Int J Clin Exp Med 2017;10(4):6158-6166
www.ijcem.com /ISSN:1940-5901/IJCEM0039719
Original Article
MiR-126 inhibits the proliferation of myocardial
fibroblasts by regulating EGFL7-mediated
EGFR signal pathway
Yan Peng1, Fengfeng Chao2, Yuping Cai3, Wei Teng4, Chunguang Qiu4
Department of Endocrinology, Linyi People’s Hospital, Linyi 276000, Shandong Province, China; 2Department
of Radiology, Linyi People’s Hospital of Eastern Medical Area, Linyi 276000, Shandong Province, China; 3Department of Fever Clinics, Linyi People’s Hospital of Eastern Medical Area, Linyi 276000, Shandong Province, China;
4
Department of Cardiology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan
Province, China
1
Received September 8, 2016; Accepted November 29, 2016; Epub April 15, 2017; Published April 30, 2017
Abstract: Objectives: The aim of this study was to investigate miR-126 for its effect on cardiac fibroblasts proliferation and regulatory mechanism. Methods: Isolation and culture of rats cardiac fibroblasts cells (CFs) were
conducted and CFs in the experiment were divided into CFs, mimics, inhibitors, the NS-MiRNA group. Then relevant
genetic sequences of miR-126 mimics, inhibitors and NS-the miRNA transfected into CF cells, respectively. The effect of miR-126 on the proliferation of CFs was tested by CCK8 method. And the effects of miR-126 on cell cycle of
CFs were measured by flow cytometry method. Meanwhile, Immunofluorescence Tests were done for measuring the
effects of miR-126 on expression of α-SMA and EDU. Finally, mRNA and protein expression levels of EGFL7, AKT,
pAKT, ERK, pERK of each group of cells, respectively, were measured by fluorescence quantitative PCR (fqPCR) and
protein printing. Results: The miR-126 agonist and inhibitor were successfully constructed, respectively. And results
of CCK8 test showed that miR-126 mimics group inhibited effectively proliferation of CFs while miR-126 inhibitor
group promoted the proliferation of CFs. Results of flow cytometry showed that compared with those of CFs group,
cells of G1 phase in the mimics group was significantly increased (P < 0.05), but cells proportion of S phase in the
mimics group reduced (P < 0.05). Compared with those of CFs group, cells of G1 phase in the inhibitors group was
significantly reduced (P < 0.05), cell proportion of S phase in the inhibitors group increased (P < 0.05), accordingly.
Results of immunofluorescence test indicated that compared with those of CFs group, expression levels of actin
α-SMA and cell proliferation markers protein EDU in the mimics group were significantly lower (P < 0.05); however,
expression levels of α-SMA, EDU in the inhibitors group were significantly increased (P < 0.05). Results of qPCR and
results of western blotting manifested that compared with those of CFs group, mRNA expression of EGFL7, AKT,
pAKT, ERK, pERK and protein expression levels in the mimics group significantly raise, respectively (P < 0.05); but
mRNA expression levels of EGFL7, AKT, pAKT, ERK, Perk and protein expression levels in the inhibitor group were
significantly lower (P < 0.05). Conclusions: MiR-126 inhibits the proliferation and differentiation of myocardial fibroblasts, possibly through increasing the expression of EGFL7 and activating AKT/ERK signaling pathway.
Keywords: MiR 126, cardiac fibroblasts, EGFL7, AKT/ERK, signaling pathways, proliferation
Introduction
Myocardial infarction (MI) or acute myocardial
infarction (AMI) is a major cause of death worldwide and is defined as massive cell damage
(necrosis and apoptosis) [1]. The prevalence of
MI in China has happened a dramatic change
as the Chinese economy developed over the
last two-decade years and the mortality of ischemic heart disease has doubled, which means
that more than 1 million people die of myocardial infarction each year [2]. The phenomenon
appears to be more and more common for
the increasing lifestyle-related stress and the
growing aging population. In addition, because
of coronary artery disease, particularly coronary atherosclerosis, other recognized risk
factors include smoking, obesity, diabetes and
so on lead to myocardial infarction [3]. Due to
the regeneration capability of cardio-myocytes,
the current AMI therapies mainly focus on cardiovascular remodeling to prevent further
impairment of the myocardium and to restore
cardiac functions [4].
