Leukemia (2000) 14, 629–635
 2000 Macmillan Publishers Ltd All rights reserved 0887-6924/00 $15.00
www.nature.com/leu
Characterization of a novel negative regulatory element in the human interleukin 4
promoter
S Georas1,2, J Cumberland1, T Burke1, E Park1, S Ono2,3 and V Casolaro2
1
Division of Pulmonary and Critical Care Medicine, and 2Division of Allergy and Clinical Immunology, Johns Hopkins University Asthma
and Allergy Center, Baltimore, MD, USA
Interleukin 4 (IL-4) is a multifunctional cytokine that plays an
important role in hematopoiesis, tumor cell growth, and cellular
immune responses. Expression of the IL-4 gene is tightly controlled at the level of gene transcription, and many positive
regulatory cis-elements have been identified in the proximal IL4 promoter region. Relatively little is known about factors that
downregulate IL-4 transcription. We performed a detailed
deletional analysis of the proximal human IL-4 promoter and
studied reporter gene activity in transiently transfected Jurkat
T lymphoblasts. In this report, we characterize a novel negative
regulatory element (termed P2 NRE) that is adjacent to a binding site for nuclear factor of activated T cells. Mutation of P2
NRE significantly enhanced the activity of a 175 base pair IL-4
promoter construct in transiently transfected Jurkat T lymphoblasts. Using nuclear extracts from Jurkat cells, we identify a
candidate factor (termed Rep-1) that binds uniquely to the P2
NRE in DNA-binding assays. Rep-1 is not related to other factors previously shown to interact with the IL-4 promoter, and
by UV cross-linking and SDS-PAGE analysis, we found that it
migrates with a molecular mass of approximately 150 kDa.
Characterizing the molecular mechanisms responsible for
downregulating the IL-4 promoter should enhance our understanding of IL-4-gene dysregulation in disease states. Leukemia
(2000) 14, 629–635.
Keywords: human; T lymphocytes; allergy; gene regulation;
cytokines
cell lines in vitro,10–14 which has fueled interest in this cytokine as a potential experimental anti-tumor agent.15
IL-4 gene expression is tightly regulated at the level of transcription by multiple transcription factors that bind to ciselements in the upstream proximal promoter (Figure 1).16–28 A
mast cell-specific intronic enhancer and a T cell-specific silencer in the 3⬘-untranslated region have also been
described.29,30 Nuclear factor of activated T cell (NFAT) proteins are thought to enhance IL-4 gene expression by binding
up to five potential sites in the promoter.16,18 These sites,
termed P0 to P4, share a consensus sequence containing a
core NFAT-binding motif: 5⬘GGAAAA3⬘.
Nucleotides surrounding the NFAT-binding core of individual P elements are highly divergent and support the binding
of additional factors. As a result, each P element can be considered an individual transcriptional unit. The P1 element in
particular plays a major role in promoting NFAT-dependent
transactivation.23,25 In contrast, C/EBP (and not NFAT) proteins
Introduction
Interleukin-4 (IL-4), a cytokine produced primarily by activated CD4+ T lymphocytes, plays a central role in immune
and inflammatory reactions. By inducing CD4+ T cell differentiation toward the Th2 phenotype and IgE isotype switching
in B cells,1,2 dysregulated IL-4 expression is thought to contribute to the development of allergic diseases including
asthma.3,4 IL-4 also regulates the differentiation of multiple
blood cell lineages. For example, in the presence of other
growth factors (eg GM-CSF), IL-4 can inhibit the growth of
myeloid progenitors (reviewed in Ref. 5). IL-4 also inhibits
stem cell factor (SCF)-driven mast cell growth from cord blood
cells,6 which is probably mediated by inhibition of c-kit
expression.7 In contrast, IL-4 (together with other growth
factors) can induce the differentiation of dendritic cells from
peripheral blood,8 and is required for the survival of resting T
cells.9 Finally, IL-4 can inhibit the growth of a variety of tumor
Correspondence: SN Georas, The Johns Hopkins Asthma & Allergy
Center, Rm 4B.41, 5501 Hopkins Bayview Circle, Baltimore, MD
21224, USA; Fax: (410) 550–2612
3
Current address: Laboratory of Molecular Immunology, The Schepens
Eye Research Institute, Harvard Medical School, Boston, MA
02114, USA
Received 28 October 1999; accepted 22 November 1999
Figure 1
Schematic diagram of the IL-4 promoter. The Figure is a
compilation of studies of both the human and mouse IL-4 genes, and
is not drawn to scale. Names of the different regulatory elements are
indicated to the left of the Figure, and their corresponding binding
proteins are indicated to the right. Numbers refers to nt upstream from
the transcription start site according to Ref. 32, and in general indicate
the central nucleotide of each defined element. Factors shown to
inhibit IL-4 transcription are indicated in italics. Binding sites for some
factors (eg octamer proteins) are not shown for clarity.
