Journal of General Virology (2015), 96, 1957–1968 DOI 10.1099/vir.0.000102 Defects in RNA polyadenylation impair both lysogenization by and lytic development of Shiga toxin-converting bacteriophages Dariusz Nowicki,13 Sylwia Bloch,13 Bożena Nejman-Faleńczyk,1 Agnieszka Szalewska-Pałasz,1 Alicja We˛grzyn2 and Grzegorz We˛grzyn1 Correspondence 1 Grzegorz We˛grzyn 2 [email protected] Received 2 October 2014 Accepted 19 February 2015 Department of Molecular Biology, University of Gdańsk, Wita Stwosza 59, 80-308 Gdańsk, Poland Laboratory of Molecular Biology (affiliated with the University of Gdańsk), Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Wita Stwosza 59, 80-308 Gdańsk, Poland In Escherichia coli, the major poly(A) polymerase (PAP I) is encoded by the pcnB gene. In this report, a significant impairment of lysogenization by Shiga toxin-converting (Stx) bacteriophages (W24B, 933W, P22, P27 and P32) is demonstrated in host cells with a mutant pcnB gene. Moreover, lytic development of these phages after both infection and prophage induction was significantly less efficient in the pcnB mutant than in the WT host. The increase in DNA accumulation of the Stx phages was lower under conditions of defective RNA polyadenylation. Although shortly after prophage induction, the levels of mRNAs of most phage-borne early genes were higher in the pcnB mutant, at subsequent phases of the lytic development, a drastically decreased abundance of certain mRNAs, including those derived from the N, O and Q genes, was observed in PAP I-deficient cells. All of these effects observed in the pcnB cells were significantly more strongly pronounced in the Stx phages than in bacteriophage l. Abundance of mRNA derived from the pcnB gene was drastically increased shortly (20 min) after prophage induction by mitomycin C and decreased after the next 20 min, while no such changes were observed in non-lysogenic cells treated with this antibiotic. This prophage induction-dependent transient increase in pcnB transcript may explain the polyadenylation-driven regulation of phage gene expression. INTRODUCTION Shiga toxin-converting bacteriophages (or Stx phages) are classified as lambdoid viruses due to organization of their genomes, which resembles that of bacteriophage l (Allison, 2007; Łoś et al., 2011). Although there are also homologies between sequences of some crucial regulatory genes of Stx phages and l, they rarely share a common virion structure. Nevertheless, similarities in regulatory mechanisms of viral development are also evident, including the lysis-versuslysogenization decision, control of phage gene expression and phage DNA replication; though differences in important details were also reported (Ptashne, 2004; We˛grzyn & We˛grzyn, 2005; We˛grzyn et al., 2012; Allison, 2007; Nejman et al., 2009; Łoś et al., 2011; Riley et al., 2012). What clearly distinguishes all Stx phages from l is the presence of stx genes, coding for Shiga toxins, in their genomes. Escherichia coli strains become potentially pathogenic to humans when they are lysogenized with an Stx phage. This arises from production of Shiga toxins, which are 3These authors contributed equally to this work. 000102 G 2015 The Authors Printed in Great Britain dangerous to humans, due to the induction of Stx prophages and during lytic development of the viruses. E. coli strains bearing such prophages (called STEC for Shiga toxin-producing E. coli) may cause serious diseases (Gyles, 2007; Łoś et al., 2012). Particularly, a subset of STEC strains, called enterohaemorrhagic E. coli (EHEC) are especially dangerous when infecting humans (Hunt, 2010; Mauro & Koudelka, 2011). The severity of medical problems caused by STEC strains can be exemplified by the outbreak that occurred in Germany in 2011. Its fatal results, summarized as over 4000 symptomatic infections and over 50 cases of death, besides confirming the importance of the problem, also underlined our incomplete knowledge about regulatory mechanisms operating during development of the Stx phages (Mellmann et al., 2011; Beutin & Martin, 2012; Bloch et al., 2012; Karch et al., 2012; Werber et al., 2012). RNA polyadenylation is a post-transcriptional modification of various ribonucleic acids, which proceeds as the addition of adenosine (A) residues to the 39 ends of RNA strands, independently of any template. This process occurs in both eukaryotic and prokaryotic cells, while having Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1957 D. Nowicki and others different consequences in these two groups of biological entities (see Mohanty & Kushner, 2011 for a review). In bacteria, it is generally assumed that polyadenylated RNA molecules are more susceptible to degradation, thus addition of poly(A) tails destabilizes various transcripts. However, there are also examples of RNA stabilization upon polyadenylation, which makes the control of RNA metabolism even more complicated (Mohanty & Kushner, 2011; Régnier & Hajnsdorf, 2013). Moreover, although it was initially believed that RNA polyadenylation in bacterial cells concerns mainly (if not exclusively) mRNA and small regulatory RNA (sRNA) species, recent reports indicate that this kind of modification of tRNA molecules may have an important impact on cell physiology (Mohanty et al., 2012; Mohanty & Kushner, 2013). In E. coli, the major enzyme responsible for RNA polyadenylation is poly(A) polymerase I (PAP I), encoded by the pcnB gene (Cao & Sarkar, 1992; Mohanty & Kushner, 2011). Transcripts derived from over 90 % of ORFs undergo polyadenylation by this enzyme to some extent (Mohanty & Kushner, 2000, 2006). There is a surprisingly low number of published reports concerning the role of RNA polyadenylation in development of bacteriophages. The most important discoveries in this field are summarized below. Short stretches of A or U residues were detected in the RNA genome of bacteriophage MS2, however, their biological role is unclear (Klovins et al., 1997). Polyadenylation of different mRNAs of bacteriophage T7 was reported, but it appeared that this modification occurred after nucleolytic cleavage of the primary transcripts (Johnson et al., 1998). Similar results were described after analysis of mRNAs encoded by filamentous bacteriophage f1, where polyadenylation has been suggested to occur at the later stages of transcript degradation (Goodrich & Steege, 1999). Contrary to reports on T7- and f1-derived transcripts, no significant polyadenylation of mRNAs of phage T4 could be found (Yonesaki, 2002). One of the few published examples of the involvement of RNA polyadenylation in the development of bacteriophages is the requirement of this biochemical reaction for maturation of the CI RNA, a small regulatory transcript of phage P4 (Briani et al., 2002). Another example is polyadenylation of oop RNA, an antisense transcript to mRNA of the cII gene of bacteriophage l (Wróbel et al., 1998). Polyadenylated oop RNA was degraded more rapidly than its unmodified equivalent (SzalewskaPałasz et al., 1998). However, the only observed effect of the pcnB gene dysfunction was decreased efficiency of lysogenization by phage l, which was ascribed to more efficient inhibition of expression of the cII gene by the more stable antisense RNA (Wróbel et al., 1998). Because the field studying the role of polyadenylation in the development of bacteriophages is clearly underexplored and in the light of mounting evidence for important regulatory functions of this RNA modification (Mohanty & Kushner, 2011; Régnier & Hajnsdorf, 2013), we aimed to investigate the effects of mutating the pcnB gene, coding for the major E. coli poly(A) polymerase, on lytic and lysogenic modes of development of Shiga toxin-converting bacteriophages. 