MiR-126 inhibits the proliferation of myocardial fibroblasts
Table 1. PCR primers design
miRNA
miRNA 126-mimic
miRNA 126-inhibitors
NS-miRNA
Sequence
5’-UCGUACCGUGAGUUAAUGCG-3’
5’-CGCAUUAUUACUCACGGUACGA-3’
5’-UUCUCCGAACGUGUCACGU-3’
MicroRNAs (miRNAs) are 18- to 25-nucleotide
(nt) small RNA species that serve as key regulators of translation. Over the last decade or
so, a serial of new discoveries have identified
important roles for miRNAs in human health
and disease. MiRNA expression levels can
change accordingly in response to variation of
inside or outside cell environment, which in
turn modulates the entire regulatory pathways
and fundamentally change relevant cellular
function [5]. MiRNAs have a clearly significant
regular role in cardiovascular function [6]. In
recent years several protective regulators in
cardio-myocytes which include miR-24, miR214 and so on have been reported [7, 8].
Among these miRNAs, miR-126 is highly
expressed in vascular endothelial cells and is
reported to play a protective role in post-infarct
remodeling and other pathophysiological processes by activating the vascular endothelial
growth factor (VEGF) [9, 10]. For the more, it
has been discovered that miR-126 can up regular angiogenesis processes of gastric, oral,
and metastatic colorectal cancer through the
up-regulation of VEGF, which suggests a potential therapeutic strategy for preventing the
neoplasm growth process via antagonizing the
up-regulation of miR-126 in tumor tissues [11,
12]. VEGFs are important angiogenic molecules
like EGFL7, AKT, pAKT, ERK and so on and play
a key role in vascular growth and regulation.
Thereby, the down-regulation of miR-126 enhances cardiac self-repair in the infarcted heart
and protects cardio-myocytes from ischemia
injury [13]. In addition, serum miR-126 is
believed to be a prospective biomarker in the
AMI therapy and its down-modulation is usually
observed in AMIs [14]. Related studies have
provided evidences for potential angiogenesis
mediated by miR-126 in vitro and in vivo experiments [15]. Therefore, we suspected that the
interaction between miR-126 and VEGF is likely
to have substantial influence on myocardia
angiogenesis processes and may be an alternative therapeutic target for AMI.
The present study explored this potential mechanism in the treatments of miR-126 mimics
6159
transfection to assess whether miR-126
mimics could protect the cardiac tissues
once AMIs occurred.
Materials and methods
Cell extraction and cell culture
SD rats with an average age of 2-3 months and
an average weight of 225-350 g were obtained
to construct acute myocardial infarction (AMI)
models and from these rats CFs were isolated.
CFs from rats was isolated by using the density
gradient centrifugation method. All cells were
cultured in Dulbecco medium with 10% fetal
bovine serum at 37°C in an incubator with 5%
CO2. Proliferation of CF cells was inspected
using 3-(4,5-dimethyl-2-thiazolyl)-2, 5-diphenyl2-H-tetrazolium bromide assay and changes in
cellular morphology were observed under a
microscope.
All rat cells in the experiment were further subdivided into 4 groups: CFs group, mimics group,
inhibitors group and the negative control
NS-miRNA group and each group set up 3 holes
in the culture plates.
Isolation and cultivation of CFs
Newborn 1-3 days SD rats provided by the laboratory of molecular biology were executed after
75% alcohol disinfection. Isolated hearts and
clipped apical tissues of rats on sterile operating table. The broken apical tissues were
digested and isolated by 1.25% trypsin (Solarbio biological technology co., LTD., Shanghai,
China). Then isolated cells were filtered by 200
mesh sterile stainless steel mesh and thesupernatant was removed by centrifugation and
the precipitate came into cell suspension. Cell
suspension was inoculated on the DMEM culture medium containing 10% calf serum
(Solarbio biological technology co., LTD., Shanghai, China) in the cell bottles by differential
adherence method. And the culture medium
was cultivated in sterile, constant temperature
incubator at 37°C and the atmosphere of 5%
CO2 saturated humidity in 60-90 minutes.
Removal of myocardial cells was done by differential adhesion method and the rest of the
cells are CFs. When the adherence fibroblasts
cells were confluence above 90%, then those
were digested and went down to posterity.
