inc., 1982.
9. Hariharan,P. V., and Cerutti, P. A. Formationof products of the 5,6-dihydrox5P. Rouet, L. B. Couto, and J. M. Essigmann, manuscript in preparation.
VOL. 45 DECEMBER
1985
6117
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
INHIBITION
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
OF DNA SYNTHESIS
ydihydrothyminetype by ultraviolet light in HeLacells. Biochemistry, 76:2791 2795, 1977.
Maridaran.P. V., Achey, P. M., and Cerutti, P. A. Biologicaleffects of thymine
ring saturation in coliphage 0X174-DNA. Radiât.Res., 69: 375-378,1977.
Gates, F. T., and Linn, S. Endonuclease from Escherichia coli that acts
specifically upon duplex DNA damaged by ultraviolet light, osmium tetroxide,
acid, or X-rays. J. Biol. Chem., 252: 2802-2807,1977.
Grossman,L. Enzymesinvolvedin the repair of damaged DNA. Arch. Biochem.
Biophys., 211: 511-522, 1981.
Marinaran,P. V., and Cerutti. P. A. Repair of ->-rayinduced thymine damage
in Micrococcus radiodurans. Nature (Lond.), 229: 247-249, 1971.
Hariharan,P. V., and Cerutti, P. A. Excision of damaged thymine residuesfrom
gamma-irradiatedpoly(dA-dT)by crude extracts of Escherichiacoli. Proc. Nati.
Acad. Sci. USA, 77: 3532-3536,1974.
Breimer,J. H., and Lindahl,T. DNA glycosylase activities for thymine residues
damaged by ring saturation, fragmentation, or ring contraction are functions
of endonucleaseIII in Escherichia coli. J. Biol. Chem., 259: 5543-5548,1984.
Demple, B., and Linn, S. 5,6-Saturated thymine lesions in DNA: production by
ultraviolet light or hydrogen peroxide. Nucleic Acids Res., 70: 3781-3789,
1982.
Mattem. M. R., Hariharan,P. V., and Cerutti, P. A. Selectiveexcision of gamma
ray damaged thymine from the DNA of cultured mammalian cells. Biochim.
Biophys. Acta, 395: 48-55, 1975.
Carthcart, R., Schwiers, E., Saul, R. L., and Ames, B. N. Thymine glycol and
thymidine glycol in human and rat urine: a possible assay for oxidative DNA
damage. Proc. Nati. Acad. Sci. USA,87: 5633-5637, 1984.
lida, S., and Hayatsu, H. The permanganate oxidation of deoxyribonucleic
acid Biochim. Biophys. Acta, 240: 370-375, 1971.
Frenkel, K., Goldstein, M. S., and Teebor, G. W. Identification of the cisthymine glycol moiety in chemicallyoxidized and -»-irradiated
deoxyribonucleic
acid by high pressure liquid chromatography analysis. Biochemistry,20: 75667571,1981.
Miller,J. Experimentsin MolecularGenetics,pp. 431-432. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory, 1972.
Messing, J., Gronenborn, B., Muller-Hill,B., and Hofschneider, P. H. Filamen
tous coliphage M13 as a cloning vehicle: insertion of a Hind III fragment of the
lac regulatory region in M13 replicative form. Proc. Nati. Acad. Sci. USA, 74:
3642-3662, 1977.
Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning, a Laboratory
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982.
Ray, D. S., and Scheckman, R. W. Replication of bacteriophage M13. I.
Sedimentation analysis of crude lysates of M13 infected bacteria. Biochim.
Biophys. Acta. 779: 398-407, 1969.
lida, S., and Hayatsu, H. The permanganate oxidation of thymine. Biochim.
Biophys. Acta. 273: 1-13, 1970.
Baird. W. M., and Brookes, P. Isolation of the hydrocarbon deoxyribonucleoside products from the DNA of mouse embryo cells in culture treated with 7methyl benz(a)anthracene.Cancer Res.. 33. 2378-2385,1973.
Mandel, M., and Higa, A. Calcium dependent bacteriophage DNA infection. J.
CANCER
RESEARCH
ON OXIDIZED TEMPLATES
Mol. Biol., 53:154-162, 1970.
28. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain
terminating inhibitors. Proc. Nati. Acad. Sci. USA, 76: 5463-5467, 1977.