1958 RESULTS Impaired lysogenization of the pcnB mutant by Stx phages The only effect of severely decreased RNA polyadenylation, due to mutation of the pcnB gene, on lambdoid bacteriophage development reported to date was a decreased efficiency of lysogenization by bacteriophage l (Wróbel et al., 1998). Therefore, we have measured this parameter for a series of Stx bacteriophages (W24B, 933W, P22, P27 and P32) in WT and DpcnB :: kan strains of E. coli. We confirmed that bacteriophage l lysogenizes the mutant host less efficiently and found that similar but significantly more pronounced effects can be observed for all tested Stx phages (Table 1). In fact, in all our experimental systems with different m.o.i., which is known to influence efficiency of lysogenization (see We˛grzyn & We˛grzyn, 2005 for a review), formation of lysogenic E. coli DpcnB :: kan cells was either extremely rare or impossible to detect (Table 1). Therefore, we concluded that lysogenization by Stx phages is severely impaired by defects in RNA polyadenylation. Decreased efficiency of Stx phage lytic development in the pcnB mutant after infection or prophage induction Previous studies suggested that lytic development of bacteriophage l is only slightly or minimally, if at all, affected by pcnB dysfunction (Wróbel et al., 1998). Here, we have confirmed only minor (less than twofold, on average) effects of the DpcnB :: kan mutation on the kinetics and efficiency of formation of l phage progeny, either after infection of the host cells (Fig. 1) or following prophage induction with mitomycin C (Fig. 2). In both kinds of experiments, burst sizes of l were in the range of a few hundred, as expected. However, while the differences between WT and DpcnB :: kan hosts reached statistical significance in experiments with infection (Fig. 1), no such significance was detected after prophage induction (Fig. 2). On the other hand, significant differences between Stx phage lytic development in WT and DpcnB :: kan hosts were noted, irrespective of the nature of the initiation of phage lytic development (infection or prophage induction) and this was true for all tested Shiga toxin-converting phages (Figs 1 and 2). In all cases, the phages produced five to ten times less progeny in the pcnB mutant than in the WT host. Thus, not only lysogenization, but also lytic development of Stx phages was negatively affected by dysfunction of the pcnB gene. We conclude that the RNA polyadenylation process is important in both developmental pathways of these viruses. Phage DNA synthesis is negatively influenced by dysfunction of the pcnB gene To identify the process(es) in phage development affected by impaired RNA polyadenylation, we tested the kinetics of Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96 RNA polyadenylation in development of lambdoid phages Table 1. Efficiency of lysogenization of E. coli WT (MG1655) and otherwise isogenic DpcnB :: kan strains with lambdoid bacteriophages Results are presented as mean ±SD from three independent experiments. In all cases, differences between WT and DpcnB :: kan strains were significant (P,0.05 in Student’s t-test). Phage Efficiency of lysogenization WT m.o.i.51 lpapa W24B 933W P22 P27 P32 0.412±0.024 0.381±0.031 0.400±0.028 0.355±0.016 0.324±0.024 0.250±0.025 DpcnB :: kan m.o.i.55 m.o.i.510 m.o.i.51 m.o.i.55 m.o.i.510 0.553±0.019 0.467±0.024 0.560±0.054 0.367±0.028 0.480±0.034 0.270±0.018 0.733±0.054 0.662±0.035 0.784±0.044 0.554±0.045 0.640±0.029 0.620±0.037 0.010±0.010 0.001±0.001 0.001±0.001 ,0.001* ,0.001* 0.002±0.001 0.022±0.004 0.002±0.001 0.001±0.001 0.001±0.001 0.001±0.001 0.002±0.001 0.040±0.020 0.005±0.001 0.003±0.001 0.002±0.001 0.002±0.001 0.003±0.002 *No lysogens could be detected. the increase in phage DNA amount (which reflects phage DNA synthesis) in the host cells. The rationale for testing this parameter stems from previous observations that indicated sensitivity of DNA replication of different Stx phages to environmental or physiological stresses, like starvation, oxidative stress or temperature variation (Łoś et al., 2009; Nejman-Faleńczyk et al., 2012; Nowicki et al., 2013). Bacteriophage l and three Stx phages (W24B, 933W and P27) were chosen to test DNA synthesis [P22 and P32 were omitted since replication regions of their genomes are very similar to that of P27 (Nejman et al., 2009)]. Following prophage induction, the kinetics of increases in phage DNA was monitored in WT and DpcnB :: kan hosts. We found that although mutation of the pcnB gene influenced synthesis of phage l DNA only slightly (up to twofold differences in the amount of phage DNA which, nevertheless, reached statistical significance), considerable impairment (fivefold to tenfold) in the increase in amount of Stx phages’ genome-specific sequences was evident (Fig. 3). Again, all Stx phages behave similarly in this experiment. We concluded that RNA polyadenylation indirectly influenced the efficiency of DNA synthesis in the Stx phages. Expression of phage genes in WT host and the pcnB mutant To learn about the molecular mechanism(s) of polyadenylation-mediated control of development of Stx phages, expression of selected viral genes was investigated after prophage induction by measuring the levels of particular transcripts. The following genes were chosen due to their crucial roles in either lytic or lysogenic development: xis, cIII, N, cI, cro, cII, oop, O, Q and R. Among the tested phages only genomes of l, W24B and 933W have been http://vir.sgmjournals.org completely sequenced and published to date, therefore the analysis of viral gene expression was possible only in these cases. As most of the tested genes (xis, cIII, N, cI, cro, cII, oop, O) are expressed shorty after infection or prophage induction (so-called early genes) samples for analysis were withdrawn at time points before the extensive DNA replication and before progeny virions were assembled. Results of these analyses are presented as levels of the tested RNAs at particular times after prophage induction relative to that before induction [time zero; these values were used as calibrators in reverse transcriptase (RT)-quantitative PCR (qPCR)]. A relatively short time after induction with mitomycin C, the amount of all tested transcripts of phages l and W24B, and almost all transcripts of phage 933W, was significantly increased in the pcnB mutant relative to the WT host (Fig. 4). However, opposite results were obtained at later time points in which the abundance of most of the transcripts was significantly reduced in polyadenylation-deficient cells. These differences included genes crucial for lytic development, N and O, coding for an antitermination protein (responsible for positive regulation of expression of delayed-early genes required for lytic development) and the replication initiator, respectively. Importantly, the levels of N and O transcripts were drastically decreased in the pcnB mutant after induction of W24B and 933W prophages, while the differences were moderate in experiments with bacteriophage l (Fig. 4). Such a pattern corresponds to effects of the pcnB gene mutation on lytic development of the tested phages, significantly pronounced for the Stx phages and small or negligible for l (compare Fig. 4 with Figs 2 and 3). Therefore, we conclude that the impairment of lytic development of Stx phages in host cells defective in RNA polyadenylation arises from significantly lower abundance of transcripts of genes coding for proteins crucial for this mode of phage growth. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1959 Fig. 1. Lytic development of bacteriophages lpapa (a), W24B (b), 933W (c), P22 (d), P27 (e) and P32 (f) after infection of otherwise isogenic E. coli WT (open symbols) or DpcnB :: kan (closed symbols) host cells at time zero. Results are presented as burst size (phages per infected cell). Mean values from three independent experiments with error bars indicating SD (note that in some cases, the bars are smaller than the size of symbols) are shown. Significant differences (P,0.05; Student’s t-test) were detected between WT and DpcnB :: kan strains in all experiments with the last five points indicated. 150 Time (min) 100 100 50 150 Time (min) 100 100 50 100 50 100 50 0 0.001 0.01 0.1 10 1 Burst size (p.f.u. per cell) 100 1000 (a) 1960 Time (min) 150 0.001 0.01 λ papa 0.1 1 10 WT ΔpcnB (b) 0 Time (min) 150 0.001 0.01 φ 24B WT ΔpcnB 0.1 0 Time (min) 150 0.001 0.01 933W WT ΔpcnB 0.1 0 50 WT ΔpcnB 0.001 1 1 1 0.01 10 10 10 P22 100 100 100 100 0.1 1000 1000 1000 (e) (d) (f) 1000 0 Time (min) 150 0.001 0.01 P27 0.1 1 WT ΔpcnB 10 100 1000 (f) 0 50 P32 WT ΔpcnB D. Nowicki and others Growth rate of lysogenic cells and expression of the pcnB gene after prophage induction We asked how can defects in RNA polyadenylation affect expression of many viral genes in a coordinated manner which is, however, different at various time points after prophage induction? It has been demonstrated that the pcnB gene is expressed at low levels in exponentially growing E. coli cells (Binns & Masters, 2002; Mohanty et al., 2004), however, the level of the PAP I protein is growth-rate-dependent, being significantly higher in slowly growing cells (Jasiecki & We˛grzyn, 2003). This regulation of pcnB expression during slow growth is apparently due to the presence of a complicated promoter system upstream of this gene, composed of three s70- and two sS-dependent promoters (Jasiecki & We˛grzyn, 2006; Nadratowska-Wesołowska et al., 2010). Therefore, we have measured growth rates of lysogenic and non-lysogenic WT and DpcnB :: kan cells under growth conditions employed in this work. The average generation time of non-induced lysogenic strains was 28±1 min (Table 2, note that all lysogens gave very similar results irrespective of the kind of the prophage), while shortly after prophage induction, the bacterial growth slowed down and the average generation time measured between 0 and 40 min after addition of mitomycin C was 35±2 min (Table 2). At later times (over 40 min) after prophage induction, bacterial growth temporarily resumed (Table 2). The average generation time of non-lysogenic strains was 25±1 (there was no difference between WT and DpcnB :: kan bacteria) and after the addition of 1 mg, microgram mitomycin C ml21 the generation time (measured between 0 and 40 min after the addition) did not change significantly (Table 2). Apparently, the concentration of mitomycin C employed in these experiments was too low to cause bacterial growth inhibition, thus, the effects observed in lysogenic strains were due to prophage induction. To test whether the decreased bacterial growth rate after prophage induction, likely arising from the induction-related stress conditions, might cause enhanced expression of the pcnB gene, we measured the transcript levels of this gene at various times after prophage induction in WT cells lysogenic for l, W24B or 933W, as well as in non-lysogenic bacteria. pcnB transcript levels did not change significantly in non-lysogenic cells after addition of mitomycin C (Fig. 5). However, a dramatic increase in pcnB transcript levels was observed for all tested lysogens 20 min after prophage induction. This increase was transient, as at 40 min and later times after the addition of mitomycin C the abundance of this transcript dropped to the level measured in non-lysogenic cells (Fig. 5). We conclude that prophage induction created conditions that resulted in a significant increase in pcnB gene expression. This may explain the mechanism of RNA polyadenylationdependent regulation of phage genes under such conditions. DISCUSSION In this work, the effects of defective RNA polyadenylation, caused by dysfunction of the pcnB gene coding for the Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96 RNA polyadenylation in development of lambdoid phages (b) (a) 1010 Relative phage titre p.f.u. per A600 unit 1010 108 108 106 106 WT DpcnB 104 102 100 λ papa WT DpcnB 104 102 φ24B 100 0 100 200 Time (min) 0 300 (c) 100 200 Time (min) 300 (d) 1010 Relative phage titre p.f.u. per A600 unit 1010 108 108 106 106 WT DpcnB 104 WT DpcnB 104 102 102 933W 100 0 100 200 Time (min) 300 (e) P22 100 0 100 200 Time (min) 300 (f) 1010 Relative phage titre p.f.u. per A600 unit 1010 108 108 106 106 WT DpcnB 104 WT DpcnB 104 102 102 P27 P32 100 100 0 100 200 Time (min) 300 0 100 200 Time (min) major poly(A) polymerase [poly(A) polymerase I, or PAP I], on lysogenization and lytic growth of several Shiga toxin-converting phages were investigated. Similar to bacteriophage l that was previously reported to lysogenize E. coli pcnB mutant cells less efficiently than WT hosts (Wróbel et al., 1998), we found the formation of prophages by Stx phages to be impaired in bacteria devoid of poly(A) polymerase I (Table 1). However, defects in polyadenylation caused significantly more pronounced impairment of lysogenization by Stx bacteriophages than by l. It was suggested that less effective lysoganization of pcnB hosts by l is due to defective polyadenylation of oop RNA, an antisense transcript acting as a negative regulator of expression of the cII gene, coding for the positive regulator of the pE promoter, necessary for production of the cI repressor and establishment of the prophage state (Wróbel et al., 1998). Since polyadenylated oop RNA is rapidly degraded http://vir.sgmjournals.org 300 Fig. 2. Lytic development of bacteriophages lpapa (a), W24B (b), 933W (c), P22 (d), P27 (e) and P32 (f) after prophage induction with 1 mg mitomycin C ml”1 at time zero in otherwise isogenic E. coli WT (open symbols) or DpcnB :: kan (closed symbols) host cells. Results are presented as number of phages (p.f.u.) per A600 unit of the culture. Mean values from three independent experiments with error bars indicating SD (note that in some cases, the bars are smaller than the size of symbols) are shown. Significant differences (P,0.05) between WT and DpcnB :: kan strains were detected in all Stx phages, but not in l. in E. coli cells (Szalewska-Pałasz et al., 1998), impaired modification of this transcript would result in its stabilization, more effective inhibition of cII expression, less efficient production of the cI repressor and difficulties in lysogenization. Such a mechanism could also operate in Stx phages as oop RNA has been reported for W24B, 933W and some other lambdoid phages (Nejman-Faleńczyk et al., 2015). However, if modification of oop RNA is the only cause of polyadenylation-facilitated lysogenization, it must be more effective than in l. In bacteriophage l, Wróbel et al. (1998) found that lysogenization was the only major process of phage development considerably impaired in PAP I-deficient cells. In contrast, lytic growth of all Stx phages tested here and measured as efficiency of production of phage progeny, was significantly less effective in the pcnB mutant. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1961 D. Nowicki and others Realtive phage DNA content (ng per A600 unit) (a) (b) 40 40 w 24B λ papa 20 20 WT WT DpcnB DpcnB 0 0 0 60 120 180 240 60 120 180 240 Time (min) (c) Realtive phage DNA content (ng per A600 unit) 0 Time (min) (d) 40 40 933W 20 P27 20 WT WT DpcnB DpcnB 0 0 0 60 120 Time (min) 180 240 0 60 120 Time (min) This was the case when the developmental mode had been initiated by infection or prophage induction, suggesting that a common mechanism might operate to slow down the production of phage progeny. To learn about the specific mechanism of polyadenylationcontrolled Stx phage development, expression patterns of phage genes crucial for the regulation of virus development were determined after prophage induction in WT and pcnB hosts. Levels of mRNAs of xis, cIII, N, cI, cro, cII, O, Q and R genes, as well as levels of oop antisense RNA, were determined by RT-qPCR. Note that after prophage induction xis, cIII and N are transcribed from the pL promoter (after excision of the prophage and circularization of phage DNA, xis may be expressed from another promoter, pI, this promoter operates in l but not in some other lambdoid phages, like W24B), cI is expressed from its own promoter, pM (though under these conditions this promoter is repressed by Cro and low levels of cI expression was detected), cro, cII, O and Q mRNAs form a multicistronic transcript from pR, the R gene is under control of the pR’ promoter and oop RNA is a short transcript originating from a promoter located in the cII–O region but oriented in the opposite direction relative to pR (see We˛grzyn & We˛grzyn, 2005 for a review). Interestingly, 1962 180 240 Fig. 3. Levels of DNA of bacteriophages lpapa (a), W24B (b), 933W (c) and P27 (d) either without prophage induction (circles) or after prophage induction with 1 mg mitomycin C ml”1 at time zero (squares) in otherwise isogenic E. coli pcnB+ (open symbols) or DpcnB :: kan (closed symbols) host cells. Results are presented as mean values from three independent experiments with error bars indicating SD (note that in some cases, the bars are smaller than the size of symbols). Control experiments with strains lacking a prophage resulted in detection of no phage DNA. Significant differences (P,0.05) between WT and DpcnB :: kan strains were detected for all phages. although several transcripts were tested, some common features could be established for all investigated phages and most of the genes assessed. Namely, the majority of tested RNAs were significantly more abundant in the pcnB mutant relative to WT bacteria (at a relatively short time after prophage induction), while PAP I-deficient cells had lower levels of transcripts at later times. Importantly, the differences were severe in the Stx phages, revealing impaired lytic growth in the pcnB host, but moderate in phage l where lytic development was only slightly affected. This strongly suggests that changes in the expression of crucial genes of the Stx bacteriophages are responsible for less efficient lytic growth of these viruses under conditions of deficient RNA polyadenylation. Such a hypothesis is supported by the fact that levels of the N and O gene transcripts are significantly less abundant in the pcnB mutant cells at later times after prophage induction and these genes code for an antitermination protein (responsible for the positive regulation of other genes required for lytic development) and the replication initiator (a protein necessary for phage DNA replication initiation), respectively. In fact, we found that synthesis of all tested Stx phages’ DNA after prophage induction was significantly less in pcnB cells than in WT hosts, indicating that this process can be at least one of the targets of the regulation. Most probably, this effect was indirect, possibly due to impaired Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96 RNA polyadenylation in development of lambdoid phages (b) xis cIII N cI cro cII oop O Q R λ - 80 min wt ΔpcnB xis cIII N cI cro cII oop O Q R 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 xis cIII N 1400 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 cI cro cII oop O Q R φ24B - 60 min wt ΔpcnB xis cIII N cI cro cII oop O Q R φ24B - 80 min wt ΔpcnB xis cIII N cI cro cII oop O Q Relative quantification results (E-Method) Relative quantification results (E-Method) R λ - 60 min wt ΔpcnB Relative quantification results (E-Method) 1400 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 Q φ24B - 40 min wt ΔpcnB R 110 100 90 80 70 60 50 40 30 20 10 0 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 933W - 40 min wt ΔpcnB xis cIII N 1400 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 cI cro cII oop O Q R 933W - 60 min wt ΔpcnB Relative quantification results (E-Method) cI cro cII oop O (c) 110 100 90 80 70 60 50 40 30 20 10 0 xis cIII N cI cro cII oop O Q R 933W - 80 min wt ΔpcnB Relative quantification result (E-Method) xis cIII N Relative quantification results (E-Method) 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0 λ - 40 min wt ΔpcnB Relative quantification results (E-Method) 110 100 90 80 70 60 50 40 30 20 10 0 Relative quantification results (E-Method) Relative quantification results (E-Method) (a) xis cIII N cI cro cII oop O Q R Fig. 4. Levels of transcripts of the indicated genes of l, W24B and 933W bacteriophages, assessed by RT-qPCR analysis, at various times (40, 60 and 80 min) after prophage induction with 1 mg mitomycin C ml”1, in otherwise isogenic E. coli WT (open columns) or DpcnB :: kan (closed columns) host cells. The sample at the time point ‘zero’ was used as a calibrator (all presented quantities are expressed as n-fold difference relative to the calibrator minus an untreated control sample; in fact, values for untreated samples were close to zero, and all calibrator values were similar and low). Statistical analysis (Student’s t-test) was performed for results from each time point and indicated significant differences (P,0.05) between expression of most genes in WT (pcnB+) and DpcnB :: kan hosts for tested phages. For a clear presentation, asterisks representing P values are not marked. Differences in levels of expression of the following genes of tested phages (WT versus DpcnB :: kan hosts) did not reach significance in the t-test (P.0.05): l papa at 60 min: cI, O, Q, R; at 80 min: cI, cII, Q; w24B at 40 min: cI; at 60 min: cI; at 80 min: cI, R; 933W at 60 min: cI, cro, xis, Q, R. Results are presented as mean values from three independent experiments with error bars indicating SD. expression of the O gene. Importantly, replication of phage l DNA was only slightly slowed down in PAP Ideficient cells and abundance of mRNA for the O gene was similar in WT and DpcnB strains, corroborating the above assumptions. Investigating the mechanism by which defects in RNA polyadenylation affect expression of many viral genes in a coordinated manner at different times after prophage induction, we have found