1617
Journal of Cell Science 108, 1617-1627 (1995)
Printed in Great Britain © The Company of Biologists Limited 1995
Mapping the distribution of Golgi enzymes involved in the construction of
complex oligosaccharides
Catherine Rabouille, Norman Hui, Felicia Hunte, Regina Kieckbusch, Eric G. Berger*, Graham Warren and
Tommy Nilsson†
Cell Biology Laboratory, Imperial Cancer Research Fund, 44 Lincoln’s Inn Fields, London, WC2A 3PX, UK
*Present address: Physiologisches Institut, Universität Zürich, Switzerland
†Author for correspondence
SUMMARY
The distribution of β1,2 N-acetylglucosaminyltransferase I
(NAGT I), α1,3-1,6 mannosidase II (Mann II), β1,4 galactosyltransferase (GalT), α2,6 sialyltransferase (SialylT)
was determined by immuno-labelling of cryo-sections from
HeLa cell lines. Antibody labelling in the HeLa cell line was
made possible by stable expression of epitope-tagged forms
of these proteins or forms from species to which specific
antibodies were available. NAGT I and Mann II had the
same distribution occupying the medial and trans cisternae
of the stack. GalT and SialylT also had the same distribu-
tion but they occupied the trans cisterna and the transGolgi network (TGN). These results generalise our earlier
observations on the overlapping distribution of Golgi
enzymes and show that each of the trans compartments of
the Golgi apparatus in HeLa cells contains unique mixtures
of those Golgi enzymes involved in the construction of
complex, N-linked oligosaccharides.
INTRODUCTION
two adjacent cisternae was taken as evidence of cisternal duplication. This interpretation was supported by the observation
that the number of cisternae in the Golgi stack can vary widely
from tissue to tissue and from organism to organism (see
Fawcett, 1981). To investigate the possibility of cisternal
duplication, we examined, using immunogold electron
microscopy, the distribution of NAGT I and GalT in HeLa
cells. Each enzyme was found in two, adjacent cisternae but,
contrary to expectation, both were present in the trans cisterna
(Nilsson et al., 1993). In other words, the two enzymes had an
overlapping distribution such that each cisterna contained a
unique mixture of enzymes not a unique set. In order to generalise these observations and obtain further evidence against
cisternal duplication and in favour of each cisterna having a
unique composition, we have extended our observations to
other Golgi enzymes. To do this we have generated a series of
stable HeLa cell lines expressing either epitope-tagged
enzymes or ones to which antibodies were available.
The construction of complex, bi-antennary, N-linked oligosaccharides involves the sequential action of enzymes located in
different parts of the Golgi apparatus (for reviews, see Kornfeld
and Kornfeld, 1985; Roth, 1991). α1,2 mannosidase I continues
the trimming of mannose residues that started in the endoplasmic reticulum (ER) leaving a penta-mannose core to which the
first N-acetylglucosamine is added by β1,2 N-acetylglucosaminyltransferase I (NAGT I). α1,3-1,6 mannosidase II
(Mann II) removes two more mannose residues permitting
addition of the final N-acetylglucosamine by β1,2 N-acetylglucosaminyltransferase II. Each branch can then be elongated by
the addition of galactose by β1,4 galactosyltransferase (GalT)
and sialic acid by α2,6 sialyltransferase (SialylT). Fucose may
also be added prior to or following the addition of sialic acid.
GalT was the first of these enzymes to be localised, first to
the trans cisterna (Roth and Berger, 1982) and later to the
trans-Golgi network (TGN) (Lucocq et al., 1989; Nilsson et
al., 1993). SialylT was found to localise to the trans Golgi
cisterna and the TGN (Roth et al., 1985) and to have the same
distribution in most though not all cells (Roth et al., 1986).
NAGT I was found in medial cisternae (Dunphy et al., 1985)
as, more recently, was Mann II (Velasco et al., 1993). The
location of these enzymes strongly supported the idea that
proteins undergoing transport moved through the stack in a
cis to trans direction, sampling each of the compartments in
turn.
The fact that most of these enzymes were usually found in
Key words: Golgi apparatus, trans-Golgi network,
glycosyltransferase, mannosidase, TGN38
MATERIALS AND METHODS
Stable cell lines
HeLa cell lines expressing either human NAGT I (Kumar et al., 1990)
tagged with a myc-epitope or murine Mann II (Moremen and Robbins,
1991) have been described elsewhere (Nilsson et al., 1993, 1994).
Human SialylT (Grundmann et al., 1990) was tagged with a VSVG epitope (underlined) (Kreis, 1986; Soldati and Perriard, 1991) using
PCR (Saiki et al., 1988) to introduce the epitope immediately prior to
the stop codon. Primers used were:
1618 C. Rabouille and others
Table 1. Stable HeLa cell lines used in this study
Cell line
NAGT I-HeLa
Mann II-HeLa
SialylT-HeLa
TGN38/SialylT-HeLa SialylT
TGN38
Origin of expressed protein
Epitope tag
Human
Mouse
Human
Human
Rat
myc
None
VSV-G
VSV-G
None
Antibody used to detect the
stably-expressed protein(s)
Expression level relative
to endogenous protein*
9E.10 monoclonal
Polyclonal anti-murine Mann II
P5D4 monoclonal
P5D4 monoclonal
Polyclonal anti-rat TGN38
4-fold
6-fold
50 to 100-fold
10-fold
2.5-fold
*Measured by the increase in enzyme activity (NAGT I and SialylT) or by comparing the linear density of gold labelling over the Golgi with that in NRK cells
(Mann II and TGN38).