Novel interleukin 4 promoter negative regulatory element
S Georas et al
630
transactivate the IL-4 promoter from the P4 element (or PRE1).31 Additionally, the human P3 element binds NF-Y more
strongly than NFAT proteins due to a CCAAT box just downstream of the NFAT motif.21
To dissect the contribution of each of the P elements in
regulating IL-4 transcription, in this study we performed a
detailed deletion analysis of the human IL-4 promoter using
reporter constructs transiently transfected into Jurkat T lymphoblasts. This led to the identification of a novel negative
regulatory element (NRE) overlapping the P2 NFAT site. NRE
activity localized to the sequence −170TTTCACAGGA−161,
which we term P2 NRE. Here we show that mutation of this
sequence significantly enhances the activity of downstream
activators in transient transfection assays. Using Jurkat nuclear
extracts, we identified a candidate repressor factor that binds
uniquely to P2 NRE and not to other human P elements in
electrophoretic mobility shift assays (EMSA). This factor,
termed Rep-1, has an apparent molecular mass of 苲150 kDa,
and appears to be distinct from other transcription factors previously shown to regulate IL-4 promoter transactivation.
Materials and methods
Plasmid construction
IL-4 promoter constructs were amplified from human genomic
DNA using the polymerase chain reaction (PCR). 25-nucleotide (nt) 5⬘ primers annealing −265, −225, −175, −145, −95,
and −65 base pairs (bp) upstream from the transcription start
site (tss) (according to Ref. 32) were used with a constant 25nt 3⬘ primer ending at position +65. Primers were designed to
delete individual P elements, and incorporated restriction sites
to facilitate subsequent ligation. PCR products were
sequenced using the dideoxy method, and then ligated into
the HindIII and XbaI sites of pCAT Basic (Promega, Madison,
WI, USA). Mutations were introduced into the pCAT175 plasmid at 5 bp intervals using the following mutagenic 5⬘ primers
(mutations in small case): m1: CCAGTAAGCTTgagacTTTCACAGGAACATTTTAC; m2: CCAGTAAGCTTTCTGAgggacCAGGAACATTTTACCTGTT; m3: CCAGTAAGCTTTCTGATTTCA
gctcgACATTTTACCTGTTTG; m4: CCAGTAAGCTTTCTGAT
TTCACAGGActcggTTACCTGTTTGTGAGGCAT.
(Figure 2), or by assaying for CAT enzyme levels using a sensitive ELISA (Roche Molecular, Biochemicals, Indianapolis, IN,
USA). Cell extracts were normalized for protein content using
the Bradford method (Bio Rad) prior to assays for CAT gene
expression.
Electrophoretic mobility shift assays (EMSAs)
The following 30-nt oligonucleotides and their complements
were synthesized (mutations in small case): 5⬘-TCTGATTTCACAGGAACATTTTACCTGTTT-3⬘ (P2 wt −175 to −146); 5⬘gagacTTTCACAGGAACATTTTACCTGTTT-3⬘ (m1); 5⬘-TCTGA
gggacCAGGAACATTTTACCTGTTT-3⬘ (m2); 5⬘-TCTGATTTCA
gctcgACATTTTACCTGTTT-3⬘ (m3); 5⬘-TCTGATTTCACAGGActcggTTACCTGTTT-3⬘ (m4); 5⬘-ATCTGGTGTAACGAAA
ATTTCCAATGTAAAC-3⬘ (P1 −92 to −60). Nuclear extracts
were obtained from 5 × 106 Jurkat cells using the method of
Schreiber et al.34 EMSAs were performed using 5 ␮g nuclear
protein, 0.8 ␮g poly (dG-dC; Pharmacia Biotech, Piscataway,
NJ, USA) and ␥32P end-labeled probe in a final volume of
10 ␮l. Free probes and protein–DNA complexes were
resolved by 5% polyacrylamide gel electrophoresis (PAGE)
with 0.5× Tris-borate EDTA (TBE). In competition experiments,
extracts were pre-incubated for 20 min at room temperature
with 100-fold molar excess of the following commercially
available consensus oligonucleotides: GRE: 5⬘-TCGACTGTACAGGATGTTCTAGCTACT-3⬘; AP1: 5⬘-CGCTTGATGAGT
CAGCCGGAA-3⬘; mutAP1: 5⬘-CGCTTGATGAGTTGGCC
GGAA-3⬘; AP2: 5⬘-GATCGAACTGACCGC CCGCGGCCCGT3⬘; AP3: 5⬘-CTACTGGGACTTTCCACACATC-3⬘; CRE: 5⬘AGAGATTGCCTGACGTCAGAGAGCTAG-3⬘; and mutCRE:
5⬘-AGAGATTGCCTGTGGTCAGAGAGC TAG-3⬘. In antibody
experiments, extracts were incubated at room temperature
with 1 ␮l of the following anti-sera for 30 min after the
addition of labeled probe: anti-NFATp (non-cross reactive
with NFATc, courtesy of Dr A Rao, Harvard University), antiNFATc (7A6, courtesy of Dr G Crabtree, Stanford University),
anti-c-Fos (4–10G, broadly cross-reactive with Fos family
members) and anti-c-Jun (D, broadly cross-reactive with Jun
family members, both from Santa Cruz Biotechnology, Santa
Cruz, CA, USA).