that growth rates of lysogenic strains (both WT and DpcnB) temporarily decreased following induction with mitomycin C. This phenomenon was not observed in non-lysogenic bacteria. Since expreshttp://vir.sgmjournals.org sion of pcnB is growth-rate-dependent, being significantly higher in slow growing cells (Jasiecki & We˛grzyn, 2003), we supposed that a transient production of PAP I may occur in lysogenic cells after prophage induction. Testing this possibility, we found the level of the pcnB mRNA increased dramatically shortly after prophage induction (up to 20 min) in WT bacteria, while at the same time this increase was transient, as it was abolished during the next 20 min. Again, such a phenomenon was not observed in nonlysogenic cells. Based on these results, we propose the following hypothesis: decreased bacterial growth rate, arising from the induction- Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1963 D. Nowicki and others related stress conditions, enhances pcnB expression and thus, more efficient polyadenylation of various transcripts. In fact, it was demonstrated that transcripts derived from over 90 % of ORFs are polyadenylated in E. coli (O’Hara et al., 1995; Mohanty & Kushner, 2006). However, among all RNA molecules appearing due to transcription of a particular gene, only some are polyadenylated, thus, a fraction as small as 2 % of total RNA molecules undergoes this modification under standard laboratory growth conditions (Sarkar et al., 1978). Therefore, enhanced polyadenylation (occurring shortly after prophage induction) can lead to more efficient degradation of transcripts in the WT strain. On the other hand, this cannot occur in the DpcnB strain, resulting in a higher abundance of a large fraction of tested (phage-derived) transcripts in the mutant host relative to WT bacteria. At later times (over 40 min) after prophage induction, the level of PAP I in WT cells decreased, thus, most RNA molecules would not be polyadenylated, while polyadenylation of specific RNAs could be highly predominant over low level polyadenylation of many transcripts. There are both experimental results and theoretical analyses suggesting that such a specificity or preference might be characteristic to tRNA and sRNA species (Mohanty et al., 2012; Mohanty & Kushner, 2013; Régnier & Hajnsdorf, 2013). If putative sRNAs, involved in the control of phage gene expression, were preferentially polyadenylated their stability could be affected resulting in weak negative effects on the abundance of phage transcripts in WT cells but in more effective degradation in pcnB mutants. Although oop RNA is the only polyadenylated short regulatory transcript specifically affecting lambdoid phage development reported to date (Wróbel et al., 1998), results from a recent study suggest that phageencoded sRNAs may be significantly more abundant. Namely, global genomic analysis indicated that one of the prophages present in EHEC encodes 55 potential candidates for such RNA species (Tree et al., 2014). METHODS Bacterial strains and bacteriophages. E. coli MG1655 strain (Jensen, 1993) and its isogenic DpcnB :: kan derivative (Masters et al., 1993; Wróbel et al., 1998) were used in this study. The following bacteriophages were used: l (papa), W24B (Dstx2 :: cat) (Allison et al., 2003), 933WDtox (Dstx2 :: catGFP), 22Dtox (Dstx2 :: catGFP), 27Dtox (Dstx2 :: catGFP) and 32Dtox (Dstx2 :: catGFP); derivatives of phages 933W, 22, 27 and 32 were described previously (Gamage et al., 2004), they are devoid of the toxin genes (due to a safety concern) but have all other features of the original phages with cat and/or GFP markers; these are referred to as W24B, 933W, P22, P27 and P32, respectively, in the text. Media and growth conditions. Bacteria were routinely cultured in the Luria-Bertani (LB) medium, supplemented with 10 mM CaCl2 and 10 mM MgSO4. Where appropriate, the following antibiotics were added: up to 20 mg chloramphenicol ml21 and/or up to 50 mg kanamycin ml21. The same broth, supplemented with 1.5 % (w/v) bacteriological agar, was used as a bottom agar for pouring plates. Top agar consisted of 1 % (w/v) tryptone, 0.5 % (w/v) NaCl and 0.7 % (w/v) bacteriological agar. Cultures were grown and phage infections were carried out at 37 uC under aerobic conditions. 1964 Efficiency of lysogenization. To estimate the efficiency of lysogenization, we used the procedure described in detail previously (Nowicki et al., 2013), with slight modifications. Briefly, host bacteria were cultured to A600 1.0 in LB medium supplemented with MgSO4 and CaCl2 (to final concentrations of 10 mM each) at 37 uC with shaking. Cultures were washed with twice with TMC buffer (10 mM Tris/HCl pH 7.2, 10 mM MgSO4 and 10 mM CaCl2) and cells were suspended in the same buffer. Different m.o.i. values (m.o.i of 1, 5 or 10) were used for cell infection. Mixtures of bacteria and phages were incubated in TMC buffer for 30 min at 30 uC, then one-half of each mixture was spread on a LB agar plate and the second half on LB agar plates containing 20 mg chloramphenicol ml21(except for lpapa). Efficiency of lysogenization was calculated as a fraction of lysogens (all PCR-tested chloramphenicol-resistant colonies were lysogens) among all bacterial cells (determined on the basis of number of colonies appearing on LB agar plates with no antibiotic). The following primers were used in these tests: catR, 59-GCATTCTGCCGACATGGAAG; catF 59-CACTGGATATACCACCGTTG; gfpR, 59GGTCTGCTAATTGAACGCTTCC and gfpF, 59-CATGGCCAACACTTGTCACTAC (catR and catF are complementary to fragments of the cat gene and gfpR and gfpF are complementary to fragments of the GFP gene). The length of the specific reaction product was 599 bp for cat and 375 bp for GFP. The presence of each prophage was confirmed by the prophage induction assay. Lysogens of bacteriophage l were tested by PCR (among 10–30 % of survivors) with the following primers (complementary to fragments of the cro gene): croF, 59 ATGCGGAAGAGGTAAAGCCC; croR, 59-TGGAATGTGTAAGAGCGGGG (product length 74 bp) and confirmed by the prophage induction assay. One-step growth experiments. Lytic development of lambdoid phages was studied in one step growth experiments in phage-infected bacteria, as described previously (Nowicki et al., 2013). Briefly, bacteria were grown in LB medium supplemented with MgSO4 and CaCl2 (to a final concentration of 10 mM each) at 37 uC to A600 0.2. The phage was added at an m.o.i. of 0.1. Unadsorbed phages were removed by double washing in TMC buffer. The number of phageinfected bacterial cells (infection centres) was determined at times between 0 and 10 min after infection. Culture samples were withdrawn, 0.1 ml of each serial dilution and mixed with 0.3 ml of an overnight culture of E. coli strain MG1655, 3 ml of top agar (prewarmed to 45 uC) was added, mixed and poured onto an LB plate. Plates were incubated overnight at 37 uC and the number of plaques was determined [infected cells were ‘infection centres’ (ICs) as they were sources of viruses, which after one lytic developmental cycle could be released from host cells and after infection of neighbouring cells subsequent lytic cycles could form plaques on a bacterial lawn]. Samples withdrawn at later times (10 min and later) were treated with an equal volume of chloroform and titrated to determine the number of p.f.u. Results were calculated as a ratio of phage titre to the titre