Acta Biochim Biophys Sin 2012, 44: 162– 171 | ª The Author 2011. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the
Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DOI: 10.1093/abbs/gmr102.
Advance Access Publication 7 December 2011
Original Article
Two novel cis-elements involved in hepatocyte nuclear factor 4a regulation
of acyl-coenzyme A:cholesterol acyltransferase 2 expression
Zhuqin Zhang, Jinjing Liu, Yang Xi, Ruifeng Yang, Houzao Chen, Zhenya Li, Depei Liu*, and Chihchuan Liang
National Laboratory of Medical Molecular Biology, Institute of Basic Medical Science, Chinese Academy of Medical Sciences,
Beijing 100005, China
*Correspondence address. Tel: þ86-10-65296415; Fax: þ86-10-65105093; E-mail: [email protected]
Acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2)
is important for cholesterol ester synthesis and secretion.
A previous study revealed that ACAT2 gene promoter
activity was upregulated by hepatocyte nuclear factor 4a
(HNF4a) through two sites around 2247 and 2311 of
ACAT2 gene promoter. Here, we identified two novel ciselements, site I (21006 to 2898) and site II (238 to
229), which are important for HNF4a effect. In HepG2
cells, mutation of site I decreased ACAT2 gene promoter
activity to one-fifth of that of the wild type, while mutation of site II reduced promoter activity to less than onetenth of that of the wild type. In 293T cells, mutation of
these two cis-elements profoundly impaired the HNF4a
induction effect. When either of these two elements was
inserted into pGL3-promoter, HNF4a induced promoter
activity through the inserted element, while mutation of
the element impaired HNF4a induction effect. In electrophoretic mobility shift assay and chromatin immunoprecipitation experiment, HNF4a bound to these two
elements. Thus, the two cis-elements are important for
HNF4a effect on ACAT2 gene transcription. We also
showed that HNF4a positively regulates ACAT2 gene expression at mRNA level. Overexpression of HNF4a
increased ACAT2 expression, whereas knockdown of
HNF4a decreased ACAT2 expression. Peroxisome proliferator-activated receptor gamma coactivator 1a
(PCG1a), a coactivator of HNF4a, increased ACAT2 expression, while small heterodimer partner (SHP), a corepressor of HNF4a, decreased ACAT2 expression. These
results provide more insights into transcriptional regulation of ACAT2 expression.
Keywords
SHP
ACAT2; gene expression; HNF4a; PGC1a;
Received: August 25, 2011
Accepted: September 30, 2011
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 162
Introduction
Acyl-coenzyme A:cholesterol acyltransferase (ACAT)
family is an important enzyme family involved in cholesterol metabolism. ACAT converts cholesterol and fatty
acyl-coenzyme A to cholesterol esters, which are packaged
into very-low-density lipoprotein (VLDL). The ACAT
family consists of two members, ACAT1 and ACAT2.
While ACAT1 is widely expressed in different tissues,
ACAT2 is mainly expressed in the liver and intestine. Liver
ACAT2 catalyzes the formation of cholesterol esters,
which, together with apolipoprotein B (ApoB), are
assembled into VLDL and secreted into the blood [1–3].
In cells, overexpression of ACAT2 increases cholesterol
ester secretion in ApoB-containing lipoproteins [4,5]. In
mice, liver-specific downregulation of ACAT2 leads to
reduced packaging of cholesterol into ApoB-containing
lipoproteins [6]. In addition, ACAT2 deficiency in mice
significantly decreases the percentage of cholesterol ester
in VLDL [7]. ACAT2 is regarded as an important target for
hypercholesterolemia [8]. Thus, ACAT2 and the regulation
of ACAT2 levels are important for lipid metabolism.
Hepatocyte nuclear factor 4a (HNF4a) is a liverenriched transcription factor that has an important function
in liver development and metabolism [9,10]. Total HNF4a
knockout in mice is embryonic lethal [11]. Liver-specific
HNF4a knockout mice display defective lipid homeostasis
as evidenced by lipid accumulation in the liver and
reduced triglyceride levels in the plasma [12]. In
maturity-onset diabetes of the young-1 (MODY-1) patients,
mutation of HNF4a causes hypolipidemia [13], indicating
an essential role for HNF4a in lipid metabolism in
humans. HNF4a, which belongs to the nuclear receptor
family, consists of a DNA-binding domain that binds to
HNF4a response elements and a ligand-binding domain
that is necessary for ligand binding, dimerization, and
Two novel cis-elements for HNF4a regulation of ACAT2
transactivation [14]. As a transcription factor, HNF4a binds
to its response element, CAAAGTNCA [15], and regulates
transcription of many diverse downstream genes involved
in lipid metabolism, such as apolipoproteins [16,17],
VLDL assembling protein, and the microsomal triglyceride
transfer protein (MTP) [18].
