Brain and Cognition 57 (2005) 53–60
www.elsevier.com/locate/b&c
The emerging fragile X premutation phenotype:
Evidence from the domain of social cognition
Kim Cornisha,*, Cary Koganb, Jeremy Turkc, Tom Manlye, Nicole Jamesf,
Andrea Millsd, Ann Daltong
a
Neuroscience Laboratory for Research and Education in Neurodevelopmental Disorders, McGill University, Montreal, Canada
b
Department of Psychology, McGill University, Montreal, Canada
c
Medical Research Council Cognition and Brain Sciences unit, Cambridge, United Kingdom
d
University of London, United Kingdom
e
University of Cambridge, United Kingdom
f
University of Nottingham, United Kingdom
g
North Trent Molecular Genetics Laboratory, Sheffield, United Kingdom
Accepted 12 August 2004
Available online 28 October 2004
Abstract
Fragile X syndrome is a neurodevelopmental disorder that is caused by large methylated expansions of a CGG repeat (>200)
region upstream of the FMR1 gene that results in the lack of expression of the fragile X mental retardation protein (FMRP).
Affected individuals display a neurobehavioral phenotype that includes a significant impairment in social cognition alongside deficits
in attentional control, inhibition and working memory. In contrast, relatively little is known about the trajectory and specificity of
any cognitive impairment associated with the fragile X premutation (‘‘carrier-status’’) (approximately 55–200 repeats). Here, we
focus on one aspect of cognition that has been well documented in the fragile X full mutation, namely social cognition. The results
suggest that premutation males display a pattern of deficit similar in profile, albeit milder in presentation, to that of the full mutation. However, little evidence emerged for a correlation between CGG repeat length and severity of phenotypic outcomes. The findings are discussed in the context of functional neuroimaging and brain-behaviour-molecular correlates. We speculate that the
deficiencies in social cognition are attributable to impairment of neural pathways modulated by the cerebellum.
! 2004 Elsevire Inc. All rights reserved.
1. Introduction
Fragile X syndrome is the most common form of heritable mental retardation, affecting approximately 1 in
4000 males and 1 in 6000 females (Turner, Webb, Wake,
& Robinson, 1996). In recent years, it has become one
of the most widely researched and well-documented of genetic conditions. In nearly all cases, the syndrome is
caused by an expansion of the CGG repeat at the beginning of the FMR1 gene on the X chromosome. This
expansion leads to methylation of the promoter sequence
*
Corresponding author.
E-mail address: [email protected] (K. Cornish).
0278-2626/$ - see front matter ! 2004 Elsevire Inc. All rights reserved.
doi:10.1016/j.bandc.2004.08.020
and loss of the ‘‘fragile X mental retardation protein’’
(FMRP) (Verkerk et al., 1991). In normal individuals,
there are 7–60 repeats, with 30 repeats found on the most
common allele (DNA sequence at FMR1 gene site). Alleles with between 55 and 200 repeats are called ‘‘premutations’’ and generate some protein. When 200 or more
CGG repeats are present, there is hypermethylation and
a subsequent silencing of the FMR1 gene. This is commonly referred to as the FMR1 full mutation. However,
unlike females affected by the mutation, full mutation
males are hemizygous and therefore often display a more
pronounced phenotype that is characterised by significant
developmental delay. In contrast, individuals with a premutation (an expansion of 50–200 CGG repeats) possess
54
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
unmethylated versions of the FMR1 gene and therefore
have normal or near-normal levels of FMRP (Devys,
Lutz, Rouyer, Bellocq, & Mandel, 1993). The frequency
of the fragile X premutation in the general population is
estimated at 1 in 250 females (Rousseau, Rouillard, Morel, Khandjian, & Morgan, 1995) and 1 in 813 males (Dombrowski et al., 2002) and has generally been associated
with normal intellectual functioning. Although the various phenotypic effects of the premutation are likely to
be subtle in comparison with the full mutation, the greater
prevalence of this condition warrants investigation of
possible neurocognitive and neurobehavioral effects.
In terms of the neurological expression of the full
mutation, studies have revealed decreased size of the
posterior vermis of the cerebellum in males and females
(Mostofsky et al., 1998; Reiss, Aylward, Freund, Joshi,
& Bryan, 1991). Other structures affected by FMR1 status include the caudate nucleus (Eliez, Blasey, Freund,
Hastie, & Reiss, 2001) and the hippocampus (Kates,
Abrams, Kaufmann, Breiter, & Reiss, 1997; Reiss,
Lee, & Freund, 1994). In addition, several studies reported a correlation between neuroanatomical abnormalities and the degree of functional impairment in
the full mutation. For example, posterior vermis volumes are positively correlated with performance on specific measures of intelligence, visual–spatial ability, and
executive function suggesting a putative functional role
for this structure (Mostofsky et al., 1998). Taken together the purely structural and combined structural/
functional studies implicate the cerebellum, caudate nucleus, and hippocampus as potential sites for phenotypic
effects from abnormal FMR1 gene expression.