of ICs, thus the numbers in the figures represent the burst size (number of progeny phages per one infected cell). Phage lytic development after prophage induction. Prophage induction experiments were performed as described previously (Nowicki et al., 2013). Phage lytic development was provoked in lysogenic bacteria, growing at 37 uC in LB medium at A600 0.2, by addition of 1 mg mitomycin C ml21. The relative phage titre, expressed as p.f.u. ml21, was calculated by subtracting the mean value in the control experiment (without an inducer, which allows estimation of effects of spontaneous prophage induction) from the mean value determined in the main experiment. Estimation of phage DNA synthesis efficiency. Samples of bacterial culture were withdrawn at indicated times after prophage induction. Bacteriophage DNA was isolated and separated as described previously (Nejman et al., 2009; Nowicki et al., 2013) and quantified by staining with Quant-iT PicoGreen dsDNA (Invitrogen), according to Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96 RNA polyadenylation in development of lambdoid phages Table 2. Generation times of lysogenic and non-lysogenic WT and DpcnB :: kan strains before and at different times after treatment with 1 mg mitomycin C ml”1 Bacteria lysogenic for different phages gave very similar results (with no statistically significant differences), therefore, the presented values concern all lysogens. Results are presented as mean±SD from three independent experiments. Statistically significant (P,0.05 in Student’s t-test) differences were found only between values indicated by asterisks and other values (but not between both values marked by asterisks). Strain Generation time (min) Before induction WT 25±1 25±1 28±1 28±1 DpcnB :: kan WT (lysogen) DpcnB :: kan (lysogen) Relative quantification results (E-Method) 2.0 20 min *** 1.8 40 min 1.6 60 min *** 1.4 80 min 1.2 ** 1.0 0.8 0.6 0.4 0.2 0.0 MG1655 (WT) MG1655 (λ) MG1655 (φ24B) MG1655 (933W) Fig. 5. Expression patterns of pcnB gene of WT E. coli strain MG1655 and its lysogens of bacteriophage l, w24B and 933W, assessed by RT-qPCR analysis, after treatment of bacterial cells with 1 mg mitomycin C ml”1. Levels of transcripts corresponding to pcnB gene were determined at the following times: 20 (white columns), 40 (black columns), 60 (dark grey columns) and 80 min (grey columns). The sample at the time point ‘zero’ was used as a calibrator (all presented quantities are expressed as n-fold difference relative to the calibrator minus an untreated control sample; in fact, values for untreated samples were close to zero, and all calibrator values were similar and low). Statistical analysis (Student’s t-test) was performed for results from each time point and indicated significant differences P¡0.01 (**) and P¡0.001 (***) between pcnB gene expression in WT E. coli strain MG1655 and its lysogens. Differences in levels of pcnB gene expression of tested lysogens (WT versus lysogens) at 40 and 60 min did not reach significance in the t-test (P.0.05). The results presented are mean values from three independent experiments with error bars indicating SD. manufacturer’s instructions. Concentration of phage DNA (ng ml21) was calculated relative to l DNA standards of known concentrations and stained under the same conditions as the tested DNA. http://vir.sgmjournals.org Between 0 and 40 min after induction Between 40 and 80 min after induction 24±2 24±2 35±1* 35±2* 24±1 25±2 29±2 29±2 Preparation of RNA and cDNA from bacteria. For the preparation of RNA, the induction of prophages W24B, 933W and l from E. coli MG1655 or MG1655DpcnB :: kan was performed with 1 mg mitomycin C ml21 (Sigma Aldrich) as described above. To inhibit the growth of bacteria, all samples were treated with 10 mM NaN3 (Sigma Aldrich). Total RNA was isolated from 16109 bacterial cells using the High Pure RNA Isolation kit (Roche). The TURBO DNA-free kit (Life Technologies) was used to remove contaminating DNA from purified RNA to a level that is mathematically insignificant for RT-qPCR. RNA preparations were digested with TURBO DNase for 60 min at 37 uC. The total RNA isolated was quantified by staining with Qubit RNA BR Assay kit (Invitrogen) and Qubit 2.0 Fluorometer (Life Technologies), which provides an accurate and selective method for quantification of high-abundance RNA samples. The band patterns of total RNA were also visualized by electrophoresis. Absence of DNA from RNA samples was verified by PCR amplification and by RTqPCR amplification of all genes tested. RNA samples were stored at 280 uC. Preparation of cDNA from the total RNA (1.25 mg) was performed with Transcriptor Reverse Transcriptase and random hexamer primers (Roche), according to the manufacturer’s instructions. All cDNA reaction mixtures were diluted tenfold for use in RT-qPCR. Real-time PCR. Gene expression was determined by RT-qPCR essentially as described previously (Bloch et al., 2014). All experiments were performed with the LightCycler 480 Real-Time PCR System (Roche), using cDNA samples from lysogenic bacteria. Steady-state levels of transcripts of W24B, 933W and l genes were compared in parallel to the 16S rRNA, according to a procedure described by Strauch et al., (2008), and it was found to be stable. Primers, presented in Table 3, were developed by Primer3web (version 4) and produced by Sigma Aldrich or GENOMED. Real-time PCR amplifications were carried out for 55 cycles in a 20 ml reaction using LightCycler 480 SYBR Green I Master (Roche) as a fluorescent detection dye. All reactions were performed in Roche 96-well plates. For each reaction, 10 ml of 26 SYBR Green I Master Mix, 6.25 ng cDNA ml21 and 200 nM of each gene-specific primer (Table 3) were mixed and supplemented with water to a final volume of 20 ml. Relative quantification assays were performed with cDNA relative to 16S rRNA and phage gene multiplex assay. Parameters for RT-qPCR were as follows: initial incubation at 95 uC for 5 min, followed by 55 cycles of 95 uC for 10 s, 60 uC for 15 s and 72 uC for 15 s. Specificity of amplified products was examined by melting curve analysis immediately after the final PCR cycle and confirmed by gel electrophoresis. Each experiment was repeated three times. Real-time PCR data analysis. The relative changes in gene expression, revealed by quantitative real-time PCR experiments, Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1965 D. Nowicki and others Table 3. cont. Table 3. Primers used in real-time PCR Primer name pF_W24B_xis pR_W24B_xis pF_W24B_cIII pR_W24B_cIII pF_W24B_N pR_W24B_N pF_W24B_cI pR_W24B_cI pF_W24B_cro pR_W24B_cro pF_W24B_cII pR_W24B_cII pF_W24B_oop pR_W24B_oop pF_W24B_O pR_W24B_O pF_W24B_Q pR_W24B_Q pF_W24B_R pR_W24B_R pF_933W_xis pR_933W_xis pF_933W_cIII pR_933W_cIII pF_933W_N pR_933W_N pF_933W_cI pR_933W_cI pF_933W_cro pR_933W_cro pF_933W_cII pR_933W_cII pF_933W_oop pR_933W_oop pF_933W_O pR_933W_O pF_933W_Q pR_933W_Q pF_933W_R pR_933W_R pF_l_xis pR_ l_xis pF_l_cIII pR_ l_cIII pF_l_N pR_ l_N pF_l_cI pR_ l_cI pF_l_cro pR_ l_cro pF_l_cII pR_ l_cII pF_l_oop pR_ l_oop pF_l_O pR_ l_O 1966 Sequence (5§ to 3§) TATCGCGCCGGATGAGTAAG CGCACAGCTTTGTATAATTTGCG ATTCTTTGGGACTCCTGGCTG GTAAATTACGTGACGGATGGAAAC AGGCGTTTCGTGAGTACCTT TTACACCGCCCTACTCTAAGC TGCTGTCTCCTTTCACACGA GCGATGGGTGGCTCAAAATT CGAAGGCTTGTGGAGTTAGC GTCTTAGGGAGGAAGCCGTT TGATCGCGCAGAAACTGATTTAC GACAGCCAATCATCTTTGCCA TGCAAGACCGAGCGTTCT