Peroxisome proliferator-activated receptor gamma coactivator 1a (PGC1a) is an emerging coactivator that plays an
extensive role in glucose, lipid, and bile-acid metabolism
[19–22]. PGC1a interacts with many nuclear receptors
through an LXXLL motif [23]. PGC1a strongly interacts
with HNF4a and coactivates transcription of genes involved
in glucose metabolism, such as phosphoenolpyruvate carboxykinase and glucose-6-phosphatase [24], and in lipid
metabolism, including ApoAIV, ApoCII, and ApoCIII [20].
In contrast to PGC1a, small heterodimer partner (SHP) acts
as a corepressor protein that inhibits the transcriptional activity of diverse nuclear receptors [25]. SHP has been
shown to interact with HNF4a and inhibits its transcriptional activity on multiple downstream target genes such as
CYP7A1, the rate-limiting enzyme for bile acid biosynthesis [26], and MTP, which is important for VLDL assembly and secretion [27]. Thus, both PGC1a and SHP play an
important regulatory role in HNF4a transcriptional activity.
Due to the importance of hepatic ACAT2 in cholesterol
ester and lipid metabolism, revealing the underlying mechanism behind transcriptional regulation of ACAT2 expression is important. A previous report showed that in
luciferase reporter assay ACAT2 gene promoter activity is
upregulated by HNF4a through two sites around 2247
and 2311 [28]. Here we revealed two novel cis-elements
responsible for HNF4a induction effect. Mutation of the
two cis-elements profoundly impairs the functions of
HNF4a. We showed that in addition to promoter activity,
ACAT2 gene expression at mRNA level is also induced by
HNF4a. Our results provide more insights for the transcriptional control of ACAT2 expression.
Materials and Methods
Materials and reagents
The anti-HA (H3663) and anti-b-actin (A5441) antibodies
were purchased from Sigma-Aldrich (St Louis, USA). The
anti-HNF4a (sc-8987), anti-myc (sc-40), and anti-PGC1a
(sc-13067) antibodies were from Santa Cruz Biotechnology
(Santa Cruz, USA). HepG2, HuH7, and 293T cells were
obtained from ATCC (Manassas, USA) and were grown in
Dulbecco’s modified Eagle’s medium medium supplemented with 10% fetal bovine serum.
Plasmids and constructs
The luciferase reporter plasmid pGL3-hACAT2-1299,
which spans the region 21299 to þ8 of the human
ACAT2 gene promoter, was a kind gift from Prof. Li
(Shanghai Institute of Biochemistry and Cell Biology,
China) [29]. The pcDNA3.1-HNF4a (gift from Dr Darnell,
Rockefeller University) [9], pcDNA3.1-PGC1a (gift from
Dr Puigserver, Johns Hopkins University School of
Medicine) [30], and pcDNA3.1-HA-SHP (gift from
Dr Choi, Chonnam National University, Korea) [31]
expression plasmids were used in the experiments. HNF4a
cDNA was inserted into the pcDNA4-myc-hisB vector to
construct pcDNA4-myc-HNF4a. The sequence of the
siRNA targeting HNF4a (siHNF4a) was AACCACAU
GUACUCCUGCAGA [32,33]. siRNA targeting green
fluorescent protein (GFP) (siGFP), with a sequence of
GAACGGCAUCAAGGUGAAC, was used as a negative
control. The siGFP and siHNF4a templates were inserted
into the BamHI and EcoRI restriction sites of
pSiren-RetroQ to construct pSiren-RetroQ-siGFP and
pSiren-RetroQ-siHNF4a, respectively.