Another source of valuable information regarding
vulnerable candidate brain structures comes from the
expression profile of FMRP in the unaffected brain.
For example, Kogan et al. (2004) showed a relationship
between local higher basal FMRP expression levels in
the magnocellular pathway of the thalamus—a pathway
associated with visual deficits in full mutation individuals. Identified areas with relatively higher FMR1 gene
expression include in the mouse, the hippocampus and
cerebellum (Hinds et al., 1993), in human embryos, differentiating neurons of the nucleus basalis magnocellularis, the hippocampus, discrete cortical areas, and to
a lesser extent the cerebellum (Abitbol et al., 1993). Such
findings are consistent with imaging studies showing
structural abnormalities in the same brain regions of
individuals with the full mutation. However, it is important to stress that abnormal structures form part of
widely distributed networks and that deficits may be observed across a broad range of activities. For example,
in addition to motor control and the acquisition of complex motor sequences, the cerebellum in its connection
with the frontal lobes has more recently been implicated
in higher order processes, including social cognition
(Riva & Giorgi, 2000).
Recent work by Hagerman and colleagues indicate
that a subgroup of older males (>50 years) with the premutation may have an increased risk of developing a
progressive cerebellar ataxia and tremor (Berry-Kravis
et al., 2003; Jacquemont et al., 2003). Associated neurobiological findings in this subgroup include generalised
brain atrophy, elevated FMR1 messenger RNA levels
and autopsy findings of widespread eosinophilic nuclear
inclusion bodies in CNS neurons and glia (Greco et al.,
2002). Such findings suggest that that brain regions compromised in full mutation males and females may be susceptible in some carriers.
At the cognitive level, there are relatively few studies
that have examined the pattern of any deficit in the fragile X premutation—fewer still have defined the premutation male phenotype. In contrast, the profile of males
with the FMR1 full mutation is now well documented
and there is an abundance of evidence showing that
fragile X is not a syndrome characterised by global mental retardation. Instead, the profile can be characterised
by uneven abilities within and across cognitive domains.
Relative strengths in vocabulary (Dykens, Hodapp, &
Leckman, 1987), verbal working memory (Jakala
et al., 1997), and long-term memory for meaningful
and learned information (Freund & Reiss, 1991) are
accompanied by relative weaknesses in attentional control (Cornish et al., 2004; Scerif, Cornish, Wilding, Driver, & Karmiloff-Smith, 2004; Wilding, Cornish, &
Munir, 2002), executive functions (Cornish, Munir,
& Cross, 2001; Estevez-Gonzalez, Roig, Piles, Pineda,
& Garcia-Sanchez, 1997), and linguistic processing
(Ferrier, Bashir, Meryash, Johnston, & Wolff, 1991;
Sudhalter, Cohen, Silverman, & Wolf-Schein, 1990).
In the domain of social cognition, recent findings indicate that individuals with the full mutation demonstrate
deficits in mentalising (‘‘theory of mind’’) abilities, (Cornish, Burack, Rahman, Russo, & Grant, in press; Garner,
Callias, & Turk, 1999) alongside impairments in basic face
recognition and emotion perception (Cornish, Munir, &
Cross, 1998; Turk & Cornish, 1998). Although these studies did not report comparable levels of impairment to
those typically associated with autism, strong similarities
between the two syndromes exist. Commonalities include
echolalia, repetitive speech, social avoidance, and hand
flapping in response to anxiety and excitement (Ferrier
et al., 1991; Turk & Graham, 1997).
1.1. The present study
Here, the main objective was to examine whether the
FMR1 premutation has a phenotypic effect in adulthood and, in particular, whether there are subtle abnormalities in the social cognition of this group. In contrast
to previous studies, we aimed to use a sample with sufficient power to examine the relationship between CGG
repeat size and postulated cognitive deficit. By looking
55
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
across a wide age range, we could also establish whether,
as with the motor control results discussed above, there
may be a trajectory moving from subtle to more obvious
impairment over the years.
Perhaps particularly for social cognition tests, variability may arise from cultural factors in addition to
more individual differences in !basic" perceptual, semantic and intellectual capacities. Selecting an appropriate
control group is therefore crucial. Here, we adopted
two. The first was recruited from genetically normal
(6–39 CGG repeats) male relatives of our index group
who, in general, would share socio-economic and cultural backgrounds with the premutation participants.
A slight drawback of this approach is that, if the premutation is associated with subtle impairments in intellectual as well as social function, this group may not be
well matched to the experimental population on general
factors such as IQ. A second possibility is that the control group—through having an affected relative or
through showing subtle problems themselves—may under-represent the difficulties faced by the premutation
group in any comparison. Accordingly, we recruited a
second control group from members of the general population with no family history of fragile X who were
matched on age and IQ with the premutation group.
We used two measures designed to tap ‘‘mentalising
abilities’’ (see below) and facial expression recognition—both capacities known to be compromised in males
with the full FMR1 expression. In addition, given the evidence of communication difficulties in boys with full
mutations (Turk & Graham, 1997), boys with premutations (Aziz et al., 2003) and girls with the full mutation
(Keysor & Mazzocco, 2002; Mazzocco, Baumgardner,
Freund, & Reiss, 1998) we employed the self-report Autism Spectrum Quotient instrument.