Cell lines and transfections
Jurkat T cells (a gift of Dr Jack Strominger, Harvard University)
were maintained in RPMI 1640 supplemented with 10% heatinactivated fetal calf serum (Life Technologies, Grand Island,
NY, USA) and gentamycin. These cells constitutively express
IL-4 mRNA (not shown). Cells of low passage number (⬍8
weeks) were used in transfection experiments. Cells (3 × 106)
were transfected in duplicate using the lipofectamine method
(Life Technologies) as follows: 5 h incubation, 2 ␮g plasmid
DNA, and 12 ␮g lipofectamine, followed by 48 h culture in
complete medium prior to harvest. The amount of plasmid
DNA resulting in optimal CAT activity was determined for
each reporter construct and centered around 2 ␮g. Cells were
stimulated with 1 ␮m calcium ionophore (A23187; Calbiochem, La Jolla, CA, USA) or DMSO control for the last 18 h
of culture followed by lysis by three freeze–thaw cycles.
Reporter gene expression was determined either by measuring
CAT activity using thin layer chromatography as described33
Leukemia
UV cross-linking
Jurkat nuclear extracts (50 ␮g) were incubated with a double
stranded oligonucleotide encompassing the P2 oligonucleotide in a standard EMSA reaction using 4 ␮g poly (dG-dC),
followed by UV irradiation at 120 000 ␮J/cm2 for 20 min (UV
Crosslinker 1000; Fisher Scientific, Chicago, IL, USA). The
reaction mixture was subject to 5% PAGE with 0.5× TBE, and
analyzed by autoradiography. The portion of the gel corresponding to Rep-1 (see Figures 3–5) was excised, DNA and
protein were eluted, and then analyzed by sodium dodecyl
sulfate (SDS)-PAGE using 5–6% gradient gels, followed by
autoradiography of the fixed and dried gel. The molecular
weight of Rep-1 was estimated by comparing the mobility of
the observed band with radiolabeled molecular weight markers run in parallel, allowing for approximately 19 kDa due to
the radiolabeled 30-bp oligonucleotide.
Novel interleukin 4 promoter negative regulatory element
S Georas et al
631
Figure 2
Detailed deletion analysis of the IL-4 promoter. The indicated constructs were transiently transfected into Jurkat T cells, and promoter
activity was assayed after stimulation with calcium ionophore (1 ␮m A23187 for 18 h) using thin-layer chromatography. The length of promoter
fragments is indicated to the left of each construct (numbers refer to bp upstream from the tss), and the P elements are indicated by shaded
boxes. Results from three experiments performed in duplicate are shown, and expressed as fold-induction over unstimulated reporter constructs.
Identical amounts of plasmid DNA were used in each experiment, and two individual pCAT175 reporter constructs (pCAT175-1 and pCAT1752) were used. Constitutive CAT activity varied between experiments (between 2 and 5% 14C-chloramphenicol transacetylation).
Results
A negative regulatory element is located near the P2
element
IL-4 promoter reporter constructs were transiently transfected
into Jurkat T cells and CAT activity was assayed after 18 h of
cell activation. As we have previously shown, the IL-4 promoter is constitutively active in these cells, and maximal CAT
activity was obtained using a calcium signal alone.33 Figure
2 shows the results of three experiments using a series of
deletion constructs in transient transfection assays. A striking
finding was that constructs beginning 175 bp upstream from
the tss (pCAT 175) were not inducible by a calcium signal,
whereas the addition of 50 bp upstream (pCAT 225) or
deletion of 30 bp (pCAT 145) restored inducibility. Constitutive activity of pCAT175 was also low. This result suggests that
the region between bp −175 and −146 harbors a NRE that is
able to suppress the activity of downstream activators, but is
over-ridden by positive elements further upstream. Additional
combinations of various agonists shown to regulate IL-4 transcription in different experimental systems (including PMA,
PHA and 8Br-cAMP) also failed to induce pCAT 175 (not
shown).
region in EMSA. As shown in Figure 3, six complexes formed
on this oligonucleotide using nuclear extracts obtained from
calcium ionophore activated cells. Using extracts from
unstimulated cells, complex II (subsequently shown to contain
NFATp, see Figure 4) formed with less intensity (not shown).