Int J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
Table 2. Primer sequences for luciferase reporter experiments
PCR primers
sequences
miRNA 126
U6
EGFL7
AKT
ERK
GAPDH
Forward (5’-3’)
Reverse (5’-3’)
ACACTCCAGCTGGGTCGTACCGTGAGTAAT
CTCGCTTCGGCAGCACA
CTGCTGATGTGGCTTCTGGT
CCTCTCTACCGCCGTTG
GAGCACAGAGCCTCGCCTTT
AGATGCATATTCGGACCCAC
TGGTGTCGTGGAGTCG
AACGCTTCACGAATTTGCGT
GAGGAAGGGCTGGTACACAC
CCACACAGGGTTCTTC
ATCCT TCTGACCCATGCCCA
CCTCATGTTTGTGCAGGAGA
Immunofluorescent
identification
Placed the logarithmic
growth phase cells
after transfection inoculation to the 24 hole
plate glass and When
the cell fusion rate was
90%, used 4% paraformaldehyde (SolarbEGFL7: epidermal growth factor-like domain 7; AKT: protein kinase B; ERK: extracellular
io biological technolosignal-regulated kinase; GAPDH: glyceraldehyde-phosphate dehydrogenase.
gy co., LTD., Shanghai,
China) to fix cells 10
Finally, P4 cells were used for subsequent
min. Then Containing 5% calf serum and 0.25%
Triton X-100 (Solarbio biological technology co.,
experiments.
LTD., Shanghai, China) sealing fluid was used to
handle cells 30 min. Then Joined the rabbit
CFs transfection
anti-human α-SMA primary antibody (diluted
According to miRbase database, the sequencmultiples, 100), (Solarbio biological technology
es of rats miRNA 126 mimics, inhibitors and
co., LTD., Shanghai, China) and rabbit antihuman EDU primary antibody (diluted multiples,
NS-miRNA were shown in Table 1. The sequenc100), (Solarbio biological technology co., LTD.,
es were synthetized by Shanghai Yingjun comShanghai, China), respectively. The above reapany. Frist of all, CF cells in the logarithmic
gents stayed overnight in 4°C and then were
phase were inoculated in 6-holes culture plates
rinsed by the reagent TBSB with the condition
and when cell fusion rate was 70% transfection
of 3 times/5 min. Added the horseradish perwas done. Secondly, 0.03 mol miRNA-126 mimoxidase labeled goat anti-rabbit secondary
ics, inhibitors and NS-miRNAs reagent, sepaantibody (MB005, Solarbio biological technolorately, were mixed with 50 mul Opti-MEM
gy co., LTD., Shanghai, China) and diluted mixserum-free medium. And then the mix reagents
tures with purified water in the proportion of
were still standing for 5 min. Then, 0.5 μl
1:100. Incubation was implemented at room
Lipofectamine™ 2000 reagent was joined
temperature in 1 h and DAPI staining was done
to above mix reagents with standing for 30
at room temperature and avoided light in 10
min, which formed miRNA-lipofectamine commin. Finally, the reagent was fixed with glycerin
pounds. Finally, the miRNA-lipofectamine comand observed and taken pictures under the flupounds were transfected into CFs for 24 h and
orescence microscope. The above experiments
continue.
repeated by 3 times.
CCK8 assay
Flow cytometry for analysis of cell cycle
CCK8 assay was used to analyze the proliferation of myocardial fibroblasts for each group.
The cell suspension after 48 h transfection was
vaccinated in 96-well plates with the concentration of 100 μl per hole and incubated for 24
h. And then put culture plate in 37°C cell culture incubator. After that, each group randomly
toke three holes in the 12, 24, 36, 48 and 72 h
after incubation, respectively. And each hole
was added 10 μl CKK reagent followed by 2 h
incubation. Finally, the absorbance value at
the 450 nm wave length was measured by
ELIASA reader to draw the cell growth curve.
The experiments repeated 3 times.
48 h after transfection cells were done with
0.25% trypsin digestion, and count 1 × 106
cells with killed by 12 h 75% ethanol treatment.
And the reagent was joined the final concentration of 50 mu g/ml of RNA enzymes with reaction at room temperature for 1 h. Propidium
Iodide (PI) was joined with avoiding-light staining for 30 min. Using flow cytometry instrument
analyzing the cell cycle, the experiment repeated 3 times.