2. Methods
2.1. Participants
Group 1 comprised 22 adult males with a fragile X
premutation (‘‘carrier’’) who were recruited through the
UK Clinical Genetic Service Centres and the UK Fragile X Society. Participant"s ages ranged from 18 to 69
years with a mean age of 47.91 years (SD 15.79). Group
2 comprised 22 non-affected adult males from FXS families (familial controls) who were age matched (within a 5
year window) to the premutation males. Their ages ranged from 20 to 67 years, with a mean age of 40.8 years
(SD 12.9). Group 3 comprised 22 non-affected adult
males with no family history of FXS (non-familial controls) who were recruited from the local area and
matched individually on age to the premutation group.
Ages ranged from 20 to 68 years, with a mean age of
44.6 years (SD 14.8).
Table 1
Mean CA (SD) and IQ scores across the three groups: Premutation
males, familial and non-familial controls
Group
Age
IQ
Premutation
Familial
Non-familial controls
47.91 (15.8)
105.18 (10.5)
40.8 (12.9)
114.82 (12.8)
44.6 (14.8)
114.00 (10.5)
All participants were tested (individually) on the
Wechsler Abbreviated Scale of Intelligence (WASI;
Wechsler, 1999). This test provides a composite IQ score
based on four subtests tapping both verbal and performance domains. Table 1 shows a summary of mean
choronological age (CA) and IQ across the three groups.
The three groups were well matched on age
(F (1.306) = 0.278, ns). There were significant differences
between the groups for IQ (F (4.960) = 0.010). Post hoc
analysis (Scheffe) revealed that the Premutation group
had a lower mean IQ than the familial (p = .025) and
non-familial control groups (p = .043). There was no significant difference in IQ between the two control groups.
2.2. Fragile X DNA testing
Direct PCR was carried out using primers F5 0 CACG
ACGTTGTAAAACGACACGGAGGCGCCGCTGC
CAGG, R5 0 GAGAGGTGGGCTGCGGGCGCT, modified from Wang, Green, Bobrow, and Mathew (1995) at
0.5 pmol final concentration. Conditions were as follows: Final concentration 1 mM MgCl2, dATP, dCTP,
and dTTP at 0.2 mM, 7-deazaGTP (Amersham Phamacia Biotech) at 0.4 mM supplemented with 5% DMSO in
a total volume of 20 ll. Cycling conditions were 32 cycles at 67 "C annealing. Products were separated on
PAGE gels and visualised by silver staining according
to standard protocols. Where the premutation was
visible on PCR the repeat size was calculated according
to size markers and by electrophoresing the products
in size order and aligning the stutter bands. Southern
blotting was carried out according to standard protocols
on genomic DNA using a double digest of EcoR1 (NEB)
and the methylation sensitive enzyme Eag1 (NEB) and
probed with O·1.9 (Knight et al., 1993).
Sizing was relative to a female control of known repeat size. Where possible, repeat sizes derived from SB
were compared to those obtained from direct PCR. Repeat sizes of those individuals who gave a result on direct PCR and on SB were congruent. Blots were
overexposed to detect any evidence of mosaicism against
a known mosaic control. A premutation was an allele
between 55 CGG repeats up to approximately 200 repeats without any evidence of abnormal methylation.
Mosaicism was considered present when there was evidence of a methylated cell line as well as an unmethylated premutation cell line.
56
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
2.3. Test materials
In the present study, tasks that tapped both simple
and complex mental states were administered to participants. These tasks were chosen because they had been
developed for use with normal adults and are powerful
enough to detect subtle individual differences in social
sensitivity.
2.4. Facial expression recognition test (Ekman &
Friesen, 1971)
To test for the ability of judging simple mental states
in human faces, the present study used the well-known
and cross-cultural concept of seven basic emotional
states by Ekman and Friesen (1971). This test consists
of 70 black and white photographs of actors" faces posing happy, sad, fearful, angry, surprised, disgusted, or
neutral emotional expressions. Participants were required to look at each photograph and choose the verbal
label that best described the emotion. All pictures were
shown for 3 s, followed by a 5-s pause for the subject
to give his response. The maximum score was 70.
2.5. Revised eyes test (Baron-Cohen, Wheelwright,
Hill, Raste, & Plumb, 2001)
The Revised Eyes Test is a more extensive version of
the original test developed by Baron-Cohen, Jolliffe,
Mortimore, and Robertson (1997) and comprises items
related only to complex mental states. The stimuli for
this test consist of 35 black and white photographs taken
from larger photographs in popular magazines. Each
pair of eyes is digitised and cropped such that the
remaining image was black and white and measured 2
by 5 in, showing the eye region of faces, from just above
the eyebrows to the bridge of the nose. Baron-Cohen,
Wheelwright, Skinner, Martin, and Clubley (2001) and
Baron-Cohen, Wheelwright, Hill et al. (2001) asked
two judges to generate target words and foils for each
picture in open discussion. These target words were then
tested with their semantic opposites as foils on groups of
eight judges (four male and four female). The criterion
adopted was that at least five out of the eight judges
agreed that the target word was the most suitable
description for each stimulus and that no more than
two judges picked any single foil.