We next analyzed the sequence specificity of complex formation using a panel of related and unrelated competitor
Several nuclear factors bind the P2 element in
electrophoretic mobility shift assays
Detection of an NRE in this region of the human IL-4 promoter
is a novel finding. This 30 bp stretch (between bp −175 and
−146) contains the P2 NFAT site, which was originally identified based on sequence homology with an NFAT consensus
sequence.18 The mouse P2 element was found to bind NFAT
and AP-1 proteins using nuclear extracts from EL-4 cells in
EMSA.18,27 The human P2 element differs from its mouse
counterpart, and other NFAT sites, within the 3⬘ half of the
recognition element: −163GGAACA−158. Nonetheless, the
human P2 element also supports the binding of NFAT and AP1 using T cell nuclear extracts in EMSA.35 We analyzed the
ability of nuclear proteins isolated from Jurkat cells to interact
with a 30-bp oligonucleotide spanning the −175 to −146
Figure 3
Characterization of the cellular factors that interact with
the P2 oligonucleotide. Nuclear extracts from ionophore-stimulated
Jurkat cells (1 ␮m A23187, 2 h) were analyzed by EMSA. Six complexes (I to VI) formed. Competition analysis using 100-fold molar
excess of unlabeled oligonucleotides is shown (lanes 3–8). Complexes
I and IV are not inhibited by any competitor, whereas complex II
contains NFAT proteins (lane 3).
Leukemia
Novel interleukin 4 promoter negative regulatory element
S Georas et al
632
oligonucleotides in EMSA. Complex II appeared to contain
NFAT proteins since its formation was specifically inhibited
using the high-affinity P1 NFAT site as competitor (Figure 3,
lane 3). This was confirmed using an AP3 oligonucleotide
(lane 6), which also contains an NFAT-like sequence.33 The
formation of complex III was inhibited by oligonucleotides
containing AP-1 and cAMP response element (CRE) consensus
sequences. However, additional competition analysis using
oligonucleotides with mutated AP-1 and CRE motifs also
inhibited its formation (not shown), suggesting that this complex is due largely to non-specific DNA binding. Complex V
was also competed for by the P1 NFAT oligonucleotide (lane
3). Notably, complexes I and IV were not competed for by
any oligonucleotide tested.
Different pattern of complex formation on the P2 and
P1 oligonucleotides
When we compared nuclear factor binding to the P2 oligonucleotide and to a similar length oligonucleotide containing
the P1 sequence, we observed a strikingly different pattern
of binding (Figure 4). One major complex formed on the P1
oligonucleotide which contains predominantly NFATp (lane
7 and Ref. 33). As expected, formation of complex II on the
P2 oligonucleotide was inhibited by anti-NFATp antibodies
(Figure 4, lane 3). Interestingly, this complex was much less
intense and migrated more quickly than the corresponding
NFATp-immunoreactive complex on the P1 probe. We did
not detect NFATc binding to either probe in these experiments
(Figure 4, lanes 4 and 8). Neither complex I nor complex IV
formed on the P1 sequence. Complex III migrated with similar
mobility as a band we had previously determined to be nonspecific on the related P1 oligonucleotide (n.s., Figure 4).
Complex V (which occasionally resolved into two distinct
bands) migrated with similar mobility as two high-mobility
complexes (HMC-I and II) that formed on the P1 probe. The
observation that the P1 probe in particular competed for this
complex (Figure 3, lane 3) suggests that complex V and HMCI/II are related. In previous work, we found that HMC-I and
HMC-II were not inhibited by a panel of unrelated oligonucleotide competitors, and they did not appear to be involved in
the repression of the IL-4 promoter by RelA, which bound
competitively with NFAT in the P1 region.33 Since there are
no other known negative regulatory elements within the P1
region, however, complex V is not a good candidate for a
repressor factor.
Mutational analysis localizes the negative regulatory
element
In order to better define the binding site of possible repressor
factors, mutations were introduced into the pCAT175 plasmid
(Figure 5a) and the inducibility of mutated constructs was
compared to that of wild-type pCAT175 and pCAT145. As
shown in Figure 5, pCAT175 m2 and m3 were significantly
more active than wt (approximately five-fold). Thus, negative
regulatory
activity
localized
to
the
sequence
−170
TTTCACAGGA−161, which we term P2 NRE. Neither construct was as inducible as pCAT145, suggesting that repressor
activity had not been fully abolished. We speculated that
mutants m2 and m3 disrupted the binding of a transcriptional
repressor and allowed greater inducibility of downstream
enhancer elements. To test this hypothesis, we used mutated
30-bp P2 oligonucleotides in EMSA, and reasoned that a
repressor factor would not readily bind the m2 and m3 oligonucleotides. As shown in Figure 6, the formation of complex I
was inhibited on both the m2 and m3 oligonucleotide probes.
Note that a similar complex did not form on the P1 probe
(Figure 4), nor on similar length oligonucleotide probes
including the other human P elements (Burke T and Georas
S, unpublished observations). Thus, complex I is a good candidate for a repressor factor and will be subsequently referred
to as Rep-1. In additional experiments using nuclear extracts
obtained from peripheral blood T cells as well as from a pair
Figure 4
A comparison of nuclear factor binding to the similar length oligonucleotide probes including the P2 (lanes 1–4) and P1 (lanes 5–
8) elements. Experiments were carried out in parallel using identical reaction conditions and exposure times. As expected, complex II was
inhibited by anti-serum specific for NFATp (lane 3), but unaffected by control serum (lane 2). The P1 NFATp-specific complex formed with
much greater intensity and slower mobility than the corresponding complex on the P2 oligonucleotide (lanes 5–8). Two high-mobility complexes
(HMC-I and HMC-II) forming on this oligonucleotide have been previously described.33 n.s. denotes non-specific.