6160
RNA isolation and RT-PCR
Total RNA from tissues or cells were extracted
using TRIzol reagent. The Rever Tra Ace qPCR
Int J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
Figure 1. The morphological changes of CFs (*100). A: CFS, B: Mimics group, C: Inhibitors group, D: NS-miRNA
group.
Figure 2. miR-126 expression in the RMSCs by QRTPCR. Note: *P < 0.05, compared with CFs group.
Figure 3. Effect of miR-126 on proliferation of CFs by
CCK8. Note: *P < 0.05, compared with CFs group.
RT Kit was used to reversely transcribe total
RNA into cDNA and real-time PCR (RT-PCR) was
performed using THUNDERBIRDSYBR® qPCR
Mixand the CFX96 Touch RealTime PCR Detection System. The relevant primers are listed
in Table 2. Target gene expression levels were
normalized to those of the control gene
(GADPH) and were calculated using the method
of 2-ΔΔCT.
Western blot
6161
Tissues and cells were harvested and lysed by
radio immunoprecipitation assay (RIPA) buffer.
Total protein was separated and evaluated
by the Bradford method [20]. Then, the total
protein was denatured in boiling water and
transferred onto polyvinylidene fluoride (PVDF)
membranes when sodium dodecyl sulfate-poly-
Int J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
Table 3. Effects of miR-126 on cell cycle of CFs
through flow cytometry
G0/G1
CFs
43.12 ± 4.31
Mimics
69.12 ± 5.31*
Inhibitors 29.02 ± 3.31*
NS-miRNA 45.12 ± 4.11
G2/M
S
13.12 ± 2.31 42.12 ± 4.31
15.12 ± 4.01 28.12 ± 5.31*
14.12 ± 4.01 68.32 ± 2.12*
12.02 ± 4.31 41.12 ± 4.11
*P < 0.05, compared with CFs group.
acrylamide gel electrophoresis (SDS-PAGE)
was completed. The membranes were blocked
in Tris-Buffered Saline Tween (TBST) with 5%
skim milk for 1 h and then they were treated
with primary antibodies against VEGF-A (1: 800
dilution) at 4°C overnight. After membranes
were washed, they were incubated with secondary antibodies (horseradish peroxidaseconjugated goat anti-goat, 1:2000 dilutions).
Samples and reduced glyceraldehydes-phosphate dehydrogenase (GAPDH) as the endogenous control were ultimately processed with
enhanced chemiluminescence and quantified
using Lab Works 4.5 software.
Statistical analysis
All statistical analyses were performed with
SPSS 18.0 software (Chicago, IL). Data are presented in the form of mean ± standard deviation (SD). Two-tailed Student’s t-test or one way
analysis of variance (ANOVA) was used to
assess significant different among different
groups and P < 0.05 provided evidence of statistical significance.
Results
Morphological observation of CFs
After transfection cells continued to being
developed after 48 h and observed microscopically CFs group and NS-miRNA group cells. As
shown in Figure 1, the cell present long fusiform or triangle, abundant cytoplasm, big cell
body. Some cells became round with lower
degree of proliferation in mimics group. Cells is
woven, active and cell body expand with intensive growth in inhibitors group.
The effect of miR-126 transfection CFs
After 48 h transfection of MicroRNA-126 mimics, inhibitors and NS-miRNA of CFs, the results
of QRT-PCR revealed that Mimics group of miR126 expression level increased significantly (P
< 0.05) compared with CFs group. Moreover,
Inhibitors group of miR-126 expression level
6162
decreased significantly (P < 0.05) and
NS-microRNA group have no significant difference (P > 0.05) compared with CFs group.
Therefore, miRNA-126 mimics, inhibitors
and NS-microRNAs successful infection CFs
and all of they can be used for follow-up
study (Figure 2).
The influence of miR-126 on proliferation
capacity of CFs
Results of CCK8 tests showed that D-value of
NS-MiRNA group had no significant change (P >
0.05) compared with those of CFs group.
However, D-value of Mimics groups in 12, 24,
36, 48 and 72 h point decreased obviously (P <
0.05). That of NS-miRNA group had no significant difference (P > 0.05). D value of inhibitors
group of cells in 12, 24, 36, 48 and 72 h point
increased significantly (P < 0.05). In three
group, the more time extended, the more cell
proliferation increased (Figure 3). Thence, MiR126 could significantly inhibit proliferation of
CFs.