Participants were asked to look at each photograph
one at a time and to choose the word (from a choice
of 4) that best describes what that individual may be
thinking or feeling. For example, the correct response
of ‘‘panicked’’ needed to be selected from three foil
terms, ‘‘jealous’’, ‘‘arrogant,’’ and ‘‘hateful’’. All pictures were shown for 3 s, followed by a 5-s pause for
the participants to give his response. Immediately before
the test, participants were asked to read through the
glossary and indicate any word meanings of which they
were unsure (in practice, none of the participants asked
for clarification). The maximum score was 35.
2.6. Autism spectrum quotient (AQ) (Baron-Cohen
et al., 2001)
The AQ is a self-assessment screening instrument
developed by Baron-Cohen, Wheelwright et al. (2001)
to measure the degree to which an individual of normal
intelligence shows autistic traits. Participants were presented with 50 statements about different aspects of social
functioning: social skill, attention switching, attention to
detail, communication, and imagination. Each subscale
comprised 10 statements, with participants being asked
to either agree, slightly agree, slightly disagree, or definitely disagree with each. In addition to individual subscale scores, an overall score can be derived.
2.7. Procedure
With approval from regional and local ethical committees, and after receiving informed consent, the participants were tested in a quiet setting, generally their own
homes. Feedback was not given on individual
performance.
3. Results
3.1. Revised eyes test
To examine whether premutation was associated with
difficulties in reading emotions from the eyes, the performance of the three groups on the Revised Eye Test was
compared using ANCOVA. To establish whether any
difference was greater than one would expect based on
the observed IQ differences, both IQ and age were covaried out. There was a statistically significant group effect
[F (2, 64) = 5.27, p = .008]. Post hoc Scheffé tests confirmed that the FXS premutation group performed significantly worse (p < .001) than either of the control
groups. There was no significant difference between the
premutation and familial control group or between the
familial and non-familial control groups. The percentage
of errors across groups is shown graphically in Fig. 1.
3.2. Facial expression recognition test
Performance of the three groups on the Facial Expression Recognition task was again compared using ANCOVA with age and IQ covaried out. There was a
statistically significant effect of group F (2, 64) = 4.23,
p = .02. Scheffé post hoc analysis revealed that the difference between the premutation group and the non-familial controls was statistically significant (p < .05), whilst
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
Percentage Error
57
egory refer to a preference for rather fixed routines,
emotional distress at changes in routine, and a tendency
to focus on details (for example, ‘‘I tend to have very
strong interest, which I get upset about if I can"t pursue’’,
and ‘‘I prefer to do things the same way over and over
again’’). Scheffé tests revealed a similar pattern to that
reported above, with the critical difference in performance between the premutation group and non-familial
controls (p < .012). There were no other significant
group differences across the categories.
Revised Eyes Task
35
30
25
20
15
10
5
0
Premutation
Familial controls
Non-familial controls
Fig. 1. Percentage of errors on the Revised Eyes Test by Group:
premutation males, familial control males and non-familial control
males.
Percentage Error
Facial Expressions Task
46
44
42
40
38
36
34
32
Premutation
Familial controls
Non-familial controls
Fig. 2. Percentage of errors on the Facial Expressions Task by Group:
premutation males, familial control males and non-familial control
males.
the difference between the premutation and familial control group was insufficient to reach statistical significance. Analysis of the seven emotion categories of the
task revealed a group difference specifically on faces
depicting neutral expressions only (F (2, 64) = 3.199,
p = .05); with the critical difference again between the
premutation group and the non-familial controls. Notably, however, the categorisation of neutral expressions
was not the most challenging of the categories for the
control groups and the effect is therefore unlikely to stem
from a simple !level of difficulty". In addition, the absence
of a difference on other expressions suggests that basic visual processing/discrimination problems are very unlikely to account for this or the Eyes Test results. There
were no other significant differences (see Fig. 2).
3.4. Relationship between chronological age and
performance on the Revised Eyes task, Facial Expression
task, and the AQ
Previous research examining motor function in males
with the premutation has suggested an exaggeration of
relative impairment with increasing age. Here, we examined relationships with age across this measures using
correlation within the premutation group. With IQ covaried out, a robust relationship with age emerged on
the Facial Expression task (r = !.63; p = .002), with
older participants experiencing more difficulty on this
measure. A similar pattern emerged for familial controls
(r = !.44; p = .05). Previous research has shown normal
ageing effects on a similar test of facial recognition that
particularly compromise the recognition of fear and, to
a lesser extent, anger expressions (Calder et al., 2003). In
the premutation group here, the relationship between
fear recognition and age was minimal (r = !.164
p = .466), and indeed no single face category–age relationship reached statistical significance in isolation.
The results therefore suggest a general decline in sensitivity to emotional expression with age that cannot be
explained purely on the basis of general intellectual decline. There were no other significant correlations.
