RIKEN BRC use:JCM No. (Form M-8-GD) Data Sheet of Living Modified Organism Scientific Name: Should be confirmed by: □PCR □others( ) PCR Condition Data Sheet Please send any information such as sequence of construct or restriction map if available. Providing with the positive control DNA (including plasmid) is highly appreciated. reaction mixtures DW ×Buffer mM dNTP primer #1 pmol/µl Primer #2 pmol/µl primer #3 pmol/µl primer #4 pmol/µl mM MgCl2 Taq polymerase ( U/µl) DNA total tube 1 µl µl µl µl µl µl µl µl µl µl µl tube 2 µl µl µl µl µl µl µl µl µl µl µl cycling condition min 94 ˚C min 94 ˚C min ˚C min 72 ˚C min 72 ˚C × cycle Taq product name (company) primer #1 name ( 3’ ( 3’ ( 3’ ( 3’ sequence 5’ primer #2 name sequence 5’ primer #3 name sequence 5’ primer #4 name sequence 5’ primer set primer #1 primer # product size ⇔ ⇔ primer # primer # wild or mutant band bp bp Construction map, electrophoretogram, and other information: mer) mer) mer) mer) [Example] PCR Condition Data Sheet reaction mixtures DW 2 ×Buffer 2.5 mM dNTP primer 1 10 pmol/µl Primer 2 10 pmol/µl primer 3 primer 4 2.5 mM MgCl2 Taq polymerase ( 5 U/µl) DNA total tube 1 4.8 µl 9.4 µl 2.0 µl 1.0 µl 1.0 µl µl µl 0.6 µl 0.2 µl 1.0 µl 20.0 µl tube 2 µl µl µl µl µl µl µl µl µl µl µl cycling condition 94 ˚C 300 min 30 min 94 ˚C 30 min 57 ˚C 72 ˚C 120 min 72 ˚C 300 min × 34 cycle Taq product name (company) EX Taq (TAKARA) primer #1 name LCB600 sequence 5’ LCB601 sequence 5’ primer #2 name GTTTTAAATTCCTTTAAATTT AAAACCCCGGGGAAATTTTAA primer #3 name sequence 5’ primer #4 name sequence 5’ primer set primer #1 primer # ⇔ ⇔ primer #2 primer #3 product size 120 bp 150 bp wild or mutant band Mutant wild Construction map, electrophoretogram, and other information: ( 21 mer) 3’ ( 21 mer) 3’ ( mer) 3’ ( mer) 3’
© Copyright 2026 Paperzz