Parental HeLa cells were transfected with pSRα containing the appropriate cDNA and stable lines selected as described in Materials and Methods.
5′GTCGACGGATCCACCATGATTCACACCAACCTGAAG3′;
and
5′GTCGACGGATCCTTACTTTCCCAGCCTGTTCATCTCTATATCGGTGTAAGGGCAGTGAATGGTCCGGAAGCC3′.
The PCR product was sequenced and subcloned into the BamHI
site of pSRα (DNAX, Palo Alto, CA).
A full length cDNA encoding rat TGN38 (Luzio et al., 1990) was
digested with HindIII and complementary oligonucleotides encoding
a BamHI site were introduced immediately following the stop codon.
The complementary oligonucleotides were:
5′AGCTTTGAG3′ and 5′GATCCTCAA3′.
The coding region of TGN38 was then excised and subcloned into
the BamHI site of pCMUIV (Nilsson et al., 1989).
HeLa cells were transfected with tagged SialylT in pSRα either
alone or together with TGN38 in pCMUIV. Transfection and isolation
of stable lines was carried out essentially as described previously
(Nilsson et al., 1994). Table 1 summarises relevant properties of the
HeLa cell lines used.
Membrane fractionation and western blotting
SialylT-HeLa and TGN38/SialylT-HeLa cells were grown in
Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supplemented with 10% foetal calf serum, penicillin (100 µg/ml), streptomycin (100 µg/ml) and geneticin (500 µg/ml) (Gibco). Approximately
109 cells were used to isolate Golgi membranes (Balch et al., 1984)
which were purified at least 10-fold over homogenate assayed by
GalT activity (Bretz and Stäubli, 1977). Protein concentration was
determined using the BCA protein assay kit (Pierce Chemical Co,
Rockford, IL). SDS-PAGE was carried out essentially as described
by Blobel and Dobberstein (1975) and western blotting as described
previously (Nilsson et al., 1993). SialylT was assayed as described by
Dunphy et al. (1981) using asialo-transferrin as the substrate.
Immunogold electron microscopy
Cells were fixed either in 2% paraformaldehyde and 0.2% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, or in 0.5% glutaraldehyde in the same buffer containing 0.2 M sucrose and
processed as described previously (Rabouille et al., 1993). Briefly,
cells were embedded in 10% gelatine and small blocks were infused
with 2.3 M sucrose and frozen in liquid nitrogen. Ultra-thin cryosections were cut on an Ultracut E microtome with FC4E cryo-attachment and transferred onto collodion-carbon coated, copper or nickel,
100-mesh grids. All antibodies and gold conjugates were diluted in
0.5% fish skin gelatine in PBS.
The following primary antibodies were used: the 9E.10 mouse
monoclonal antibody which recognises the c-myc epitope (Evan et al.,
1985) at the C-terminus of NAGT I; a rabbit polyclonal antibody
recognising rat Mann II (Moremen et al., 1991); a rabbit polyclonal
antibody (N11) recognising human GalT (Watzele et al., 1991); the
P5D4 mouse monoclonal antibody which recognises the VSV-G tag
(Kreis, 1986; Soldati and Perriard, 1991) at the C-terminus of SialylT;
and a rabbit polyclonal antibody recognising rat TGN38 (Luzio et al.,
1990). Goat anti-mouse antibodies coupled to gold (Biocell Research
Laboratories, Cardiff, UK) were used to detect the primary monoclonal antibodies whereas goat anti-rabbit antibodies coupled to gold
(Biocell Research Laboratories, Cardiff, UK) or Protein A gold (from
Dept of Cell Biology, Utrecht School of Medicine, Utrecht, the
Netherlands) were used to detect primary polyclonal antibodies.
Two protocols were used for double-labelling experiments. When
one of the primary antibodies was a monoclonal and the other a polyclonal, they were mixed together for the initial incubation with the
section. Each of the secondary antibodies was then added sequentially
(Nilsson et al., 1993). When both antibodies were polyclonal, incubation with the first primary antibody was followed by goat anti-rabbit
or Protein A coupled to one size of gold. Sections were then fixed for
15 minutes in 4% paraformaldehyde and the second primary antibody
added followed by goat anti-rabbit or Protein A coupled to a different
size of gold (Slot et al., 1991).
Grids were stained with 2% neutral uranyl acetate and embedded
in 2% methyl cellulose containing 0.4% uranyl acetate as described
NAGT I
MannII
GalT
SialylT
TGN38
C
N
6
23
418
5
21
1124
N
C
N
C
24
20
354
9
17
380
C
N
N
C
34
19
287
Fig. 1. Topology of the hybrid proteins stably expressed in HeLa
cells. Parental HeLa cells were selected for stable expression of
NAGT I, Mann II, SialylT or TGN 38 (together with SialylT). The
topology of the endogenous GalT is presented for comparison. The
numbers (from left to right) refer to the length (not to scale) of the
cytoplasmic tail, the membrane-spanning domain, the lumenal
domain and the epitope tag (where present). Note that all the Golgi
enzymes are type II proteins whereas TGN38 is type I.
Mapping the distribution of resident Golgi proteins 1619
kDa
54
kDa
58
kDa
Fig. 2. Western blotting of the SialylT-HeLa and TGN38/SialylTHeLa cell lines. Golgi membranes were isolated from each cell line,
fractionated by SDS-PAGE, blotted and probed for TGN38 (lane3)
and/or SialylT (lanes 1 and 2). Equal amounts were loaded in each
lane.
by Tokuyasu (1980). Grids were examined at 80 kV using a Philips
CM10 electron microscope. Pictures were taken at a magnification of
15.5 or 21 K.