3.5. Relationship between the premutation CGG repeat
length and performance on the revised eyes task, facial
expression task, AQ, and IQ
There were no significant correlations between number of CGG repeats in the premutation range and performance on the Revised Eyes task (r = .27; p = .34),
the Facial Expression task (r = !.14; p = .63), or on
the AQ (r = !.04; p = .88). There was no also no correlation between IQ and CGG repeats (r = 19; p = .52).
3.3. Autism spectrum quotient
4. Discussion
There were no significant group differences in the total score from this self-report measure [F (2, 64) = 1.928,
p = .2]. However, analysis of the five categories showed
a significant group difference for the Attention Switching
subscale (F = 4.068, p < .02). The statements in this cat-
To date, this is the first study to investigate social
cognition in FMR1 premutation adults and one of the
few studies to incorporate a population-based, non-clinical sample together with age-matched familial and nonfamilial controls. Our primary aim was to establish
58
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
whether individuals with the FMR1 premutation show
subtle impairments on tasks of social cognition, tasks
that are typically impaired in individuals with the full
mutation. In addition, we sought to identify the trajectory and specificity of any such impairment—in particular, whether phenotypic effects become more severe with
age. Finally, we assessed the extent to which variability
in performance might be explained by the size of the
expansion in the FMR1 gene.
The results may be summarised as follows:
1. Males with the premutation performed significantly
more poorly than males without the premutation on a
task requiring recognition of complex emotions/inference
of mental state from photographs of eyes. This relative
impairment was over and above that which might be
anticipated on the basis of general ability, as indexed in
IQ. A similar pattern was observed on a task requiring
recognition of emotion from the whole face. Notably,
the difficulties experienced by the premutation group were
most apparent when categorising neutral expressions. As
these were not the most difficult for the control group, it
suggests that task difficulty per se cannot account for
the finding. Similarly, the adequate performance of the
premutation group on some but not all expressions suggests that basic perceptual problems are unlikely to account for the effect. Importantly, this finding is
consistent with previous research reporting similar but
more severe problems in individuals with the FMR1 full
mutation (Cornish et al., in press; Garner et al., 1999;
Turk & Cornish, 1998). This suggests that social perception difficulties may lie on a continuum. Although this
idea is not supported by the correlation analysis between
CGG repeat expansion size and performance on the Revised Eyes Task, the somewhat limited range of expansion
sizes (78–164) of the premutation males in the present
study may preclude establishing such a relationship.
2. On a self-report questionnaire of social difficulties,
the strongest difference between the premutation and the
non-familial control group lay in the attention switching
factor. At a cognitive level, problems in attention
switching and control have been reported as a fundamental deficit in the FMR1 full mutation (Munir, Cornish, & Wilding, 2000; Wilding et al., 2002). It is has
been suggested that this control requires a balance of
excitation and inhibition, to enable switching from one
attentional focus to another, or from one emitted response to the next response in a sequence. In the present
study, premutation males may display a subtle yet similar profile to that of full mutation males. At the
behavioural level, this may result in problems in over
focusing and a fixation on details, whilst at the cognitive
level, our preliminary analysis of attention and executive
functioning in this group is strongly suggestive of executive dysfunction (Cornish, Manly, James, Mills, & Hollis, 2003). Although speculative, it is possible that the
subtle impairments in executive functioning can be accounted for by disturbances in the cerebellum, which
can modulate executive functions subserved by frontal
cortex. Such deficits have been described previously
for patients with cerebellar atrophy (Grafman et al.,
1992), impairments normally attributed to damage of
the frontal lobe. Schmahmann and Pandya (1997) have
demonstrated that there are indeed corticopontine pathways from prefrontal areas suggesting that the cerebellum contributed to the network of brain areas critical
for higher-order cognitive processes.
3. Previous research has demonstrated that, for motor abilities, there is an interaction between premutation
status and age—with abnormalities becoming marked in
older age. There was a remarkably strong relationship
between worsening performance in categorising emotional expressions and increasing age in the premutation
and—to a lesser degree—in the familial control group.
The direction of the relationship in the Revised Eyes
Test was consistent with this finding for both groups,
although insufficient to reach statistical significance. Unlike normal ageing effects that disproportionately compromise the recognition of fear and anger expressions
(e.g., Calder et al., 2003); the decline in the premutation
group appeared to be more general. This effect is unlikely to be explicable on the basis of more general intellectual decline with age and, given the relatively good
performance of many members of this group on some
aspects of this task, unlikely to result from basic perceptual processing problems.
4. A notable trend across the emotional cognition
tasks employed here is that, although differences between the relatives of participants with the FMR1 premutation and non-related controls were not sufficient
to reach statistical significance, often the performance
of this group fell somewhere between the premutation
and non-familial groups. This occurred despite the ‘‘unaffected’’ relatives being well matched in terms of general ability. This raises the question of whether, across
a large sample, there are subtle effects of having one
or more relatives affected with full mutation fragile X,
whether there are other social factors that interact with
fragile X prevalence, or whether indeed these relatives
may themselves show very subtle problems with no currently obvious cause.