Leukemia
Novel interleukin 4 promoter negative regulatory element
S Georas et al
633
Figure 5
Mutational analysis of the of the −175 to −146 region of
the human IL-4 promoter. (a) Mutations were introduced into
pCAT175 at 5 bp intervals as indicated (dashed line indicates identity
to wild type (wt). Each mutated construct began at −175 and ended
at +65. (b) Constructs m2 and m3 were consistently more active than
wt. Mutated constructs were transiently transfected into Jurkat cells
and CAT activity was measured in unstimulated cells (open bars) and
after stimulation with calcium ionophore (closed bars) as described
in Materials and methods. Data are the mean ± s.e.m. of four independent experiments and expressed relative to the activity of pCAT
145 in parallel samples. Dashed line indicates activity of wild-type
pCAT 175, and asterisk indicates P ⬍ 0.05 using the Wilcoxon signedrank test.
of allergen-specific Th1 and Th2 clones (courtesy of Dr David
Essayan, Johns Hopkins Asthma & Allergy Center) in EMSA,
we found that a band of similar mobility as Rep-1 was equally
expressed in all samples (not shown). Thus, Rep-1 expression
does not appear to be restricted to the leukemic Jurkat cell
line.
As expected, NFATp did not bind to the m3 and m4 oligonucleotides, consistent with the disruption of the core NFAT
site by these mutations (Figure 6). Interestingly, NFATp bound
with higher affinity to the m2 probe, suggesting that Rep-1
may act in part by competing for NFATp binding. Note, however, that pCAT175 m3, which binds neither NFATp nor Rep1 (Figure 6), is also more active than wt suggesting that the
major reason for the increased activity of m2 and m3 is
diminished Rep-1 binding.
Figure 6
Characterization of cellular factor binding to wild-type
and mutated oligonucleotide probes. Nuclear extracts were obtained
from ionophore-stimulated Jurkat cells as described and analyzed by
EMSA. 30 bp wt and mutated probes labeled to similar specific
activity were used with identical amounts of nuclear extracts and
reaction conditions. Note that complex I does not bind the m2 and
m3 oligonucleotide probes. This complex will be referred to as
Rep-1 (see text). As expected, NFATp did not bind the m3 and m4
oligonucleotides.
incubated with the wild-type −175 to −146 bp oligonucleotide
probe in a standard EMSA reaction followed by UV cross-linking, autoradiography and excision of the Rep-1 complex, and
subsequent analysis by SDS-PAGE (see Methods). Figure 7
shows that Rep-1 appears to be made up of a single protein
that migrates with an apparent molecular mass of approximately 150 kDa, after subtracting 苲19 kDa attributed to the
30 bp oligonucleotide.
Rep-1 contains a single protein of apparent molecular
mass of 150 kDa
In an attempt to better characterize Rep-1, we analyzed the
composition of complex I by UV cross-linking and SDS-PAGE
analysis. In these experiments, Jurkat nuclear extracts were
Figure 7
UV cross-linking and SDS-PAGE analysis. Rep-1
migrated as a single protein (arrow). The relative migration of radiolabeled molecular weight markers run in parallel are indicated.
Leukemia
Novel interleukin 4 promoter negative regulatory element
S Georas et al
634
Discussion
Expression of the interleukin-4 gene is tightly regulated at the
level of gene transcription by multiple positively and negatively-acting transcription factors. Several factors involved in
the cell type-specific regulation of IL-4 production have
recently been identified.22,36–38 NFAT and C/EBP family members can enhance IL-4 transcription by interacting with multiple sites in the IL-4 promoter.16,18,31 Relatively little is known,
however, about factors that downregulate IL-4 transcription.
Negative regulatory elements have been described in the
proximal 300 bp of the IL-4 promoter and in the 3⬘-untranslated region.19,21,30 For example, an NRE centered around bp
−300 of the human IL-4 promoter was identified by Li-Weber
et al.19 In EMSA, this region bound two proteins: the T cellspecific Neg-1 and the ubiquitous Neg-2. IRF-2 has been suggested to downregulate the IL-4 promoter by binding an ISRElike sequence adjacent to the P3 element.21 In transient cotransfection experiments, we showed that RelA/NFKB1 heterodimers and RelA homodimers inhibit the human IL-4 promoter
by competing for NFAT binding to the P1 sequence.33
HMGI/Y was recently shown to downregulate IL-4 transcription by a similar mechanism.39 Additionally, we recently
reported that Stat6 can downregulate the IL-4 promoter in Jurkat T cells, apparently by competing for NFAT binding to overlapping recognition elements.40 In this report, we describe a
novel negative regulatory element adjacent to the P2 NFAT
site which we term P2 NRE.