The effect of miR-126 on cell cycle of CFs
The results of flow cytometry instrument detection showed that compared with those of
CFs group, mimics group cells in G1 phase
increased significantly (P < 0.05) and S period
cells proportion was lower (P <0.05). While G1
phase cells were significantly reduced in the
inhibitors group (P < 0.05), S phase cell proportion increased in the inhibitors group (P < 0.05).
Results of NS-MiRNA group revealed that there
was no obvious difference between any periods, compared with the G1 phase cells and S
period cells proportion of CFs group (P > 0.05)
(Table 3; Figure 4). The results of the experiments showed that miR-126 inhibited cell cycle
progression of CFs via G1 phase blocking and
the replication activity decrease of cells.
The influence of miR-126 on protein expression of α-SMA, EDU
Myocardial fibroblasts are contractile cells that
express α-smooth muscle actin (α-SMA), which,
in combination with the appearance of stress
fibres, is a reliable marker for the myocardial
fibroblast phenotype. And cell proliferation
markers protein EDU was proven for tool of
research of cell cycle.
Results of immunofluorescence tests results
revealed that compared with those of CFs groInt J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
Figure 4. The effects of miR-126 on cell cycle of CFs by flow cytometry. A: CFs, B: Mimics group, C: Inhibitor group,
D: NS-miRNA.
up, expression levels of α-smooth muscle, actin
α-SMA, cell proliferation markers protein EDU
were significantly reduced in the mimics group
(P < 0.05). However, α-SMA, protein EDU expression levels were significantly increased in the
inhibitor group (P < 0.05). Furthermore, α-SMA,
EDU protein expression level had no significant
difference in the NS-MiRNA group (P > 0.05). All
results proved that miR-126 had proliferation
inhibition effect on CFs and, to a certain extent,
could inhibit the differentiation of CFs to muscle fiber cell (Figure 5).
Effects of miR-126 on EGFL7, AKT ERK expression
Compared with those of CFs group, expression
levels of EGFL7, AKT, pAKT, ERK, pERK mRNA
and protein in the mimics group were signifi6163
cantly increased (P < 0.05). The expression levels of EGFL7, AKT, pAKT, ERK, pERK mRNA and
protein were significantly reduced (P < 0.05) in
the inhibitor group. The relevant expression levels had no significant difference in the MiRNA
group (P > 0.05) (Figure 6). Thence, MiR-126
could increase EGFL7 expression level, and
activate AKT/ERK pathway and inhibit cardiac
fibroblasts proliferation.
Discussion
This study investigated the mechanism of miR126 in the regulator of myocardial infarction.
The results revealed that MiR-126 could alleviate myocardial infarction damage through
EGFL7 expression up-regulation. Epidermal
Growth Factor like domain 7 (EGFL7) also
known as Vascular Endothelial-statin (VE-statin)
Int J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
Figure 5. α-SMA, EDU protein expression by immunofluorescence. A: CFs, B: Mimics group, C: Inhibitor group, D:
NS-miRNA. Notes: blue as the nucleus DAPl, green as cell proliferation EDU, red as α-SMA.
Figure 6. Expression of EGFL7, AKT, pAKT, ERK,
pERK among groups. A: mRNA expression of EGFL7
AKT, pAKT, ERK, pERK by qRT-PCR. B: Protein expression of EGFL7, AKT, pAKT, ERK and Perk by
Western blot. Notes: *P < 0.05, compared with CFs.
codes for a gene mostly expressed in endothelial cells [16-18]. Vascular Endothelial Growth
Factor (VEGF) is an important neovasculariza-
6164
tion regulator which can effectively enhance
the establishment of collateral circulation in
ischemic myocardium [19]. The main mecha-
Int J Clin Exp Med 2017;10(4):6158-6166
MiR-126 inhibits the proliferation of myocardial fibroblasts
nism of VEGF related to angiogenesis is its
specific effects on vascular endothelial cells,
inducing endothelial cell proliferation, sprouting, migration, and luminal formation [20].
Animal and clinical trials have demonstrated
that the expression of VEGF was increased in
myocardial infarction [21].