Our finding of a selective deficit in social cognition in
premutation carriers raises the interesting possibility
that the cerebellum might serve as a neurobiological locus for these abilities. Evidence from aging premutation
carriers indicates that abnormal FMR1 mRNA levels in
this population have their greatest impact on cerebellar
functioning (Berry-Kravis et al., 2003; Hagerman et al.,
2001; Jacquemont et al., 2003; Jacquemont et al., 2004).
Although premutation status does not appear to guarantee development of ataxia and tremor in later life,
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
there seems to be a significant increased vulnerability of
this brain structure with increased CGG repeat number.
Moreover, one of the most consistent findings from research into the neuroanatomical abnormalities associated with autism, a condition where similar deficits in
social cognition have been reported, (e.g., Baron-Cohen,
Wheelwright, Hill et al. (2001)), indicates that there are
structural abnormalities of the cerebellum. Furthermore,
mounting evidence implicates the cerebellum, as being
critical for non-motor functions, including language,
thought modulation, and social behaviour. Riva and Giorgi (2000), for example, observed that children with
lesions of the cerebellar vermis involving the postero-inferior lobules had autistic-like disruptions of social and
communicative behaviour. Finally, the expression pattern of FMRP in the brains of mouse embryos and to a lesser extent in human embryos reveal relatively higher levels
of the protein in the cerebellum, suggesting that alterations in the function of FMRP might have a detrimental
impact on this brain structure (Abitbol et al., 1993; Hinds
et al., 1993). Future research should examine the contribution of the cerebellum to the social cognition deficits
in fragile X syndrome. Specifically, these studies should
investigate the relationship among mutation status,
neuroanatomical variations in the cerebellum, and performance on neuropsychological measures of social
cognition.
In conclusion, the findings of the present study provide evidence of a subtle yet measurable effect of the
FMR1 premutation on aspects of social cognition,
namely for skills that require accurate social perception.
Consistent with previous research, the pattern of deficit
is similar in profile, albeit milder in presentation, to that
of the full mutation, indicating that the premutation
does not come without some degree of cognitive risk.
Future research will need to address whether there is
an increased risk of impairment to individuals who have
CGG repeat sizes in the higher premutation range
(>150), whether the effects generally worsen with age.
It is possible that the severe clinical profiles of ataxia
and tremor reported in previous studies included males
in the upper premutation range and that the potential
of developing such pathology is directly related to
FMR1 repeat size. Finally, it is crucial that future research address the phenotypic consequence of premutation status in childhood as well as the developmental
timing of any impairment. This will allow interventions
to be targeted more appropriately and prior to the development of irreversible neuropathology. Furthermore, it
may allow for identification of at risk premutation individuals for the development of more serious pathology
later in life. A longitudinal study of premutation males
may assist in our understanding of the impact of the repeat expansion on the neurobiology as well as the unique features of perception, cognition, emotion, and
behaviour in this population.
59
Acknowledgments
This research was supported by a grant from the
Wellcome Trust, UK to K.C., J.T., and A.D. We express our thanks to the all the regional genetics centres
that took part in the study and to the fragile X Society
for their support in recruitment. We would also like to
thank Amira Rahman and Danielle Ostield for their
helping in the editing of the manuscript.
References
Abitbol, M., Menini, C., Delezoide, A. L., Rhyner, T., Vekemans, M.,
& Mallet, J. (1993). Nucleus basalis magnocellularis and hippocampus are the major sites of FMR-1 expression in the human fetal
brain. Nature Genetics, 4, 147–153.
Aziz, M., Stathopulu, E., Callias, M., Taylor, C., Turk, J., Oostra, B.,
et al. (2003). Clinical features of boys with fragile X premutations
and intermediate alleles. American Journal of Medical Genetics B,
121, 119–127.
Baron-Cohen, S., Wheelwright, S., Skinner, R., Martin, J., & Clubley,
E. (2001). The autism-spectrum quotient (AQ): evidence from
Asperger syndrome/high-functioning autism, males and females,
scientists and mathematicians. Journal of Autism and Developmental Disorders, 31, 5–17.
Baron-Cohen, S., Wheelwright, S., Hill, J., Raste, Y., & Plumb, I.
(2001). The ‘‘Reading the Mind in the Eyes’’ Test revised version: a
study with normal adults, and adults with Asperger syndrome or
high-functioning autism. Journal of Child Psychology and Psychiatry, and Allied Disciplines, 42, 241–251.
Baron-Cohen, S., Jolliffe, T., Mortimore, C., & Robertson, M. (1997).
Another advanced test of theory of mind: evidence from very high
functioning adults with autism or asperger syndrome. Journal of
Child Psychology and Psychiatry, 38(7), 813–822.
Berry-Kravis, E., Lewin, F., Wuu, J., Leehey, M., Hagerman, R.,
Hagerman, P., et al. (2003). Tremor and ataxia in fragile X
premutation carriers: blinded videotape study. Annals of neurology,
53, 616–623.