It is worth noting that although the P2 NRE described in this
report has not been previously characterized, two previous
deletion analyses detected negative regulatory activity in this
region of the mouse IL-4 promoter.24,25 In one study, an NRE
between bp −213 and −115 was identified using CAT constructs transfected into EL-4 T cells.25 In another study, deleting the 20 bp between −157 and −137 increased ionomycin
and anti-CD3 inducibility of mouse IL-4 promoter constructs
approximately two-fold in D10 cells.24 Thus, negative regulatory activity in this region of the IL-4 promoter has now been
detected in three different human and murine T cell lines.
Because of differences in the species and scale of deletions,
however, it is not definite that each of these findings was due
to the P2 NRE.
Because the P2 NRE is flanked both upstream and downstream by additional enhancer elements, its negative regulatory activity only became apparent during a detailed promoter
deletion analysis. In this respect, it appears to be related to
other ‘internal’ NRE’s that have been characterized in the
proximal promoter regions of several cytokine genes, including
those for IL-2, IL-3 GM-CSF, TNF-␣, IFN-␣ and IFN-␤.41–47
Importantly, although these NREs are flanked by positive regulatory elements, they can significantly inhibit transcriptional
activation of their respective genes. In additional experiments,
we found that complex IV contained factors reactive with antibodies specific for the multifunctional transcription factor YinYang-1 (YY1), and we identified a binding site for this multifunctional factor just downstream of the P2 NRE (Georas S,
unpublished observation). However, mutations that disrupted
this element did not consistently affect activity of pCAT175
(m3 and m4 in Figure 5), suggesting that YY1 binding to this
region does not play a major role in regulating activity of the
minimal promoter.
Several lines of evidence support our contention that Rep-1
is the factor responsible for transcriptional repression from the
P2 NRE. First, we have shown that formation of the lowmobility Rep-1 complex is inversely correlated with the
Leukemia
activity of a 175-bp IL-4 promoter construct. Second, we did
not detect a similar complex on oligonucleotide probes corresponding to the other human P elements in EMSA, suggesting
that Rep-1 recognizes sequences unique to the P2 NRE. Rep1 binding was not competed for by consensus sequences for
many transcription factors (Figure 3), or by antibodies directed
against NFAT, AP-1, Oct, Stat-6, or Bcl-6 proteins (Figure 4
and data not shown). By UV cross-linking and SDS-PAGE
analysis, we found that it migrates as a single protein with
an apparent molecular mass of approximately 150 kDa. The
identity of Rep-1, and the mechanism by which it inhibits
transcriptional activation from downstream elements in the IL4 promoter, are currently not known. Rep-1 might specifically
antagonize the effects of NFATp on downstream elements
since both basal and calcium ionophore-induced activity of
pCAT175, both of which appear to be NFAT-dependent, are
extremely low. In preliminary experiments, Rep-1 appeared to
be equally expressed in nuclear extracts obtained from a pair
of established allergen-specific Th1 and Th2 clones. However,
defining the precise role of this factor in regulating differential
cytokine gene expression in Th subsets awaits the determination of the molecular identity of Rep-1.
Further characterization of this and other factors that limit
IL-4 promoter transactivation should enhance our understanding of IL-4 gene dysregulation in human diseases. For
example, aberrant T cell production of IL-4 appears to favor
the growth of certain B cell malignancies.48,49 In addition,
emerging data suggest that Th2-dominant immune responses
(ie characterized by IL-4 and IL-10 expression) are associated
with worse outcomes in experimental lymphoma models.50
Although the mechanisms responsible for dysregulated IL-4
production in these conditions are unknown, it is tempting to
speculate that they involve primary defects in the expression
and regulation of IL-4 promoter-specific transcription factors.
Future studies of T cells isolated from human subjects with
leukemia and lymphoproliferative disorders should shed light
on this important question.
Acknowledgements
We thank Dr Anjana Rao and Dr Gerald Crabtree for the generous gifts of reagents. Cindy Chang and Mary Brummet provided invaluable assistance with the UV cross-linking experiments. This work was supported by grants from the National
Institutes of Health, the American Lung Association, and the
Johns Hopkins University School of Medicine Clinician
Scientist Program.
References
1 Abbas A, Murphy K, Sher A. Functional diversity of helper T lymphocytes. Nature 1996; 383: 787–793.
2 O’Garra A. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 1998; 8: 275–283.
3 Robinson DS, Hamid Q, Ying S et al. Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. New Engl
J Med 1992; 326: 298–304.
4 Casolaro V, Georas S, Song Z, Ono S. Biology and genetics of
atopic disease. Curr Opin Immunol 1996; 8: 796–803.
5 Vellenga E, Dokter W, Halie RM. Interleukin-4 and its receptor;
modulating effects on immature and mature hematopoietic cells.
Leukemia 1993; 7: 1131–1141.