CGCATATAATTACCTCGTTGGATG AAGCGAGTTTGCCACGAT GAACCCGAACTGCTTACCG GGGAGTGAGGCTTGAGATGG TACAGAGGTTCTCCCTCCCG GGGTGGATGGTAAGCCTGT TAACCCGGTCGCATTTTTC CTGTCCCTGGCGCGTAATAT GGTAACACTGGAGCTTTTAATGGC ATTCTTTGGGACTCCTGGCTG GTAAATTACGTGACGGATGGAAAC AGGCGTTTCGTGAGTACCTT TTACACCGCCCTACTCTAAGC TGCTGTCTCCTTTCACACGA GCGATGGGTGGCTCAAAATT CGAAGGCTTGTGGAGTTAGC GTCTTAGGGAGGAAGCCGTT TGATCGCGCTGAAACTGATTTAC GACAGCCAATCATCTTTGCCA GCCGGGGACTCTAAGCAA GATTGATCCAGTAATTCCCTCAGA AATTCTGGCGAATCCTCTGA GAATTGCATCCGGTTT GGGAGTGAGGCTTGAGATGG TACAGAGGTTCTCCCTCCCG GGGTGGATGGTAAGCCTGT TAACCCGGTCGCATTTTTC TACCGCTGATTCGTGGAACA GGGTTCGGGAATGCAGGATA ATTCTTTGGGACTCCTGGCTG GTAAATTACGTGACGGATGGAAAC CTCGTGATTTCGGTTTGCGA AAGCAGCAAATCCCCTGTTG ACCTCAAGCCAGAATGCAGA CCAAAGGTGATGCGGAGAGA ATGCGGAAGAGGTAAAGCCC TGGAATGTGTAAGAGCGGGG TCGCAATGCTTGGAACTGAGA CCCTCTTCCACCTGCTGATC GCAACCGAGCGTTCTGAA GATAGATCCAGTAATGACCTCAGA AATTCTGGCGAATCCTCTGA GAATTGCATCCGGTTT Primer name pF_l_Q pR_ l_Q pF_l_R pR_ l_R pF_E.coli_pcnB pR_E.coli_pcnB pF_E.coli_16SrRNA pR_ E.coli_16SrRNA Sequence (5§ to 3§) TTCTGCGGTAAGCACGAAC TGCATCAGATAGTTGATAGCCTTT ATCGACCGTTGCAGCAATA GCTCGAACTGACCATAACCAG AGCCAGACGGAAACGGC ACCACTAACGCCACGCC CCTTACGACCAGGGCTACAC TTATGAGGTCCGCTTGCTCT were analysed using the calibrator normalized relative quantification method with efficiency correction, the so-called E-Method. The EMethod produces more accurate relative quantification data because it can compensate for differences in target and reference gene amplification efficiency either within an experiment or between experiments. This method provides an efficiency corrected calculation mode by using the determined PCR efficiency of target (Et) as well as the efficiency of reference (Er). Relative fold change ratio was calculated using the following formula, described in the application manual of Roche LightCycler Real-Time PCR Systems: Normalized relative ratio5Et CT(t) calibrator2CT(t) sample/Er CT(r) calibrator2CT(r) sample (where ‘t’ is target and ‘r’ is reference). The sample at the time point ‘zero’ was used as a calibrator. The raw run data for W24B, 933W and l genes were transferred from the LightCycler 480 to the LinRegPCR 12.5 software using the ‘LC480 Conversion: conversion of raw LC480 data’ software (available at http://www.hartfaalcentrum.nl/index. php?main=files&sub=0). PCR efficiency was determined for each gene by LinRegPCR program (Ramakers et al., 2003; Ruijter et al., 2009). This software was successfully used previously to calculate PCR efficiency (Čikoš et al., 2007; Feng et al., 2008; Regier & Frey, 2010; Aglawe et al., 2012, Borges et al., 2012). Statistical analysis. For each experiment, data from independently replicated experiments (each experiment was repeated at least three times) were pooled and analysed using STATISTICA (StatSoft). Variation among replicates was used as the error term. Data comparisons were made by using a paired Student’s t-test. Differences were considered significant when P,0.05. ACKNOWLEDGEMENTS The authors thank Dr Katarzyna Potrykus for critical reading of the manuscript. This work was supported by the National Science Center, Poland (grant no. N N301 192439 to A. W.) and Foundation for Polish Science (grant no. VENTURES/2012-9/7 to D. N.). Studies by D. N., S. B. and B .N. -F. were supported by the European Social Fund as a part of the project ‘Educators for the elite-integrated training program for PhD students, post-docs and Professors as academic teachers at University of Gdansk’ within the framework of the Human Capital Operational Programme, Action 4.1.1, improving the quality of educational offer of tertiary education institutions. S. B. acknowledges support from the European Social Fund, the State Budget and the Pomorskie Voivodeship Budget according to the Operational Programme Human Capital, Priority VIII, Action 8.2, Underaction 8.2.2: ‘Regional Innovation Strategy’ within the system project of the Pomorskie Voivodeship ‘InnoDoktorant – Scholarships for PhD students, VIth edition’. The authors declare no conflict of interest. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96 RNA polyadenylation in development of lambdoid phages REFERENCES Aglawe, S. B., Fakrudin, B., Patole, C. B., Bhairappanavar, S. B., Koti, R. V. & Krishnaraj, P. U. (2012). Quantitative RT-PCR analysis of 20 Jasiecki, J. & We˛grzyn, G. (2006). Transcription start sites in the promoter region of the Escherichia coli pcnB (plasmid copy number) gene coding for poly(A) polymerase I. Plasmid 55, 169–172. Jensen, K. F. (1993). The Escherichia coli K-12 ‘‘wild types’’ W3110 transcription factor genes of MADS, ARF, HAP2, MBF and HB families in moisture stressed shoot and root tissues of sorghum. Physiol Mol Biol Plants 18, 287–300. and MG1655 have an rph frameshift mutation that leads to pyrimidine starvation due to low pyrE expression levels. J Bacteriol 175, 3401–3407. Allison, H. E. (2007). Stx-phages: drivers and mediators of the Johnson, M. D., Popowski, J., Cao, G. J., Shen, P. & Sarkar, N. (1998). evolution of STEC and STEC-like pathogens. Future Microbiol 2, 165– 174. Bacteriophage T7 mRNA is polyadenylated. Mol Microbiol 27, 23–30. Allison, H. E., Sergeant, M. J., James, C. E., Saunders, J. R., Smith, D. L., Sharp, R. J., Marks, T. S. & McCarthy, A. J. (2003). Immunity profiles of wild-type and recombinant shiga-like toxin-encoding bacteriophages and characterization of novel double lysogens. Infect Immun 71, 3409–3418. Beutin, L. & Martin, A. (2012). Outbreak of Shiga toxin-producing Escherichia coli (STEC) O104:H4 infection in Germany causes a paradigm shift with regard to human pathogenicity of STEC strains. J Food Prot 75, 408–418. Binns, N. & Masters, M. (2002). Expression of the Escherichia coli Karch, H., Denamur, E., Dobrindt, U., Finlay, B. B., Hengge, R., Johannes, L., Ron, E. Z., Tønjum, T., Sansonetti, P. J. & Vicente, M. (2012). The enemy within us: lessons from the 2011 European Escherichia coli O104:H4 outbreak. EMBO Mol Med 4, 841–848. Klovins, J., van Duin, J. & Olsthoorn, R. C. (1997). Rescue of the RNA phage genome from RNase III cleavage. Nucleic Acids Res 25, 4201– 4208. Łoś, J. M., Loś, M., We˛grzyn, G. & We˛grzyn, A. (2009). Differential efficiency of induction of various lambdoid prophages responsible for production of Shiga toxins in response to different induction agents. Microb Pathog 47, 289–298. pcnB gene is translationally limited using an inefficient start codon: a second chromosomal example of translation initiated at AUU. Mol Microbiol 44, 1287–1298. Łoś, J. M., Loś, M. & We˛grzyn, G. (2011). Bacteriophages carrying Bloch, S. K., Felczykowska, A. & Nejman-Faleńczyk, B. (2012). Łoś, J. M., Loś, M., We˛grzyn, A. & We˛grzyn, G. (2012). Altruism of Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteria. Future Microbiol 6, 909–924. Escherichia coli O104:H4 outbreak – have we learnt a lesson from it? Acta Biochim Pol 59, 483–488. Shiga toxin-producing Escherichia coli: recent hypothesis versus experimental results. Front Cell Infect Microbiol 2, 166. Bloch, S., Nejman-Faleńczyk, B., Dydecka, A., Łoś, J. M., Felczykowska, A., We˛grzyn, A. & We˛grzyn, G. (2014). Different Masters, M., Colloms, M. D., Oliver, I. R., He, L., Macnaughton, E. J. & Charters, Y. (1993). The pcnB gene of Escherichia coli, which is expression patterns of genes from the exo-xis region of bacteriophage l and Shiga toxin-converting bacteriophage W24B following infection or prophage induction in Escherichia coli. PLoS ONE 9, e108233. Borges, A., Tsai, S. M. & Caldas, D. G. (2012). Validation of reference genes for RT-qPCR normalization in common bean during biotic and abiotic stresses. Plant Cell Rep 31, 827–838. Briani, F., Del Vecchio, E., Migliorini, D., Hajnsdorf, E., Régnier, P., Ghisotti, D. & Dehò, G. (2002). RNase E and polyadenyl polymerase I are involved in maturation of CI RNA, the P4 phage immunity factor. J Mol Biol 318, 321–331. Cao, G.