Quantitation
Definitions
The compartments of the Golgi apparatus were defined as described
previously (Nilsson et al., 1993; Ponnambalam et al., 1994). Briefly,
the trans or T cisterna is defined as the last continuous cisterna on the
side of the Golgi stack that labels for GalT. Since the Golgi stack in
HeLa cells typically contains three cisterna, the T-1 cisterna most likely
corresponds to the medial cisterna and the T-2 to the cis cisterna. The
T+1 compartment is the TGN and comprises a tubulo-reticular network
closely apposed to the trans face of the trans cisterna. It differs from
the CGN (T-3) in having clathrin-coated (Pearse and Robinson, 1990)
in addition to COP-coated buds. Clathrin coats have a different morphology and thickness to COP coats (Orci et al., 1984, 1985; Oprins et
al., 1993). Nevertheless, it was occasionally difficult to distinguish the
TGN from the CGN so double-labelling for GalT and the test enzyme
was used in preliminary experiments to define the polarity of the stack.
Relative distribution
The relative distribution of gold particles over the TGN and each
cisterna was estimated by counting the number of gold particles
falling within the boundary of each structure. The boundary of a
cisterna was defined as the cisternal membrane. The boundary of the
TGN was defined as the interface between the outermost membranes
of the tubulo-reticular network and the immediately adjacent
amorphous cytoplasm and was drawn on each micrograph. On
occasion this boundary would include profiles of budded vesicles
which were included in the quantitation whilst other structures (e.g.
vacuolar endosomes) were omitted.
Linear density
The linear density of gold particles/µm membrane was estimated as
described previously for the T, T-1 and T-2 cisternae (Nilsson et al.,
1993). The boundary of the TGN was drawn on each micrograph and
Fig. 3. Immunofluorescence microscopy of the SialylT-HeLa and
TGN38/SialylT-HeLa cell lines. (A) SialylT-HeLa cells were fixed,
permeabilised and labelled for SialylT. Note specific labelling of a
compact, juxta-nuclear reticulum. (B) TGN38/SialylT-HeLa cells
were fixed, permeabilised and labelled for TGN38. Note the punctate
labelling in addition to labelling of a compact, juxta-nuclear
reticulum. Bar, 10 µm.
the surface density was estimated by the point-hit method (Weibel,
1979; Ponnambalam et al., 1994). The length of every portion of
membrane within this boundary was estimated by the intersection
method (Weibel, 1979; Nilsson et al., 1993). Since the ratio of surface
density to length was found to be constant (0.062±0.02) between
different cell lines, the membrane length in most experiments was calculated from the surface density and this ratio.
The grid had a 5 mm spacing and the micrograph a final magnification that varied from 50 to 100 K. The linear density was calculated
by dividing the number of gold particles by the membrane length.
Indirect immunofluorescence
TGN38/SialylT-HeLa cells were grown to 70% confluency on cover
slips and incubated for 2 hours in the presence of 10 µg/ml cycloheximide. Cells were fixed and permeabilised essentially as described
by Louvard et al. (1982). Bound primary antibodies were visualised
using secondary antibodies coupled either to Texas Red (Vector Laboratories, Inc., Burlingame, CA) or FITC (Dakopatts, Copenhagen).
Cells were visualised using a Zeiss Axiophot Epifluorescence microscope and photographed directly using Ilford black and white film.
1620 C. Rabouille and others
RESULTS
Characterisation of the stable cell lines
GalT was the only endogenous enzyme under study that could
be readily detected in cryo-sections of HeLa cells using
affinity-purified antibodies to the deglycosylated protein
(Watzele et al., 1991). Detection of the other enzymes was
made possible by transfecting the parental HeLa cell line with
the PSRα plasmid containing the appropriate cDNA (see
Materials and Methods) and selecting stable cell lines in the
presence of geneticin. Clones were picked at random and
immunofluorescence microscopy was used to select those
clones expressing approximately equal amounts of protein in
all cells as described by Nilsson et al. (1994). Expressed
protein was detected using either specific polyclonal antibodies
or monoclonal antibodies to an epitope tag engineered onto the
C-terminus of the enzyme (Table 1). The structure and
topology of the proteins under study is summarised in Fig. 1.
Stable HeLa cell lines expressing NAGT I (Nilsson et al.,
1993) and Mann II (Nilsson et al., 1994) have been characterised previously. Cells expressing SialylT either alone or
together with TGN38 were characterised by western blotting.
As shown in Fig. 2 (lanes 1 and 2), Golgi membranes from
either cell line expressed a single protein of 54 kDa. This is
higher than the 47 kDa reported for the protein from rat liver
(Weinstein et al., 1987) and presumably reflects increased glycosylation in HeLa cells. The converse was true for TGN38 in
the TGN38/SialylT-HeLa cells. A single protein of 58 kDa was
expressed (Fig. 2, lane 3), lower than the 85-95 kDa reported
for the heterogeneously sialylated protein from NRK cells
(Luzio et al., 1990).
Immunofluorescence microscopy of these two cell lines also
gave the expected pattern. SialylT was localised to a compact
reticulum on one side of the nucleus in both SialylT-HeLa cells
(Fig. 3A) and TGN38/SialylT-HeLa cells (data not shown).
TGN38 was present in the same structure but also in punctate
structures throughout the cell cytoplasm which likely represent
peripheral endosomes (Ponnambalam et al., 1994) (Fig. 3B).