6 Nilsson G, Nilsson K. Effects of interleukin (IL)-13 on immediate–
early response gene expression, phenotype and differentiation of
Novel interleukin 4 promoter negative regulatory element
S Georas et al
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
human mast cells. Comparison with IL-4. Eur J Immunol 1995; 25:
870–873.
Sillaber C, Strobl H, Bevec D et al. IL-4 regulates c-kit proto-oncogene product expression in human mast and myeloid progenitor
cells. J Immunol 1991; 147: 4224–4228.
Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by
granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp
Med 1994; 179: 1109–1118.
Vella A, Teague TK, Ihle J, Kappler J, Marrack P. Interleukin 4 (IL4) or IL-7 prevents the death of resting T cells: stat6 is probably
not required for the effect of IL-4. J Exp Med 1997; 186: 325–330.
Dutcher JP, Venkatraj U, Makower D, Wiernik PH. Interleukin-4
is a pleotropic cytokine with effects on B-cell malignancies
(comment). Leukemia Res 1997; 21: 17–19.
Obiri NI, Hillman GG, Haas GP, Sud S, Puri RK. Expression of
high affinity interleukin-4 receptors on human renal cell carcinoma cells and inhibition of tumor cell growth in vitro by interleukin-4. J Clin Invest 1993; 91: 88–93.
Gooch JL, Lee AV, Yee D. Interleukin 4 inhibits growth and
induces apoptosis in human breast cancer cells. Cancer Res 1998;
58: 4199–4205.
Topp MS, Koenigsmann M, Mire-Sluis A et al. Recombinant
human interleukin-4 inhibits growth of some human lung tumor
cell lines in vitro and in vivo. Blood 1993; 82: 2837–2844.
Topp MS, Papadimitriou CA, Eitelbach F et al. Recombinant
human interleukin 4 has antiproliferative activity on human tumor
cell lines derived from epithelial and nonepithelial histologies.
Cancer Res 1995; 55: 2173–2176.
Leach MW, Snyder EA, Sinha DP, Rosenblum IY. Safety evaluation
of recombinant human interleukin-4. I. Preclinical studies. Clin
Immunol Immunopathol 1997; 83: 8–11.
Chuvpilo S, Schomberg C, Gerwig R et al. Multiple closely-linked
NFAT/octamer and HMG I(Y) binding sites are part of the interleukin-4 promoter. Nucleic Acids Res 1993; 21: 5694–5704.
Abe E, De Waal Malefyt R, Matsuda I, Arai K, Arai N. An 11 basepair DNA sequence motif apparently unique to human interleukin
4 gene confers responsiveness to T-cell activation signals. Proc
Natl Acad Sci USA 1992; 89: 2864–2870.
Szabo S, Gold J, Murphy T, Murphy K. Identification of cis-acting
regulatory elements controlling interleukin-4 gene expression in T
cells: roles for NF-Y and NF-AT. Mol Cell Biol 1993; 13: 4793–
4805.
Li-Weber M, Eder A, Krafft-Czepa H, Krammer P. T cell-specific
negative regulation of transcription of the human cytokine IL-4. J
Immunol 1992; 148: 1913–1918.
Li-Weber M, Krafft H, Krammer P. A novel enhancer element in
the human IL-4 promoter is suppressed by a position-independent
silencer. J Immunol 1993; 151: 1371–1382.
Li-Weber M, Davydov I, Krafft H, Krammer P. The role of NF-Y
and IRF-2 in the regulation of human IL-4 gene expression. J
Immunol 1994; 153: 4122–4133.
Li-Weber M, Salgame P, Hu C, Davydov I, Krammer P. Differential
interaction of nuclear factors with the PRE-I enhancer element of
the human IL-4 promoter in different T cell subsets. J Immunol
1997; 158: 1194–1200.
Rooney J, Hoey T, Glimcher L. Coordinate and cooperative roles
for NF-AT and AP-1 in the regulation of the murine IL-4 gene.
Immunity 1995; 2: 473–483.
Todd M, Grusby M, Lederer J, Lacy E, Lichtman A, Glimcher L.
Transcription of the interleukin 4 gene is regulated by multiple
promoter elements. J Exp Med 1993; 177: 1663–1674.
Tara D, Weiss D, Brown M. An activation-responsive element in
the murine IL-4 gene is the site of an inducible DNA-protein interaction. J Immunol 1993; 151: 3617–3626.
Bruhn K, Nelms K, Boulay J, Paul W, Lenardo M. Molecular dissection of the murine interleukin-4 promoter. Proc Natl Acad Sci
USA 1993; 90: 9707–9711.
Takemoto N, Koyano-Nakagawa N, Arai N, Arai K, Yokota T. Four
P-like elements are required for optimal transcription of the mouse
IL-4 gene: involvement of a distinct set of nuclear factor of activated T cells and activator protein-1 family proteins. Int Immunol
1997; 9: 1329–1338.
28 Szabo SJ, Glimcher LH, Ho IC. Genes that regulate interleukin-4
expression in T cells. Curr Opin Immunol 1997; 9: 776–781.