The 50 deletion mutants of the ACAT2 gene promoter
were polymerase chain reaction (PCR) amplified using
pGL3-hACAT2-1299 as a template and the following upstream primers: AGTCCGACGCGTGACACAAAGGGA
GGGGAAGGATTAA (2897 fragment), AGTCCGAC
GCGTAAGCGAGCTGAACGCACTGATACA
(2365
fragment), and AGTCCGACGCGTGTGTGTGGCGGGG
TGGATAGC (2208 fragment) and the downstream primer
AGTCGGAAGATCTTGTCCCACTCAGCTCAGGTGAC
(underlined sequences indicate enzymatic sites). Using the
two-step mutagenesis method described previously [34],
the HNF4a response element site I were mutated from
TGATCTTTGGAC to gtATaTTgtGAC, and site II was
mutated from AGGACTTTAGTCT to AGGAtcccAGTtT.
Luciferase reporter assay
The luciferase reporter assay was carried out as follows.
HepG2 cells, HuH7 cells, 293T cells, or HeLa cells were
grown to 70% confluence and transfected using
Lipofectamine 2000. Luciferase reporter plasmids with
expression plasmids were transfected into cells in 24-well
plates with the internal control phRL-TK. After 36 h, cells
were collected. Luciferase activity was assessed with the
Dual Luciferase Reporter Assay System (Promega,
Madison, USA) and normalized to internal controls. The
results were calculated from duplicate samples.
Electromobility shift assay
Nuclear extracts were prepared from HepG2 cells or
pcDNA4-myc-HNF4a-transfected 293T cells according to
a previously reported protocol [35]. The protein concentration was determined according to the bicinchoninic acid
method. The extracts were frozen in aliquots and stored at
2808C. Sense probes and their complementary antisense
probes were annealed and labeled with [g-32P] ATP and
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 163
Two novel cis-elements for HNF4a regulation of ACAT2
T4 polynucleotide kinase (Takara, Dalian, China).
The sense probes for HNF4a site I (SI) were AACACTGA
TCTTTGGACACAAA (wt) and AACACgtATaTTgtGA
CACAAA (mut). The sense probes for HNF4a site II (SII)
were CTGAAAGGACTTTAGTCTTTGG (wt) and
CTGAAAGGAtcccAGTtTTTGG (mut). A sense probe for
the HNF4a binding site in the ApoCIII promoter,
GCGCTGGGCAAAGGTCACCTGC, was used as a positive control [16]. The probes were combined with nuclear
proteins in binding buffer (25 mM Tris/HCl, pH 7.4,
80 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol, 1% BSA, and 0.1 mg/ml herring sperm DNA). The
binding reaction mixtures were incubated at room temperature for 30 min and resolved on a non-denatured 5% acrylamide gel in 0.5TBE buffer (45 mM Tris base, 45 mM
boric acid, 1 mM EDTA). In supershift assay, antibodies
were pre-incubated for 15 min before the addition of
probes. For competition assay, 30-fold excess of unlabeled
competitor probes were used as cold probes.
Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) experiments were
performed essentially in the same way as previously
reported [36]. HepG2 cells or HuH7 cells were lysed and
immunoprecipitated using anti-HNF4a antibody. The
extracted DNA was PCR-amplified using specific primers
for the ACAT2 gene promoter (encompassing the two
HNF4a sites). The primers for site II (SII) were
CCAGCCACTATTCCTGTGTGTG (sense) and CCGTGT
TGCCTCCTTCCTTC (antisense). The primers for site I
(SI) were GCTGGCTTGTGTCTCTGTGTCTG (sense) and
AATCCTTCCCCTCCCTTTGTG (antisense). The antitrypsin gene promoter acted as a positive control, and the
primers were GGGGAGGCTGCTGGTGAAT (sense)
and CAGGACGCTGTGGTTTCTGAG (antisense). The
b-actin gene promoter acted as a negative control, and the
primers were TGCACTGTGCGGCGAAGC (sense) and
TCGAGCCATAAAAGGCAA (antisense).
Packaging of adenovirus and retrovirus and infection
of cells
Replication-defective adenoviral vectors expressing
HNF4a, PGC1a, SHP (Ad-HNF4a, Ad-HA-SHP) or the
control GFP (Ad-GFP) were prepared using the AdEasy
system. Ad-PGC1a was kindly provided by Dr Kelly,
Washington University School of Medicine [37]. HuH7
cells were infected with adenovirus for 36–48 h before
being harvested for real-time PCR or western blot analysis.
siGFP and siHNF4a retrovirus particles were produced as
described according to the user manual PT-3739-1
(Clontech, Mountain View, USA) with the plasmids
pSiren-RetroQ-siGFP and pSiren-RetroQ-siHNF4a. After
viral infection for 48 h, cells were selected in culture media
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 164
containing 2 mg/ml puromycin for 72 h. The resulting
HuH7 cells expressing control siRNA and HNF4a genespecific siRNA were used in real-time PCR experiments
for quantifying HNF4a and ACAT2 mRNA expression and
in western blot experiments for protein expression analysis.