29. Von Sonntag, C., Hagen, U., Schon-Bopp, A., and Schulte-Frohlinde, D.
Radiation induced strand breaks in DNA: chemical and enzymatic analysis of
end groups and mechanisticaspects. Adv. Radiât.Biol., 9: 109-142,1981.
30. Teebor, G. W., Frenkel, K., and Goldstein, M. Ionizing radiation and tritium
transmutation both cause formation of 5-hydroxymethyl-2'-deoxyuridine in
cellular DNA. Proc. Nati. Acad. Sci. USA, 87: 318-321, 1984.
31. Alexander, P., and Lett, J. T. Effects of ionizing radiation on biologicalmacromolecules.In: M. Florkin and E. M. Stotz (eds.), ComprehensiveBiochemistry,
Vol. 27, pp. 267-356. Amsterdam: Elsevier, 1967.
32. Schaaper, R. M., and Loeb, L. Depurinationcauses mutations in SOS-induced
cells. Proc. Nati. Acad. Sci. USA, 78: 1773-1777,1981.
33. Lutgerink, J. T., Retel, J., and Loman, H. Effects of adduci formation in the
biologicalactivity of singleand double stranded </>X174
modified by W-acetoxyW-acetyl-2-aminofluorene.Biochim. Biophys. Acta, 787: 81-91, 1984.
34. Howard-Flanders,P. DNA repair. Annu. Rev. Biochem., 37: 175-196,1968.
35. Moore, P. D., Rabkin, S. D., and Strauss, B. S. Termination of in vitro DNA
synthesis at acetoaminofluoreneadducts in the DNA. Nucleic Acids Res., 8:
4473-4484,1980.
36. Moore, P. D., Bose, K. K., Rabkin, S. D., and Strauss, B. S. Sites of termination
of in vitro DNA synthesis on ultraviolet and W-acetylaminofluorenetreated
0X174 templates by prokaryotic and eukaryotic DNA polymerases.Proc. Nati.
Acad. Sci. USA, 78: 110-116,1981.
37. Moore, P. D., Rabkin, S. D., Osbom, A. L., King, C. M., and Strauss, B. S.
Effect of acetylated and deacetylated 2-aminofluoreneadducts on in vitro DNA
synthesis. Proc. Nati. Acad. Sci. USA, 79: 7166-7170,1982.
38. Larson, K. L., Angelis, K., and Strauss, B. Replicationof carcinogendamaged
double and single stranded DNA templates in vitro. J. Cell. Biochem., 709: 43
1984.
39. Moore, P., and Strauss, B. S. Sites of inhibition of in vitro DNA synthesis in
carcinogen and UV treated «X174DNA. Nature (Lond.), 278: 664-667, 1979.
40. Piette, G. J., and Hearst, J. E. Termination sites of the in vitro nick-translation
reaction of DNA that had photoreacted with psoralen. Proc. Nati. Acad. Sci.
USA,80: 5540-5544,1983.
41. Strauss, B. S., Rabkin, S., Sagher, D., and Moore, P. The role of DNA
polymerase in base substitution mutagenesis on non-instructional templates.
Biochimie,64: 829-838, 1982.
42. Yoshida, S., Koiwai, 0., Suzuki, R., and Tada, M. Arrest of DNA elongation by
DNA polymerases at guanine adducts on 4-hydroxyamino quinoline 1-oxide
modified DNA template. Cancer Res., 44: 1867-1870, 1984.
43. Burton, K., and Riley, W. T. Selective degradation of thymidine deoxynucleotides. Biochem. J., 98: 70-77, 1966.
44. Smith, K. C. Multiple pathways of DNA repair in bacteria and their roles in
mutagenesis. Photochem. Photobiol., 28: 121-129, 1978.
45. Walker, G. Mutagenesis and inducible responses to deoxyribonucleic acid
damage in Escherichia coli. Microbiol. Rev., 48: 60-93, 1984.
46. Couto. L. B., and Essigmann,J. M. A plasmid-basedassay for alkylating agent
mutagenesisand repair. Proc. Am. Assoc. Cancer Res., 25: 390,1984.
VOL. 45 DECEMBER
1985
6118
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.
Possible Role for Thymine Glycol in the Selective Inhibition of
DNA Synthesis on Oxidized DNA Templates
Patricia Rouet and John M. Essigmann
Cancer Res 1985;45:6113-6118.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/45/12_Part_1/6113
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 16, 2017. © 1985 American Association for Cancer Research.