Table 2. Distribution of GalT and Sialyl T between the
Golgi stack and the TGN in different cell lines
Cell line
Enzyme
Total number of
gold particles/
Golgi apparatus
Parental-HeLa
Mann II -Hela
NAGT1-HeLa
SialylT-HeLa
GalT
GalT
GalT
GalT
SialylT
GalT
SialylT
35±15
40±19
38±17
36±21
44±30
34±11
3±1.5
TGN38/SialylT-HeLa
Percentage
distribution
of gold particles
(%)
Golgi stack
TGN
33±14
31±13
33±15
28±18
30±10
34±14
32
67±14
69±13
67±15
72±18
70±10
66±14
68
Cryo-sections from the different cell lines were labelled for either GalT or
SialylT. Gold particles (350 to 800) over 10 to 20 Golgi apparatus were
counted and the results expressed either as the total or as the percentage over
the Golgi stack or TGN ± s.e.m.
In the case of SialylT in the TGN38/SialylT-HeLa cell line the number of
gold particles was too few to permit an estimation of the s.e.m. In this case
the distribution of 78 gold particles in 30 cells from two experiments was
determined.
The expression levels relative to endogenous protein were
estimated in one of two ways and are summarised in Table 1.
For NAGT I and SialylT the activity of the enzyme was
measured and compared to the expression level of the endogenous protein in the parental HeLa cell line. Mann II activity
could not be estimated in the same way because there were too
many contaminating activities in whole cell homogenates. The
level was, therefore, estimated by immuno-gold microscopy
and compared with the level of the endogenous protein in NRK
cells. The same procedure was used for TGN38 which has no
known activity that could be measured.
The level of over-expression varied widely (Table 1). At the
lower end was TGN38 (2.5-fold), NAGT I (4-fold) and Mann
II (6-fold). At the higher end was SialylT which was expressed
10-fold over endogenous levels in the TGN38/SialylT-HeLa
cell line and 50-100-fold in the SialylT-HeLa cell line. Interestingly the difference in expression levels between these two
cell lines had no effect on the distribution of the protein within
the Golgi apparatus. As shown in Table 2, 68% of the SialylT
was present in the TGN in the TGN38/SialylT-HeLa cell line
compared with 70% in the SialylT-HeLa cell line. Similar
results were also obtained when the Mann II-HeLa cell line
was compared with another clone expressing the protein at a
3-fold lower level (2-fold over NRK cells) (data not shown).
The effect of expressed proteins on endogenous Golgi proteins
was determined by measuring the distribution of endogenous
GalT within the Golgi apparatus by immuno-gold microscopy.
In the parental cell line, 33±14% of the GalT was present in the
stack, the rest in the TGN. As shown in Table 2 this was not
changed significantly by stable expression of any of the proteins.
The level of GalT in the stack in the stable cell lines ranged from
28 to 34%. Furthermore, the level of GalT in each of the stable
cell lines was not affected by expression of any of the other
proteins since the total number of gold particles/Golgi apparatus
only varied between 34 and 40 (Table 2).
Immuno-gold microscopy
An extensive series of experiments was carried out to establish
the distribution of the four Golgi enzymes and TGN38. One of
them, GalT was used as the reference marker for each of the
others. We had earlier shown that the distribution of NAGT I
overlapped that of GalT (Nilsson et al., 1993); Mann II was
found to overlap the distribution of GalT in the exactly same
way (Fig. 4A) showing, by inference, that it had the same distribution as NAGT I. In contrast, Sialyl T had exactly the same
distribution as GalT (Fig. 4B).
To provide a more quantitative measure of the distribution,
we performed single labelling of all the cell lines and applied
a Stereological method described earlier (Nilsson et al., 1993)
in which the trans-most, or T cisterna of the stack was defined
as the last continuous cisterna on the side of the stack that
labelled for GalT. This cisterna was used as the reference
point for all other compartments. The T-1 and T-2 cisternae
most likely represent the medial and cis cisternae, respectively. This is because there are typically three cisternae in the
stack in HeLa cells (Nilsson et al., 1993). The T-3 compartment likely represents the CGN but was not readily identified
in many cross sections and was, for the most part, unlabelled
for any of the Golgi proteins under study. It was not considered further.
Mapping the distribution of resident Golgi proteins 1621
Fig. 4. Distribution of
Mann II/GalT and
SialylT/GalT by double
label immunogold
microscopy. Thin frozen
sections of (A) Mann IIHela or (B) SialylTHeLa cells were doublelabelled so as to reveal
the location of (A) Mann
II (15 nm Protein A
gold) and GalT (10 nm
Protein A gold); (B)
GalT (goat anti-rabbit
coupled to 5 nm gold)
and SialylT (goat antimouse coupled to 10 nm
gold). In A, note that
GalT is present in the
TGN (asterisk) and the
trans cisterna,
overlapping the
distribution of Mann II,
which is found in the
trans and medial
cisternae. In contrast, in
B, GalT co-distributes
with SialylT, being
present in both the trans
cisterna and the TGN
(asterisk). The primary
antibodies are listed in
Materials and Methods
and Table 1. Tubular
extensions (small
arrows, Klumperman et
al., 1993) of vacuolar
endosome (E) are not
labelled. They can be
distinguished from the
COP-coated vesicles
(large arrows, Oprins et
al., 1993) due to their
denser content and their
lack of coat. N, nuclear
envelope; M,
mitochondrion; G, Golgi
cisternae. Bar, 200 nm.
1622 C. Rabouille and others
Mapping the distribution of resident Golgi proteins 1623
The T+1 compartment represents the TGN which is a pleomorphic structure comprising flattened, cisternal elements
abutting the trans cisterna linked to extensive tubulo-reticular
elements that emanate a considerable distance from the stack.
This structure was quantitated as described in Materials and
Methods.