29 Henkel G, Brown M. PU. 1 and GATA: components of a mast
cell-specific interleukin 4 itronic enhancer. Proc Natl Acad Sci
USA 1994; 91: 7737–7741.
30 Kubo M, Ransom J, Webb D, Hashimoto Y, Tada T, Nakayama
T. T-cell subset-specific expression of the IL-4 gene is regulated
by a silencer element and STAT6. EMBO J 1997; 16: 4007–4020.
31 Davydov I, Krammer P, Li-Weber M. Nuclear factor-IL-6 activates
the human IL-4 promoter in T cells. J Immunol 1995; 155:
5273–5279.
32 Otsuka T, Villaret D, Yokota T et al. Structural analysis of the
mouse chromosomal gene encoding interleukin 4 which expresses
B cell, T cell and mast cell stimulating activities. Nucleic Acids
Res 1987; 15: 333–344.
33 Casolaro V, Georas S, Song Z et al. Inhibition of NF-AT-dependent
transcription by NF-␬B: implications for differential cytokine gene
expression. Proc Natl Acad Sci USA 1995; 92: 11623–11627.
34 Schreiber E, Matthias P, Müller M, Schaffner W. Rapid detection
of octamer binding proteins with mini-extracts from a small number of cells. Nucleic Acids Res 1989; 17: 6419.
35 Li-Weber M, Salgame P, Hu C, Krammer PH. Characterization of
constitutive and inducible transcription factors binding to the P2
NF-AT site in the human interleukin-4 promoter. Gene 1997; 188:
253–260.
36 Ho IC, Hodge MR, Rooney JW, Glimcher LH. The proto-oncogene
c-maf is responsible for tissue-specific expression of interleukin4. Cell 1996; 85: 973–983.
37 Lederer J, Perez V, DesRoches L, Kim S, Abbas A, Lichtman A.
Cytokine transcriptional events during helper T cell subset differentiation. J Exp Med 1996; 184: 397–406.
38 Rincon M, Flavell R. Transcription mediated by NFAT is highly
inducible in effector CD4+ T helper 2 (Th2) cells but not in Th1
cells. Mol Cell Biol 1997; 17: 1522–1534.
39 Klein-Hessling S, Schneider G, Heinfling A, Chuvpillo S, Serfling
E. HMGI(Y) interferes with DNA binding of NF-AT factors and the
induction of the interleukin 4 promoter in T cells. Proc Natl Acad
Sci USA 1996; 93: 15311–15316.
40 Georas S, Cumberland J, Burke T, Chen R, Schindler U, Casolaro
V. Stat6 inhibits interleukin 4 promoter activity in T cells. Blood
1998; 92: 4529–4538.
41 Nabel G, Gorka C, Baltimore D. T-cell-specific expression of
interleukin 2: evidence for a negative regulatory site. Proc Natl
Acad Sci USA 1988; 85: 2934–2938.
42 Yasui DH, Genetta T, Kadesch T et al. Transcriptional repression
of the IL-2 gene in Th cells by ZEB. J Immunol 1998; 160:
4433–4440.
43 Mathey-Prevot B, Andrews N, Murphy H, Kreissman S, Nathan
D. Positive and negative elements regulate human interleukin 3
expression. Proc Natl Acad Sci USA 1990; 87: 5046–5050.
44 Ye J, Cippitelli M, Dorman L, Ortaldo J, Young H. The nuclear
factor YY1 supresses the human gamma interferon promoter
through two mechansisms: inhibition of AP1 binding and activation of a silencer element. Mol Cell Biol 1996; 16: 4744–4753.
45 Fong C-L, Siddiqui A, Mark D. Identification and characterization
of a novel repressor site in the human tumor necrosis factor alpha
gene. Nucleic Acids Res 1994; 22: 1108–1114.
46 Kuhl D, de la Fuente J, Chaturvedi M et al. Reversible silencing
of enhancers by sequences derived from the human IFN-alpha
promoter. Cell 1987; 50: 1057–1069.
47 Nourbakhsh M, Hoffmann K, Hauser H. Interferon-beta promoters
contain a DNA element that acts as a position-independent silencer on the NF-kappaB site. EMBO J 1993; 12: 451–459.
48 Mu X, Kay NE, Gosland MP, Jennings CD. Analysis of blood Tcell cytokine expression in B-chronic lymphocytic leukaemia: evidence for increased levels of cytoplasmic IL-4 in resting and activated CD8 T cells. Br J Haematol 1997; 96: 733–735.
49 de Totero D, Reato G, Mauro F et al. IL4 production and increased
CD30 expression by a unique CD8+ T-cell subset in B-cell chronic
lymphocytic leukaemia. Br J Haematol 1999; 104: 589–599.
50 Lee PP, Zeng D, McCaulay AE et al. T helper 2-dominant antilymphoma immune response is associated with fatal outcome. Blood
1997; 90: 1611–1617.
635
Leukemia