RNA isolation and real-time PCR
RNA was extracted from HepG2 cells, HuH7 cells, mouse
primary hepatocytes, and mouse livers with Trizol reagent
(Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. RNA was reverse transcribed to cDNA
which was used as a template for PCR. For detection of expression levels, real-time PCR was performed (iQ5 thermal
cycler, Bio-Rad, Hercules, USA). The primers for real-time
PCR were as follows: ACAT2: TCTATCCTGCATGCCACGT
TG (F), AGTTCCACCAGTCCCGGTAGAA (R); GAPDH:
GCCTCAAGATCATCAGCAATGC (F), TCTTCTGGGTG
GCAGTGATGG (R); HNF4a: CTTCTTTGACCCAGATGC
CAAG (F), GAGTCATACTGGCGGT-CGTTG (R).
Western blotting
Proteins were extracted with RIPA buffer [25 mM Tris –
HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% sodium dodecyl sulfate (SDS)]. After
complete homogenization on ice, cell lysates were centrifuged, and the supernatants obtained were fractionated by
12% sodium dodecyl sulfate –polyacrylamide gel electrophoresis and electro-transferred onto a polyvinylidene
difluoride membrane. After blocking with Tris-buffered
saline Tween-20 (TBST, 20 mM Tris–HCl, pH 8.0,
150 mM NaCl, and 0.1% Tween-20) containing 5% non-fat
milk, the membranes were probed with primary antibodies
at 48C overnight. The membranes were then incubated with
horseradish peroxidase-conjugated IgG (Santa Cruz
Biotechnology) at 378C for 2 h and visualized with the ECL
System from Vigorous Biotechnology (Beijing, China).
Statistical analysis
All statistical analyses were performed using GraphPad
Prism 4.0. Data were expressed as mean + SE. Difference
among groups was tested by one-way analysis of variance.
Comparison between two groups was performed using an
unpaired t-test. P , 0.05 was considered statistical difference when compared with the control.
Results
Identification of two response elements, site I and site
II, which are important for HNF4a regulation of
ACAT2 gene promoter activity in hepatocytes
A reporter construct that spans from 21299 to þ8 of the
ACAT2 gene promoter [29] was used to analyze transcriptional regulation of ACAT2 [Fig. 1(A) ]. As previously
Two novel cis-elements for HNF4a regulation of ACAT2
reported [28], HNF4a, one important factor in lipid metabolism, induced ACAT2 gene promoter activity in HuH7
cells [Fig. 1(B)]. In another hepatic HepG2 cell line,
HNF4a also apparently induced ACAT2 gene promoter
activity, though to a less extent [Fig. 1(C)].
A series of reporter constructs with different 50 deletions
of ACAT2 gene promoter, p(21299), p(2897), p(2365),
and p(2208) were constructed [Fig. 1(A)] and were transfected into HepG2 cells in which HNF4a is endogenously
expressed [Fig. 1(D)]. P(21299) manifested a relatively
strong luciferase activity, while p(2897) had about
one-fifth that of p(21299), implying that the fragment
from nucleotide 21299 to 2897 was important for maintaining hepatic promoter activity. A dramatic decrease in
promoter activity was also observed in pGL3-basic compared with p(2208), indicating that the fragment from
2208 to þ8 also conferred high promoter activity. These
results indicate that fragment (21299 to 2897) and
fragment (2208 to þ8) are especially important for
hepatic ACAT2 gene promoter activity.
Analysis of fragment (21299 to 2897) and fragment
(2208 to þ8) revealed two HNF4a binding cis-elements:
site I (SI) at 21006 to 2898 and site II (SII) at 238 to
229, both of which, in the antisense strand, fit well with
the HNF4a binding motif CAAAGTNCA [15] [Fig. 1(A)].