Fig. 5. Distribution of the stably expressed proteins by single label immunogold microscopy. Thin frozen sections of the stable HeLa cell lines
listed in Table 1 were labelled so as to reveal the location of: (A) NAGT I (goat anti-mouse coupled to 10 nm gold); (B) Mann II (10 nm
Protein A gold); (C) SialylT (goat anti-mouse coupled to 10 nm gold); and (D) TGN38 (goat anti-rabbit coupled to 10 nm gold). Note that in A
and B, the gold is mainly restricted to the stacked Golgi cisternae (G) whereas, in C and D, the vast majority is over the TGN (asterisks). The
primary antibodies are listed in Materials and Methods and Table 1. E, vacuolar endosome; ER, endoplasmic reticulum; M, mitochondrion; N,
nuclear envelope. Bars, 200 nm.
1624 C. Rabouille and others
Distribution of NAGT I and Mann II
Labelling for NAGT I was restricted almost exclusively to the
Golgi stack with little label over the TGN or other membrane
compartments (Fig. 5A). More than 65% of the labelling (Fig.
6A) was present over two adjacent cisternae on the trans side
of the stack (Nilsson et al., 1993). Mann II was also present
over two cisternae on one side of the stack (Fig. 5B) which
was shown to be the trans side by double-labelling for GalT
(Fig. 4A). More than 75% of the labelling was present over the
medial and trans cisternae (Fig. 6A).
The linear density of labelling for both NAGT I and Mann
II in the medial and trans cisternae was at least 2 times higher
than in the cis cisterna and 5-7 times higher than in the TGN
(Fig. 6B).
Distribution of GalT and SialylT
Labelling for both SialylT (Fig. 5C) and GalT was restricted
to the trans cisterna and the TGN. There was little labelling
over the medial or cis cisternae. About 20% of labelling for
GalT and SialylT was present in the trans cisterna and about
70% in the TGN (Fig. 6A). The co-distribution of these two
enzymes was confirmed by double-labelling SialylT-HeLa
cells for both GalT and SialylT (Fig. 4B).
Quantitation showed that the linear density of both GalT and
SialylT in the trans cisterna was about 4.5 times that in the
medial cisterna and about 20 times that in the cis cisterna (Fig.
6B). The average linear density in the TGN was lower than
that in the trans cisterna even though it contained about 70%
of both enzymes. This is because the TGN has a much longer
membrane length.
Distribution of TGN38
TGN38 was originally described as a marker for the TGN in
NRK cells (Luzio et al., 1990) and, when expressed either transiently at low levels (Ponnambalam et al., 1994) or stably (Fig.
5D) in HeLa cells, it is also present almost exclusively in the
TGN. As shown in Fig. 6A, fully 90% of TGN38 was present
in the TGN in the TGN38/SialylT-HeLa cell line. The linear
density in the TGN was 7 times higher than that in the trans
cisterna and 30 times higher than in the medial cisterna. None
could be detected in the cis cisterna (Fig. 6B).
DISCUSSION
The work described in this paper both confirms and extends
our earlier observations on the overlapping distribution of
NAGT I and GalT (Nilsson et al., 1993) to include both Mann
II and SialylT. The four enzymes fell into two groups: NAGT
I co-distributed with Man II whereas GalT co-distributed with
SialylT. The overlap was in the trans cisterna which had all
four enzymes.
Fig. 6. Quantitative distribution of GalT and the stably expressed
proteins. Proteins were localised as described in Table 2 and Fig. 4
and the distribution of gold particles over the TGN, T (trans), T-1
(medial) and T-2 (cis) cisternae was determined and expressed either
as a relative distribution (A) or a linear density (B). 250-1200 gold
particles were counted over 15-20 Golgi apparatus in two separate
experiments and two grids and the results are presented as the mean
± s.e.m.
Stable cell lines
As before, considerable care was taken to ensure that the stably
expressed protein had the same distribution in HeLa cells as
the endogenous protein and did not alter the distribution of
other Golgi enzymes. First, the origin of the cDNAs was either
human (NAGT I, SialylT) or a closely related mammal (Mann
II - murine, TGN38 - rat). The sequence similarity between
Golgi enzymes from different mammals is typically in excess
of 90% (for review, see Kleene and Berger, 1993). Second, the
epitope tag, when present, was placed at the C-terminus, as far
away as possible from the membrane-spanning domain that
Mapping the distribution of resident Golgi proteins 1625
contains the signal for retention (for references, see Machamer,
1993). Third, the level of expression was in all but one case
less than or equal to 10 times the level of the endogenous
protein. Since none of the Golgi enzymes constitute more than
a few per cent of Golgi membrane, such an increase could reasonably be expected to have a minimal effect on the distribution of the protein. In fact, the one exception showed that considerable over-expression had no effect on the distribution.
SialylT was expressed at 10 times the endogenous level in
TGN38/SialylT-HeLa cells but at 50-100 times in SialylTHeLa cells, yet the distribution of SialylT between the trans
cisterna and the TGN was almost exactly the same in both cell
lines (Table 1). Lastly, the distribution of GalT was checked
in each of the stable cell lines. The results showed clearly that
none of the stably expressed proteins affected the distribution
of at least this one Golgi protein.