Calder, A. J., Keane, J., Manly, T., Sprengelmeyer, R., Scott, S. K.,
Nimmo-Smith, I., & Young, A. W. (2003). The effects of normal
ageing on recognition of emotion. Neuropsychologia, 41, 145–149.
Cornish, K. M., Burack, J., Rahman, A., Russo, N., & Grant, C. (in
press). Theory of mind deficits in children with fragile X syndrome.
Journal of Intellectral Disability Research.
Cornish, K., Manly, T., James, N., Mills, A., & Hollis, T. J. (2003).
Differential impact of the FMR1 pre-mutation on working
memory, inhibition and attention: A molecular-neuropsychological
phenotype? Journal of Cognitive Neuroscience Supplement.
Cornish, K. M., Munir, F., & Cross, G. (1998). The nature of the
spatial deficit in young females with Fragile-X syndrome: a
neuropsychological and molecular perspective. Neuropsychologia,
36, 1239–1246.
Cornish, K. M., Munir, F., & Cross, G. (2001). Differential impact of
the FMR-1 full mutation on memory and attention functioning: a
neuropsychological perspective. Journal of Cognitive Neuroscience,
13, 144–150.
Cornish, K., Turk, J., Wilding, J., Sudhalter, V., Kooy, F., &
Hagerman, R. (2004). Deconstructing the attention deficit in fragile
X syndrome: a developmental neuropsychological approach. Journal of Child Psychology and Psychiatry.
Devys, D., Lutz, Y., Rouyer, N., Bellocq, J. P., & Mandel, J. L. (1993).
The FMR-1 protein is cytoplasmic, most abundant in neurons and
appears normal in carriers of a fragile X premutation. Nature
Genetics, 4, 335–340.
60
K. Cornish et al. / Brain and Cognition 57 (2005) 53–60
Dombrowski, C., Levesque, S., Morel, M. L., Rouillard, P., Morgan,
K., & Rousseau, F. (2002). Premutation and intermediate-size
FMR1 alleles in 10572 males from the general population: loss of
an AGG interruption is a late event in the generation of fragile X
syndrome alleles. Human Molecular Genetics, 11, 371–378.
Dykens, E., Hodapp, R., & Leckman, J. (1987). Strengths and
weaknesses in the intellectual functioning of males with fragile X
syndrome. American Journal of Mental Deficiency, 92, 234–236.
Ekman, P., & Friesen, W. V. (1971). Constants across cultures in the
face and emotion. Journal of personality and social psychology, 17,
124–129.
Eliez, S., Blasey, C. M., Freund, L. S., Hastie, T., & Reiss, A. L.
(2001). Brain anatomy, gender and IQ in children and adolescents
with fragile X syndrome. Brain, 124, 1610–1618.
Estevez-Gonzalez, A., Roig, C., Piles, S., Pineda, M., & GarciaSanchez, C. (1997). Fragile X syndrome and mental retardation.
Revista de Neurologia, 25, 1068–1071.
Ferrier, L. J., Bashir, A. S., Meryash, D. L., Johnston, J., & Wolff, P.
(1991). Conversational skills of individuals with fragile-X syndrome: a comparison with autism and Down syndrome. Developmental medicine and child neurology, 33, 776–788.
Freund, L. S., & Reiss, A. L. (1991). Cognitive profiles associated with
the fra(X) syndrome in males and females. American Journal of
Medical Genetics, 38, 542–547.
Garner, C., Callias, M., & Turk, J. (1999). Executive function and
theory of mind performance of boys with fragile-X syndrome.
Journal of Intellectual Disability Research, 43, 466–474.
Grafman, J., Litvan, I., Massaquoi, S., Stewart, M., Sirigu, A., &
Hallett, M. (1992). Cognitive planning deficit in patients with
cerebellar atrophy. Neurology, 42, 1493–1496.
Greco, C. M., Hagerman, R. J., Tassone, F., Chudley, A. E., Del
Bigio, M. R., Jacquemont, S., et al. (2002). Neuronal intranuclear
inclusions in a new cerebellar tremor/ataxia syndrome among
fragile X carriers. Brain, 125, 1760–1771.
Hagerman, R. J., Leehey, M., Heinrichs, W., Tassone, F., Wilson, R.,
Hills, J., et al. (2001). Intention tremor, parkinsonism, and
generalized brain atrophy in male carriers of fragile X. Neurology,
57, 127–130.
Hinds, H. L., Ashley, C. T., Sutcliffe, J. S., Nelson, D. L., Warren, S.
T., Housman, D. E., et al. (1993). Tissue specific expression of
FMR-1 provides evidence for a functional role in fragile X
syndrome. Nature Genetics, 3, 36–43.
Jacquemont, S., Farzin, F., Hall, D., Leehey, M., Tassone, F., Gane,
L., et al. (2004). Aging in individuals with the FMR1 mutation.
American Journal of Mental Retardation, 109, 154–164.