MiR 126 is specifically expressed in vascular
endothelial cells and vascular smooth muscle
cells and has an important role in the process
of angiogenesis through regulation of cell proliferation, differentiation, and apoptosis [22]. In
our research, we transfected miR-126 into CF
cells to assess the relationship between miR126 and VEGF in vivo. The injected miR 126
inhibitors contributed to an increased expression of α-smooth muscle actin α-SMA, cell proliferation marker proteins EDU but miR 126
mimics could effectively inhibited α-smooth
muscle actin α-SMA, cell proliferation marker
protein EDU and then reduced the CF cell proliferation in the acute myocardium injure model.
Further research discovered that miR 126 mimics could inhibited expression levels of EGFL7,
AKT, pAKT, ERK, Perk mRNA compared with CFs
group. Epidermal Growth Factor like domain 7
(Egfl7) also known as Vascular Endothelialstatin (VE-statin) codes for a gene mostly
expressed in endothelial cells [23]. Silencing
(knockdown) of the egfl7 gene in the zebrafish
inhibits vascular tubulogenesis and embryos
have little or no blood circulation [24]. The mice
which did not express egfl7 had various vascular defects and the observed phenotypes were
later attributed to the concomitant inactivation of the miR-126 locus [25]. Over-expression
of egfl7 specifically in endothelial cells in mice
induces embryonic lethality with head haemorrhages, cardiac defects and head and yolk sac
vasculature defects [26]. Therefore, there was
a potential therapy method for acute myocardial injure though activation of miRNA 126 to
down regular expression of gene egfl7 and to
further inhibit expression of EGF-like domaincontaining protein and to reduce myocardial
cell proliferation and to alleviate acute myocardial injure.
Address correspondence to: Yuping Cai, Department
of Fever Clinics, Linyi People’s Hospital of Eastern
Medical Area, No.233, Phoenix Street, Hedong District, Linyi 276000, Shandong Province, China. Tel:
0539-8216079; E-mail: Zhangjiaqi201207@163.
com
References
None.
White HD, Chew DP. Acute myocardial infarction. Lancet 2008; 372: 570-84.
[2] Yang G, Wang Y, Zeng Y, Gao GF, Liang X, Zhou
M. Rapid health transition in China, 19902010: findings from the global burden of disease study 2010. Lancet 2013; 381: 19872015.
[3] Lu ML, De Venecia T, Patnaik S, Figueredo VM.
Atrial myocardial infarction: a tale of the forgotten chamber. Int J Cardiol 2016; 202: 9049.
[4] Zangi L, Lui KO, Von GA, Ma Q, Ebina W, Ptaszek LM. Modifed mRNA directs the fate of
heartprogenitor cells and induces vascular regeneration after myocardial infarction. Nat Biotechnol 2013; 31: 898-907.
[5] Filipowicz W, Jaskiewicz L, Kolb FA, Pillai RS.
Post-transcriptional gene silencing by siRNAs
and miRNAs. Curr Opin Struct Biol 2005; 15:
331-41.
[6] Jing Q, Huang S, Guth S, Zarubin T, Motoyama
A, Chen J, Di Padova F, Lin SC, Gram H, Han J.
Involvement of microRNA in AU-rich elementmediated mRNA instability. Cell 2005; 120:
623-34.
[7] Wang F, Chen C, Wang D. Circulating microRNAs in cardiovascular diseases: from biomarkers to therapeutic targets. Front Med 2014; 8:
404-18.
[8] Boon RA, Dimmeler S. MicroRNAs in myocardial infarction. Nat Rev Cardiol 2015; 12: 13542.
[9] Fish JE, Santoro MM, Morton SU, Yu S, Yeh RF,
Wythe JD. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell 2008;
15: 272-84.
[10] Tom Donnem, Kenneth LonvikMSc, Bsc KE,
Berg T, Sorbye SW, Khalid Al-Shibli. Independent and tissue-specifc prognostic impact of
miR-126 in nonsmall cell lung cancer: coexpression with vascular endothelial growth factor-A predicts poor survival. Cancer 2011; 117:
3193-200.
[11] Dan C, Shi H, Kan Z, Yi L, Zhen G. RAD51 gene
135G/C polymorphism and the risk of four
types of common cancers: a meta-analysis. Diagn Pathol 2014; 9: 18.