Co-distribution of enzymes
The co-distribution of NAGT I and Mann II is in agreement
with earlier work. Relocation of NAGT I to the ER by attachment of an ER retrieval signal causes accumulation of Mann II
in the ER, and relocation of Mann II has a similar effect on
NAGT I pointing to a very specific association between these
two enzymes (Nilsson et al., 1994). When rat liver Golgi stacks
are extracted with Triton X-100, most of the NAGT I and Mann
II remain in the Triton pellet whereas most of the markers from
other parts of the Golgi are released into the supernatant
(Slusarewicz et al., 1994). Even earlier work showed that
NAGT I and Mann II co-fractionated on sucrose gradients as
did GalT and SialylT, but at a lower density of sucrose (Dunphy
and Rothman, 1983; Goldberg and Kornfeld, 1983). Interestingly, the two sets of peaks overlapped in agreement with the
overlap of all four enzymes in the trans cisterna. At that time
the aim was to show that Golgi enzymes were in separate compartments so the overlap was either ignored or put down to a
limitation in the resolution of the technique.
The co-distribution of GalT and SialylT agrees with most
but not all published work. Though early biochemical studies
showed that both enzymes co-fractionated on sucrose gradients
(Dunphy and Rothman, 1983), studies on recycling proteins
suggested that they were in different compartments (Duncan
and Kornfeld, 1988; Huang and Snider, 1993). This discrepancy might reflect the fact that CHO cells were used for these
experiments and there is evidence in this cell line that GalT
and SialylT are in different compartments (Chege and Pfeffer,
1991). It will be important to confirm this using the approach
we have used for HeLa cells.
Earlier microscopic studies, both immuno-gold and
immunofluorescence, also suggested that GalT and SialylT
were present in different compartments (see Berger et al., 1993,
for references) but this discrepancy was due, at least in part, to
the use of antibodies that recognised oligosaccharides as well
as the enzyme polypeptide chain. The most recent immunofluorescence data show that GalT and SialylT co-localise almost
entirely at the immunofluorescence level (Berger et al., 1993)
and the data presented in this paper, also using antibodies to
the polypeptide chain of GalT, show exact co-localisation by
high resolution immuno-gold microscopy.
Mechanism of overlap
The mechanism that generates the overlapping distribution is
unclear but one possibility relates to the recent finding that
selective re-distribution of NAGT I and Mann II from the
Golgi to the ER resulted in the disappearance of the Golgi stack
(Nilsson et al., 1994). This strongly suggests that these
enzymes (and perhaps others in the same cisternae) are
involved in maintaining the structure of the stack. A simple
model would be for these enzymes to interact with each other
across the intercisternal space which means that they would
have to be present in adjacent cisternae. The overlapping distribution of Golgi enzymes would, therefore, reflect the
stacking mechanism of Golgi cisternae. A simple functional
consequence of this arrangement is that transported proteins
would meet the same set of enzymes twice. If they failed to be
modified the first time, there would be a second chance.
Though the majority of enzyme was present in two adjacent
compartments there was often significant amounts in the
flanking cisternae. One possibility is that these enzymes
represent that portion of the protein being recycled. No
retention mechanism is perfect and enzymes might be expected
to leak into transport vesicles. These might then be recycled as
has been shown for both soluble and membrane proteins of the
ER (for review, see Nilsson and Warren, 1994). There are
several Golgi proteins that appear to recycle though the
retrieval signal has not been identified (Alcalde et al., 1994;
Johnston et al., 1994). Another possibility is that overlapping
enzymes interact weakly with each other. As an example, relocation of NAGT I to the ER not only caused re-location of
Mann II but also some of the GalT (Nilsson et al., 1994). The
presence of some GalT and SialylT in the medial cisterna
might then be explained by such an interaction. One last possibility is that the distribution is the consequence of a retention
mechanism based on the increasing thickness of the lipid
bilayer through the Golgi stack (Bretscher and Munro, 1993).
Golgi enzymes would move until the length of the spanning
domain matched the thickness of the bilayer. The increment in
thickness might, however, be sufficiently small to permit accumulation in several adjacent and flanking cisternae.
Conclusions
Continued mapping of the Golgi apparatus in HeLa cells has
strengthened the idea that it is a precisely defined structure.
The Golgi enzymes involved in the construction of complex,
N-linked oligosaccharides are not restricted to single cisternae
but, so far, they are restricted to two adjacent ones. The overlapping distribution may reflect the structural organisation of
the stack. It is, however, clear that the distribution of Golgi
enzymes does vary from tissue to tissue and from organism to
organism (Roth et al., 1986; Velasco et al., 1993). This
suggests that the mechanism governing the localisation of
Golgi enzymes is subject to another layer of control. The most
obvious would be post-translational modifications such as
phosphorylation, and work is presently underway to test this
possibility.
We are indebted to Dr Paul Luzio (Cambridge, UK) and Dr George
Banting (Bristol, UK) for kindly providing us with the cDNA and
antibodies for TGN38; Dr Thomas Kreis (Geneva, Switzerland) for
the P5D4 hybridoma; Dr Kelley Moremen (Athens, Georgia) for
Mann II polyclonal antibodies; and Dr Sean Munro (Cambridge, UK)
for cDNA encoding SialylT. We also thank the oligosynthesis facility
at Clare Hall for high quality oligonucleotides; the photography
1626 C. Rabouille and others
department for high quality reproductions; and Drs Tom Misteli, Vas
Ponnambalam and Francis Barr for critical comments and helpful discussions.
REFERENCES
Alcalde, J., Egea, G. and Sandoval I. V (1994). gp74 a membrane
glycoprotein of the cis-Golgi network that cycles through the endoplasmic
reticulum and intermediate compartment J. Cell Biol. 124, 649-665.
Balch, W. E., Dunphy, W. G, Braell, W. A. and Rothman, J. E. (1984).
Reconstitution of the transport of protein between successive compartments
of the Golgi measured by the coupled incorporation of N-acetylglucosamine.
Cell 39, 405-16.