To determine whether the two predictive sites were crucial
for HNF4a effect, the conserved nucleotides [15] in these
two cis-elements were mutated [Fig. 1(A)]. In HepG2 cells
in which HNF4a is expressed endogenously, mutation of
site I decreased ACAT2 gene promoter activity to one-fifth
that of wild type, while mutation of site II reduced
promoter activity to less than one-tenth that of wild type.
Simultaneous mutations of both sites reduced promoter
activity more strikingly [Fig. 1(E)]. These results indicate
that site I and site II are important for hepatic ACAT2 gene
promoter activity.
Figure 1 Identification of two response elements, site I and site II, which are important for HNF4a regulation of ACAT2 gene promoter activity
in hepatocytes Different reporter constructs were transfected without/with HNF4a expression plasmids into cells for 36 h and dual luciferase activity
was assayed and normalized to internal control phRL-TK. (A) Upper: construction of series of reporter constructs of ACAT2 gene promoter with
different 50 deletion. Bottom: two HNF4a binding elements in the ACAT2 gene promoter, site I (SI) and site II (SII), and the corresponding mutant
HNF4a elements. Lowercase letters indicate the mutated nucleotide. (B,C) The wild-type ACAT2 gene promoter p(21299) was cotransfected without/
with HNF4a expression plasmid into HuH7 cells (B) or HepG2 cells (C) and luciferase activity was assayed. (D) The series of ACAT2 gene promoter
constructs with different 50 deletion were transfected into HepG2 cells and luciferase activity was assayed. (E) The wild type and HNF4a site I and site
II mutant promoter constructs were transfected into HepG2 cells and luciferase activity was assayed.
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 165
Two novel cis-elements for HNF4a regulation of ACAT2
Site I and site II are important for HNF4a induction
effect on ACAT2 gene promoter activity in 293T cells
We analyzed whether HNF4a could induce ACAT2 gene expression in 293T cells. The ACAT2 gene promoter constructs
were cotransfected without/with HNF4a expression plasmids into 293T cells [Fig. 2(A)]. Results showed that
HNF4a could really induce ACAT2 gene promoter activity
to a high level. ACAT2 expression is absent in 293T cells
[28]. The induction of ACAT2 gene promoter activity provided further evidence that ACAT2 was under control of
HNF4a.
Deletions of the two fragments, (21299 to 2897) and
(2208 to þ8), greatly impaired HNF4a induction effect.
Deletion of fragment (2208 to þ8) had greater impairing
effect than that of fragment (21299 to 2897). On the
other hand, deletion of fragment (2365 to 2208), which
contains two previously reported HNF4a sites around
2247 and 2311 [28], only slightly destroyed the induction effect of HNF4a [Fig. 2(A)]. These results indicate
that fragment (21299 to 2897) and fragment (2208 to
þ8) are also particularly important for HNF4a induction
effect in 293T cells. We also found that mutation of site I
strongly antagonized HNF4a induction effect on ACAT2
gene promoter activity. Mutation of site II had a more significant effect. Simultaneous mutations of two sites
profoundly destroyed the ability of HNF4a to activate the
ACAT2 gene promoter activity [Fig. 2(B)]. Thus, the two
cis-elements, site I and site II, are important for mediating
the HNF4a effect.
To further confirm the role of these two elements, we
inserted each of these two elements into the
pGL3-promoter vector and checked the response to
HNF4a [Fig. 2(C)]. HNF4a overexpression resulted in
about a 1.75-fold increase in luciferase activity through
inserted site I. The induction effect of HNF4a was lost
when site I was mutated, confirming that the HNF4a effect
was conferred by wild-type site I. Similar results were
obtained for site II [Fig. 2(D)]. Together, these results indicate that site I and site II mediate the effect of HNF4a.