Jacquemont, S., Hagerman, R. J., Leehey, M., Grigsby, J., Zhang, L.,
Brunberg, et al. (2003). Fragile X premutation tremor/ataxia
syndrome: molecular, clinical, and neuroimaging correlates. American Journal of Human Genetics, 72, 869–878.
Jakala, P., Hanninen, T., Ryynanen, M., Laakso, M., Partanen, K.,
Mannermaa, A., et al. (1997). Fragile-X: neuropsychological test
performance, CGG triplet repeat lengths, and hippocampal
volumes. The Journal of clinical investigation, 100, 331–338.
Kates, W. R., Abrams, M. T., Kaufmann, W. E., Breiter, S. N., &
Reiss, A. L. (1997). Reliability and validity of MRI measurement
of the amygdala and hippocampus in children with fragile X
syndrome. Psychiatry research, 75, 31–48.
Keysor, C. S., & Mazzocco, M. M. (2002). A developmental approach
to understanding Fragile X syndrome in females. Microscopy
research and technique, 57, 179–186.
Knight, S. J., Flannery, A. V., Hirst, M. C., Campbell, L., Christodoulou, Z., Phelps, S. R., et al. (1993). Trinucleotide repeat
amplification and hypermethylation of a CpG island in FRAXE
mental retardation. Cell, 74, 127–134.
Kogan, C. S., Boutet, I., Cornish, K., Zangenehpour, S., Mullen, K.
T., Holden, J. J., et al. (2004). Differential impact of the FMR1
gene on visual processing in fragile X syndrome. Brain, 127,
591–601.
Mazzocco, M. M., Baumgardner, T., Freund, L. S., & Reiss, A. L.
(1998). Social functioning among girls with fragile X or Turner
syndrome and their sisters. Journal of Autism and Developmental
Disorders, 28, 509–517.
Mostofsky, S. H., Mazzocco, M. M., Aakalu, G., Warsofsky, I. S.,
Denckla, M. B., & Reiss, A. L. (1998). Decreased cerebellar
posterior vermis size in fragile X syndrome: correlation with
neurocognitive performance. Neurology, 50, 121–130.
Munir, F., Cornish, K. M., & Wilding, J. (2000). A neuropsychological
profile of attention deficits in young males with fragile-X syndrome. Neuropsychologia, 38, 1261–1270.
Reiss, A. L., Aylward, E., Freund, L. S., Joshi, P. K., & Bryan, R. N.
(1991). Neuroanatomy of fragile X syndrome: the posterior fossa.
Annals of neurology, 29, 26–32.
Reiss, A. L., Lee, J., & Freund, L. (1994). Neuroanatomy of fragile X
syndrome: the temporal lobe. Neurology, 44, 1317–1324.
Riva, D., & Giorgi, C. (2000). The contribution of the cerebellum to
mental and social functions in developmental age. Fiziologiia
cheloveka, 26, 27–31.
Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., &
Morgan, K. (1995). Prevalence of carriers of premutation-size
alleles of the FMRI gene–and implications for the population
genetics of the fragile X syndrome. American Journal of Human
Genetics, 57, 1006–1018.
Scerif, G., Cornish, K., Wilding, J., Driver, J., & Karmiloff-Smith, K.
(2004). Visual search in typically developing toddlers and toddlers
with Fragile X or Williams Syndrome. Developmental Science, 7,
116–130.
Schmahmann, J. D., & Pandya, D. N. (1997). Anatomic organization
of the basilar pontine projections from prefrontal cortices in rhesus
monkey. Journal of Neuroscience, 17, 438–458.
Sudhalter, V., Cohen, I. L., Silverman, W., & Wolf-Schein, E. G.
(1990). Conversational analyses of males with fragile X, Down
syndrome, and autism: comparison of the emergence of deviant
language. American journal of mental retardation, 94, 431–441.
Turk, J., & Cornish, K. M. (1998). Face recognition and emotion
perception in boys with fragile X syndrome. Journal of Intellectual
Disability Research, 42, 490–499.
Turk, J., & Graham, P. (1997). Fragile X syndrome, autism and
autistic features. Autism, 1, 175–197.
Turner, G., Webb, T., Wake, S., & Robinson, H. (1996). Prevalence of
fragile X syndrome. American Journal of Medical Genetics, 64,
196–197.
Verkerk, A. J., Pieretti, M., Sutcliffe, J. S., Fu, Y. H., Kuhl, D. P., Pizzuti,
A., et al. (1991). Identification of a gene (FMR-1) containing a CGG
repeat coincident with a breakpoint cluster region exhibiting length
variation in fragile X syndrome. Cell, 65, 905–914.
Wechsler, D. (1999). Wechsler abbreviated scale of intelligence. San
Antonio, TX: The Psychological Corporation.
Wang, Q., Green, E., Bobrow, M., & Mathew, C. G. (1995). A rapid,
non-radioactive screening test for fragile X mutations at the
FRAXA and FRAXE loci. Journal of Medical Genetics, 32,
170–173.
Wilding, J., Cornish, K., & Munir, F. (2002). Further delineation of
the executive deficit in males with fragile-X syndrome. Neuropsychologia, 40, 1343–1349.