Blobel, G. and Dobberstein. B. (1975). Transfer of proteins across
membranes. I. Presence of proteolytically processed and unprocessed
nascent immunoglobulin light chains on membrane-bound ribosomes of
murine myeloma. J. Cell Biol. 67, 835-51.
Berger, E. G., Grimm, K., Bächi, T., Bosshart, H., Kleene, R. and Watzele,
M. (1993). Double immunofluorescence staining of α2, 6 sialyltransferase
and β1, 4 galactosyltransferase in monensin treated cells: Evidence for
different Golgi compartments? J. Cell. Biochem. 52, 275-288.
Bretscher, M. S. and Munro, S. (1993). Cholesterol and the Golgi apparatus.
Science 261, 1280-1.
Bretz, R. and Stäubli, W. (1977). Detergent influence of rat liver
galactosyltransferase activities towards different acceptors. Eur. J. Biochem.
77, 181-192.
Chege, N. W. and Pfeffer, S. R. (1990). Compartmentation of the Golgi
complex: Brefeldin-A distinguishes trans Golgi cisternae from the trans
Golgi network. J. Cell Biol. 111, 893-899.
Duncan, J. R. and Kornfeld, S. (1988). Intracellular movement of two
mannose-6-phosphate receptors: Return to the Golgi apparatus. J. Cell Biol.
106, 617-628.
Dunphy, W. G., Fries, E., Urbani, L. J. and Rothman, J. E. (1981). Early and
late functions associated with the Golgi apparatus reside in distinct
compartments Proc. Nat. Acad. Sci. USA 78, 7453-7457.
Dunphy, W. G. and Rothman, J. E. (1983). Compartmentation of asparaginelinked oligosaccharides processing in the Golgi apparatus. J. Cell Biol. 97,
270-275.
Dunphy, W. G., Brands, R. and Rothman, J. E (1985). Attachment of
terminal N-acetylglucosamine to asparagine-linked oligosaccharides occurs
in central cisternae of the Golgi stack. Cell 40, 463-72.
Evan, G. I., Lewis, G. K., Ramsay, G. and Bishop, J. M. (1985). Isolation of
monoclonal-antibodies specific for human c-myc proto-onco-gene product.
Mol. Cell. Biol. 5, 3610-3616.
Fawcett, D. W. (1981). The Cell. 2nd edn. W. B. Saunders Company,
Philadelphia, PA 19105, USA.
Goldberg, D. E. and Kornfeld, S. (1983). Evidence for extensive subcellular
organisation of asparagine-linked oligosaccharide processing and lysosomal
enzyme phosphorylation. J. Biol. Chem. 258, 3159-65.
Grundmann, U. G., Nerlich, C., Rein, T. and Zettlmeissl, G. (1990).
Complete cDNA sequence encoding human β-galactoside α-2, 6sialyltransferase. Nucl. Acids Res. 18, 667.
Huang, K. M. and Snider, M. D. (1993). Glycoprotein recycling to the
galactosyltransferase compartment of the Golgi complex J. Biol. Chem. 268,
9302-9310.
Johnston, P. A., Stieber, A. and Gonatas, N. K (1994). A hypothesis on the
traffic of MG160, a medial Golgi sialoglycoprotein, from the trans-Golgi
network to the Golgi cisternae J. Cell Sci. 107, 529-537.
Kleene, R. and Berger, E. G. (1993). The molecular and cell biology of
glycosyltransferases. Biochim. Biophys. Acta. 1154, 283-325.
Klumperman, J., Hille, A., Veenendaal, T., Oorschot, V., Stoorvogel, W.,
von Figura, K. and Geuze, H. J. (1993). Differences in the endosomal
distributions of the two mannose-6-phosphate receptors. J. Cell Biol. 121,
997-1010.
Kreis, T. E. (1986). Microinjected antibodies against the cytoplasmic domain
of vesicular stomatitis virus glycoprotein block its transport to the cell
surface. EMBO J. 5, 931-941.
Kornfeld, R. and Kornfeld, S. (1985). Assembly of asparagine-linked
oligosaccharides. Annu. Rev. Biochem. 50, 631-664.
Kumar, R., Yang, J., Larsen, R. D. and Stanley, P. (1990). Cloning and
expression of N-acetylglucosaminyltransferase I, the medial Golgi
transferase that initiates complex N-linked carbohydrate formation. Proc.
Nat. Acad. Sci. USA 87, 9948-52.
Louvard, D., Reggio, H. and Warren, G. (1982). Antibodies to the Golgi
complex and the rough endoplasmic reticulum. J. Cell Biol. 92, 92-107.
Lucocq, J. M., Berger, E. G. and Warren, G. (1989). Mitotic Golgi fragments
in HeLa cells and their role in the reassembly pathway. J. Cell Biol. 109, 463474.
Luzio, J. P., Brake, B., Banting, G., Howell, K. E., Braghetta, P. and
Stanley. K. K. (1990). Identification, sequencing and expression of an
integral membrane protein of the trans-Golgi network (TGN38). Biochem. J.
270, 97-102.
Machamer, C. E. (1993). Targeting and retention of Golgi membrane proteins.
Curr. Opin. Cell Biol. 5, 606-12.
Moremen, K. W. and Robbins, P. W. (1991). Isolation, characterisation, and
expression of cDNAs encoding murine α-mannosidase II, a Golgi enzyme
that controls conversion of high mannose to complex N-glycans. J. Cell.
Biol. 115, 1521-34.
Moremen, K. W., Touster, O. and Robbins, P. W. (1991). Novel purification
of the catalytic domain of Golgi α-mannosidase II. Characterisation and
comparison with the intact enzyme. J. Biol. Chem. 266, 16876-85.