-J. & Sarkar, N. (1992). Identification of the gene for an Escherichia coli poly(A) polymerase. Proc Natl Acad Sci U S A 89, 10380–10384. Čikoš, S., Bukovská, A. & Koppel, J. (2007). Relative quantification required for ColE1 copy number maintenance, is dispensable. J Bacteriol 175, 4405–4413. Mauro, S. A. & Koudelka, G. B. (2011). Shiga toxin: expression, distribution, and its role in the environment. Toxins (Basel) 3, 608– 625. Mellmann, A., Harmsen, D., Cummings, C. A., Zentz, E. B., Leopold, S. R., Rico, A., Prior, K., Szczepanowski, R., Ji, Y. & other authors (2011). Prospective genomic characterization of the German enterohemorrhagic Escherichia coli O104:H4 outbreak by rapid next generation sequencing technology. PLoS ONE 6, e22751. Mohanty, B. K. & Kushner, S. R. (2000). Polynucleotide phosphorylase functions both as a 39A59 exonuclease and a poly(A) polymerase in Escherichia coli. Proc Natl Acad Sci U S A 97, 11966–11971. of mRNA: comparison of methods currently used for real-time PCR data analysis. BMC Mol Biol 8, 113. Mohanty, B. K. & Kushner, S. R. (2006). The majority of Escherichia coli mRNAs undergo post-transcriptional modification in exponentially growing cells. Nucleic Acids Res 34, 5695–5704. Feng, J., Zeng, R. & Chen, J. (2008). Accurate and efficient data Mohanty, B. K. & Kushner, S. R. (2011). Bacterial/archaeal/organellar processing for quantitative real-time PCR using a tripartite plant virus as a model. Biotechniques 44, 901–912. Gamage, S. D., Patton, A. K., Hanson, J. F. & Weiss, A. A. (2004). Diversity and host range of Shiga toxin-encoding phage. Infect Immun 72, 7131–7139. Goodrich, A. F. & Steege, D. A. (1999). Roles of polyadenylation and nucleolytic cleavage in the filamentous phage mRNA processing and decay pathways in Escherichia coli. RNA 5, 972–985. Gyles, C. L. (2007). Shiga toxin-producing Escherichia coli: an polyadenylation. Wiley Interdiscip Rev RNA 2, 256–276. Mohanty, B. K. & Kushner, S. R. (2013). Deregulation of poly(A) polymerase I in Escherichia coli inhibits protein synthesis and leads to cell death. Nucleic Acids Res 41, 1757–1766. Mohanty, B. K., Maples, V. F. & Kushner, S. R. (2004). The Sm-like protein Hfq regulates polyadenylation dependent mRNA decay in Escherichia coli. Mol Microbiol 54, 905–920. Mohanty, B. K., Maples, V. F. & Kushner, S. R. (2012). overview. J Anim Sci 85 (Suppl), E45–E62. Polyadenylation helps regulate functional tRNA levels in Escherichia coli. Nucleic Acids Res 40, 4589–4603. Hunt, J. M. (2010). Shiga toxin-producing Escherichia coli (STEC). Clin Lab Med 30, 21–45. Nadratowska-Wesołowska, B., Słomińska-Wojewódzka, M., Łyzeń, R., We˛grzyn, A., Szalewska-Pałasz, A. & We˛grzyn, G. (2010). Jasiecki, J. & We˛grzyn, G. (2003). Growth-rate dependent RNA Transcription regulation of the Escherichia coli pcnB gene coding for poly(A) polymerase I: roles of ppGpp, DksA and sigma factors. Mol Genet Genomics 284, 289–305. polyadenylation in Escherichia coli. EMBO Rep 4, 172–177. http://vir.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 1967 D. Nowicki and others Nejman, B., Loś, J. M., Łoś, M., We˛grzyn, G. & We˛grzyn, A. (2009). Plasmids derived from lambdoid bacteriophages as models for studying replication of mobile genetic elements responsible for the production of Shiga toxins by pathogenic Escherichia coli strains. J Mol Microbiol Biotechnol 17, 211–220. Nejman-Faleńczyk, B., Golec, P., Macia˛g, M., Wegrzyn, A. & We˛grzyn, G. (2012). Inhibition of development of Shiga toxin-converting Riley, L. M., Veses-Garcia, M., Hillman, J. D., Handfield, M., McCarthy, A. J. & Allison, H. E. (2012). Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage W24B. BMC Microbiol 12, 42. Ruijter, J. M., Ramakers, C., Hoogaars, W. M. H., Karlen, Y., Bakker, O., van den Hoff, M. J. B. & Moorman, A. F. M. (2009). Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res 37, e45. bacteriophages by either treatment with citrate or amino acid starvation. Foodborne Pathog Dis 9, 13–19. Sarkar, N., Langley, D. & Paulus, H. (1978). Isolation and Nejman-Faleńczyk, B., Bloch, S., Licznerska, K., Felczykowska, A., Dydecka, A., We˛grzyn, A. & We˛grzyn, G. (2015). Small regulatory characterization of polyadenylate-containing RNA from Bacillus brevis. Biochemistry 17, 3468–3474. RNAs in lambdoid bacteriophages and phage-derived plasmids: not only antisense. Plasmid. doi:10.1016/j.plasmid.2014.07.006 [Epub ahead of print]. Strauch, E., Hammerl, J. A., Konietzny, A., Schneiker-Bekel, S., Arnold, W., Goesmann, A., Pühler, A. & Beutin, L. (2008). Nowicki, D., Kobiela, W., We˛grzyn, A., Wegrzyn, G. & SzalewskaPałasz, A. (2013). ppGpp-dependent negative control of DNA Bacteriophage 2851 is a prototype phage for dissemination of the Shiga toxin variant gene 2c in Escherichia coli O157:H7. Infect Immun 76, 5466–5477. replication of Shiga toxin-converting bacteriophages in Escherichia coli. J Bacteriol 195, 5007–5015. Szalewska-Pałasz, A., Wróbel, B. & Wegrzyn, G. (1998). Rapid O’Hara, E. B., Chekanova, J. A., Ingle, C. A., Kushner, Z. R., Peters, E. & Kushner, S. R. (1995). Polyadenylylation helps regulate Tree, J. J., Granneman, S., McAteer, S. P., Tollervey, D. & Gally, D. L. (2014). Identification of bacteriophage-encoded anti-sRNAs in mRNA decay in Escherichia coli. Proc Natl Acad Sci U S A 92, 1807–1811. pathogenic Escherichia coli. Mol Cell 55, 199–213. degradation of polyadenylated oop RNA. FEBS Lett 432, 70–72. We˛grzyn, G. & We˛grzyn, A. (2005). Genetic switches during edn. Cold Spring Harbour, NY: Cold Spring Harbor Laboratory Press. bacteriophage lambda development. Prog Nucleic Acid Res Mol Biol 79, 1–48. Ramakers, C., Ruijter, J. M., Deprez, R. H. & Moorman, A. F. (2003). We˛grzyn, G., Licznerska, K. & We˛grzyn, A. (2012). Phage l–new Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62–66. insights into regulatory circuits. Adv Virus Res 82, 155–178. Ptashne, M. (2004). A Genetic Switch: Phage Lambda Revisited, 3rd Regier, N. & Frey, B. (2010). Experimental comparison of relative RT-qPCR quantification approaches for gene expression studies in poplar. BMC Mol Biol 11, 57. Régnier, P. & Hajnsdorf, E. (2013). The interplay of Hfq, poly(A) polymerase I and exoribonucleases at the 39 ends of RNAs resulting from Rho-independent termination: a tentative model. RNA Biol 10, 602–609. 1968 Werber, D., Krause, G., Frank, C., Fruth, A., Flieger, A., Mielke, M., Schaade, L. & Stark, K. (2012). Outbreaks of virulent diarrheagenic Escherichia coli – are we in control? BMC Med 10, 11. Wróbel, B., Herman-Antosiewicz, A., Szalewska-Pałasz, S. & Wegrzyn, G. (1998). Polyadenylation of oop RNA in the regulation of bacteriophage lambda development. Gene 212, 57–65. Yonesaki, T. (2002). Scarce adenylation in bacteriophage T4 mRNAs. Genes Genet Syst 77, 219–225. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Fri, 16 Jun 2017 16:03:00 Journal of General Virology 96
© Copyright 2026 Paperzz