[12] Hansen TF, Christensen RD, Andersen RF, Sørensen FB, Johnsson A, Jakobsen A. MicroRNA-126 and epidermal growth factor-like do-
6165
Int J Clin Exp Med 2017;10(4):6158-6166
In conclusion, miR-126 inhibits the proliferation
and differentiation of myocardial fibroblasts,
possibly, through increasing the expression of
EGFL7 activating AKT/ERK signaling pathway.
Disclosure of conflict of interest
[1]
MiR-126 inhibits the proliferation of myocardial fibroblasts
[13]
[14]
[15]
[16]
[17]
[18]
[19]
main 7-an angiogenic couple of importance in
metastatic colorectal cancer. Results from the
Nordic ACT trial. Br J Cancer 2013; 109: 124351.
Sasahira T, Kurihara M, Bhawal UK, Ueda N,
Shimomoto T, Yamamoto K. Downregulation of
miR-126 induces angiogenesis and lymphangiogenesis by activation of VEGF-A in oralcancer. Br J Cancer 2012; 107: 700-6.
Tang JM, Luo B, Xiao JH, Lv YX, Li XL, Zhao JH.
VEGF-A promotes cardiac stem cell engraftment and myocardial repair in the infarcted
heart. Int J Cardiol 2015; 183: 221-31.
Hsu A, Chen SJ, Chang YS, Chen HC, Chu PH.
Systemic approach to identify serum microRNAs as potential biomarkers for acute myocardial infarction. Biomed Res Int 2014; 2014:
418628.
Zaitone SA, Abo-Gresha NM. Rosuvastatin promotes angiogenesis and reverses isoproterenol-induced acute myocardial infarction in rats:
role ofiNOS and VEGF. Eur J Pharmacol 2012;
691: 134-42.
Siddiqui AJ, Gustafsson T, Sylven C, Crisby M.
Rosuvastatin inhibits TIMP-2 and promotes
myocardial angiogenesis. Pharmacology 2014;
93: 178-84.
Semenova AE, Sergienko IV, Masenko VP, Gabrusenko SA, Kukharchuk, VV, Iun B. [Effect of
rosuvastatin therapy and myocardial revascularization on angiogenesis in coronary arterydisease patients]. Kardiologiia 2007; 47: 4-8.
Li X, Zhang Y, Qi G. Evaluation of isolation
methods and culture conditionsfor rat bone
marrow mesenchymal stem cells. Cytotechnology 2013; 65: 323-34.
6166
[20] Qian X, Dong H, Hu X, Tian H, Guo L, Shen Q,
Gao X, Yao W. Analysis of the interferences in
quantitation of a site-specifcally PEGylated exendin-4 analog by the Bradford method. Anal
Biochem 2014; 465: 50-52.
[21] Kim SH, Moon HH, Kim HA, Hwang KC, Lee M,
Choi D. Hypoxia-inducible vascular endothelial
growth factor-engineered mesenchymal stem
cells prevent myocardialischemic injury. Mol
Ther 2011; 19: 741-50.
[22] Konopka A, Janas J, Piotrowski W, Stepinska J.
Concentration of vascular endothelial growth
factor in patients with acute coronary syndrome. Cytokine 2013; 61: 664-99.
[23] Nowak D, Kozlowska H, Gielecki JS, Rowinski
J, Zurada A, Goralczyk K. Cardiomyopathy in
the mouse model of Duchenne muscular dystrophy caused by disordered secretion of vascular endothelial growth factor. Med Sci Monit
2011; 17: BR332-38.
[24] Kranz A, Rau C, Kochs M, Waltenberger J. Elevation of vascular endothelial growth factor-A
serum levels following acute myocardial infarction. Evidence for its origin and functional signifcance. J Mol Cell Cardiol 2000; 32: 65-72.
[25] Carmeliet P. Angiogenesis in health and disease. Nat Med 2003; 9: 653-60.
[26] Wang S, Aurora AB, Johnson BA, Qi X, Mcanally
J, Hill J, Richardson J. The endothelial-specifc
microRNA miR-126 governs vascular integrity
and angiogenesis. Dev Cell 2008; 15: 261-71.
Int J Clin Exp Med 2017;10(4):6158-6166