Nilsson, T., Jackson, M. and Peterson, P. A. (1989). Short cytoplasmic
sequences serve as retention signals for transmembrane proteins in the
endoplasmic reticulum. Cell 58, 707-18.
Nilsson, T., Pypaert, M., Hoe, M. H., Slusarewicz, P., Berger, E. G. and
Warren, G. (1993). Overlapping distribution of two glycosyltransferases in
the Golgi apparatus of HeLa cells. J. Cell Biol. 120, 5-13.
Nilsson T., Hoe, M. H., Slusarewicz, P., Rabouille, C., Watson, R., Hunte,
F., Watzele, G., Berger, E. G. and Warren, G. (1994). Kin recognition
between medial Golgi enzymes in HeLa cells. EMBO J. 13, 562-74.
Nilsson, T. and Warren, G. (1994). Retention and retrieval in the endoplasmic
reticulum and the Golgi apparatus. Curr. Opin. Cell Biol. 6, 517-521.
Oprins, A., Duden, R., Kreis, T. E., Geuze, H. J. and Slot, J. W. (1993). βCOP localises mainly to the cis-Golgi side in exocrine pancreas. J. Cell Biol.
121, 49-59.
Orci, L., Halban, P., Amherdt, M., Ravazzola, M., Vassalli, J. D. and
Perrelet, A. (1984). A clathrin-coated, Golgi-related compartment of the
insulin secreting cell accumulates proinsulin in the presence of monensin.
Cell 39, 39-47.
Orci, L., Ravazzda, M., Amherdt, M., Louvard, D. and Perrelet, A. (1985).
Clathrin-immunoreactive sites in the Golgi apparatus are concentrated at the
trans pole in polypeptide hormone-secreting cells. Proc. Acad. Nat. Sci. USA
92, 5385-5389.
Pearse, B. M. and Robinson, M. S. (1990). Clathrin, adaptors, and sorting.
Annu. Rev. Cell Biol. 6, 151-171.
Ponnambalam, S., Rabouille, C., Luzio, J. P., Nilsson, T. and Warren, G.
(1994). The TGN38 glycoprotein contains two non-overlapping signals that
mediate localisation to the trans-Golgi network. J. Cell Biol. 125, 253-268.
Rabouille, C., Strous, G. J., Crapo, J. D., Geuze, H. J. and Slot, J. W.
(1993). The differential degradation of two cytosolic proteins as a tool to
monitor autophagy in hepatocytes by immunocytochemistry. J. Cell Biol.
120, 897-908
Roth, J. and Berger, E. G. (1982). Immunocytochemical localisation of
galactosyltransferase in HeLa cells: codistribution with thiamine
pyrophosphatase in trans-Golgi cisternae. J. Cell Biol. 93, 223-229.
Roth, J., Taatjes, D. J., Lucocq, J. M., Weinstein, J. and Paulson, J. C.
(1985). Demonstration of an extensive trans-tubular network continuous
with the Golgi apparatus stack that may function in glycosylation. Cell 43,
287-295.
Roth, J., Taatjes, D. J., Weinstein, J., Paulson, J. C., Greenwell, P. and
Watkins, W. M. (1986). Differential subcompartmentation of terminal
glycosylation in the Golgi apparatus of intestinal absorptive and goblet cells.
J. Biol. Chem. 261, 14307-12.
Roth, J. (1991). Localisation of glycosylation sites in the Golgi apparatus using
immunolabeling and cytochemistry. J. Electron Microsc. Tech. 17, 121-31.
Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.
T. and Erlich, H. A. (1988). Primer-directed enzymatic amplification of
cDNA with a thermostable DNA polymerase. Science 239, 487-491.
Slot, J. W., Geuze, H. J., Gigengack, S., Lienhard, G. E. and James, D. E.
(1991). Immunolocalisation of the insulin regulatable glucose transporter in
brown adipose tissue of the rat. J. Cell Biol. 113, 123-135.
Slusarewicz, P., Nilsson, T., Hui, N., Watson, R. and Warren, G. (1994).
Isolation of an intercisternal matrix that binds medial Golgi enzymes. J. Cell
Biol. 124, 405-414.
Soldati, T. and Perriard, J. C. (1991). Intracompartmental sorting of essential
Mapping the distribution of resident Golgi proteins 1627
myosin light chains: molecular dissection and in vivo monitoring by epitope
tagging. Cell 66, 277-89.
Tokuyasu, K. T. (1980). Immunochemistry on ultrathin frozen sections.
Histochem. J. 12, 381-403.
Velasco, A., Hendricks, L., Moremen, K. W., Tulsiani, D. R. P., Touster, O.
and Farquhar, M. G. (1993). Cell type-dependent variations in the
subcellular distribution of α-mannosidase I and II. J. Cell Biol. 122, 39-51.
Watzele, G., Bachofner, R. and Berger, E. G. (1991). Immunocytochemical
localisation of the Golgi apparatus using protein-specific antibodies to
galactosyltransferase. Eur. J. Cell Biol. 56, 451-8.
Weibel, E. R. (1979). Stereological Methods. I. Practical Methods for
Morphometry. Academic Press, London.
Weinstein, J., Lee, E. U., McEntee, K., Lai, P. H. and Paulson, J. C. (1987).
Primary structure of β-galactoside α2, 6-sialyltransferase. Conversion of
membrane-bound enzyme to soluble forms by cleavage of the NH2-terminal
signal anchor. J. Biol Chem. 262, 17735-43.
(Received 13 December 1994 - Accepted 18 January 1995)