HNF4a binds to the two cis-elements site I and site II
in EMSA and ChIP experiments
To determine whether HNF4a is capable of directly
binding to site I and site II, the electromobility shift assay
(EMSA) experiment was performed. We constructed c-myc
tagged HNF4a and overexpressed myc-HNF4a in 293T
cells. As shown in Fig. 3(A), the use of nuclear extract
from myc-HNF4a transfected 293T cells resulted in a specific protein2DNA complex (columns 2, 6, and 10) which
was absent when using nuclear extracts from 293T cells
Figure 2 Site I and site II are important for HNF4a induction effect on ACAT2 gene promoter activity in 293T cells Luciferase reporter
plasmids were cotransfected without/with HNF4a expression plasmids into cells for 36 h. Dual luciferase activity was assayed and normalized to internal
control phRL-TK. (A) The series of ACAT2 gene promoter constructs with different 50 deletion were cotransfected without (gray bar) or with (dark bar)
HNF4a expression plasmid into 293T cells and luciferase activity was assayed. (B) Wild type and HNF4a site I and site II mutant promoter constructs
were cotransfected without/with HNF4a expression plasmids into 293T cells and luciferase activity was assayed. (C) Wild-type site I and mutant site I
were inserted into the pGL3-promoter (PP) vector to construct pGL3-promoter-site I-wild type (PP-SI-wt) and pGL3-promoter-site I-mutant (PP-SI-mut),
respectively. PP, PP-SI-wt, and PP-SI-mut were cotransfected without/with HNF4a expression plasmids into 293T cells and luciferase activity was
assayed. Induction of luciferase activity by HNF4a for each of these three constructs was calculated and normalized to the PP group. (D) The same
experiment as in (C) except that site I was replaced by site II. **P , 0.01 compared with the pGL3-promoter group.
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 166
Two novel cis-elements for HNF4a regulation of ACAT2
Figure 3 HNF4a binds to the two cis-elements site I and site II in EMSA and ChIP experiments (A) EMSA experiment using nuclear extract
from 293T cells transfected with pcDNA4 control plasmid (columns 1, 5, 9) or pcDNA4-myc-HNF4a expression plasmid (columns 2– 4, columns 6 – 8,
columns 10, 11). Nuclear extracts were prepared and incubated with wild-type probes or mutant probes of HNF4a site II and HNF4a site I. The DNA/
protein complexes are indicated by arrows. The known HNF4a binding element from the ApoCIII promoter was used as a positive control. Myc
antibody was added in the supershift columns (columns 3, 7, and 11). (B) HNF4a binds to the human ACAT2 gene promoter in ChIP experiment.
Chromatin was prepared from HepG2 cells, immunoprecipitated with HNF4a antibodies and amplified by real-time RT – PCR. The signal from the
HNF4a precipitation was normalized to that from the respective IgG precipitation. The antitrypsin gene promoter was used as a positive control, and the
b-actin gene promoter was used as a negative control. *P , 0.05, **P , 0.01 compared with IgG.
transfected with the control empty vector (columns 1, 5,
and 9). The addition of myc antibody resulted in a supershift (columns 3, 7, and 11). These data indicate that upper
protein2DNA complex specifically contains the mycHNF4a protein. This specific protein2DNA complex, but
not the unspecific complex, was disrupted when the probes
were mutated (columns 4 and 8), indicating that the
protein2DNA complex contained the probe specifically
binding to HNF4a. Together, these results confirm that
HNF4a indeed binds to the two elements, site I and site II,
in vitro.
To verify whether HNF4a binds to the ACAT2 gene promoter in a natural chromatin context, ChIP experiment was
carried out in HepG2 cells. Chromatin was immunoprecipitated with an antibody against HNF4a, and PCR analysis
was performed using two pairs of primer sets designed to
amplify the regions of site I and site II [Fig. 3(B)]. We
found that HNF4a precipitation led to a significant enrichment of both site I and site II, indicating the association of
HNF4a and the two sites in natural chromatin context.
HNF4a precipitation led to a high enrichment of the
antitrypsin gene promoter, a positive control [38], but no
enrichment of the negative control b-actin gene promoter,
verifying the reliability of our experiments.
HNF4a overexpression increases ACAT2 expression,
whereas HNF4a knockdown decreases ACAT2
expression
To directly investigate the influence of HNF4a on ACAT2
expression at mRNA level, HuH7 cells were infected with
the adenovirus Ad-HNF4a to overexpress HNF4a. ACAT2
expression was increased 3 fold [Fig. 4(A,B)]. On the
other hand, when HNF4a was knocked down, ACAT2
expression decreased concomitantly [Fig. 4(C,D)]. Both
HNF4a and ACAT2 expression levels were reduced by half
[Fig. 4(D)], reflecting a close relationship between HNF4a
and ACAT2 expression level. We also transfected HNF4a
expression plasmids into 293T cells which are absent of
HNF4a [Fig. 4(E)] and found that the expression level of
ACAT2 was intensely induced [Fig. 4(F)]. These results
strongly show that HNF4a induces ACAT2 expression at
the mRNA level.
The HNF4a coactivator PGC1a activates ACAT2
expression, while the HNF4a corepressor SHP inhibits
ACAT2 expression
PGC1a is an important transcriptional coactivator that
activates the transcriptional activity of HNF4a [23]. SHP,
in contrast to PGC1a, is an important transcriptional corepressor of HNF4a [25]. We examined the regulation of
ACAT2 expression by these two HNF4a cofactors. HuH7
cells were infected with Ad-PGC1a [Fig. 5(A)], ACAT2
expression was stimulated, reaching level more than 3 fold
that of control group [Fig. 5(B)]. In comparison, when
HuH7 cells were infected with Ad-HA-SHP [Fig. 5(C)],
ACAT2 expression was decreased to half that of control
[Fig. 5(D)].
Luciferase reporter assay was used to further characterize
the role of PGC1a and SHP on ACAT2 gene expression
[Fig. 5(E)]. In HeLa cells, HNF4a overexpression induced
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 167
Two novel cis-elements for HNF4a regulation of ACAT2
Figure 4 HNF4a overexpression increases ACAT2 expression, whereas HNF4a knockdown decreases ACAT2 expression (A,B) HuH7 cells were
infected with Ad-GFP or Ad-HNF4a. After 36 h of infection, cells were collected and used in western blot experiments for analysis of HNF4a
expression at the protein level (A). ACAT2 mRNA expression levels were examined by real-time PCR analysis (B). (C,D) HuH7 cells were infected with
retrovirus expressing siGFP or siHNF4a. After 48 h, cells were selected with 2 mg/ml puromycin for 72 h. Surviving cells were collected and used in
western blot experiments for the analysis of HNF4a protein expression (C) or used in real-time PCR experiments for analysis of HNF4a expression at
the mRNA level (D). ACAT2 expression levels were also examined by real-time PCR analysis (D). (E,F) 293T cells were transfected without/with
HNF4a expression plasmid for 36 h. Cells were collected for analysis of HNF4a protein levels by western blot analysis (E). ACAT2 mRNA expression
levels were analyzed by real-time PCR (F). *P , 0.05, **P , 0.01.
ACAT2 gene promoter activity. In the absence of HNF4a
overexpression, PGC1a and SHP had no impact on ACAT2
gene promoter activity. However, in the presence of HNF4a,
PGC1a could enhance, while SHP could impair, the activating effect of HNF4a on ACAT2 gene promoter activity. The
effects of PGC1a and SHP are dose dependent. In addition,
we observed that in the presence of HNF4a and PGC1a, addition of SHP led to a dose-dependent decrease in ACAT2 gene
promoter activity. Thus, our results indicate that in the presence of HNF4a, PGC1a and SHP can oppositely regulate
ACAT2 gene promoter activity.
Discussion
In this study, we investigated the underlying mechanisms
behind transcriptional control of ACAT2. ACAT2 is highly
expressed in the liver and intestine [1]. However, its promoter does not contain a TATA box or CCAAT box, and
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 168
its basal promoter activity is low [29]. Previous studies
have indicated that caudal-type homeobox transcription
factor 2 (CDX2) and hepatocyte nuclear factor 1 (HNF1)
stimulate ACAT2 expression in intestinal cells [39]. In liver
cells, ACAT2 was reported to be regulated by HNF1 [40].
However, in other organs in which HNF1 is highly
expressed, such as kidney and pancreas, ACAT2 is not
expressed [39 –41]. Pramfalk et al. [40] suggested existence
of another factor or factors that control liver-specific expression of ACAT2. ACAT2 gene promoter activity was
reported to be regulated by HNF4a through two sites
around 2247 and 2311 [28]. Here, we further analyzed
transcriptional regulation of ACAT2 gene promoter activity.
We found that deletion of fragment (21299 to 2897) and
fragment (2208 to þ8) greatly destroyed HNF4a induction effect on ACAT2 gene promoter activity [Fig. 1(D)].
However, deletion of the fragment (2365 to 2208) which
contains two previously reported sites [28] only slightly
Two novel cis-elements for HNF4a regulation of ACAT2
Figure 5 HNF4a coactivator PGC1a activates ACAT2 expression, while the HNF4a corepressor SHP inhibits ACAT2 expression (A,B) HuH7
cells were infected with PGC1a adenovirus for 36 h. Cells were collected for an analysis of PGC1a expression by western blot analysis using a primary
antibody against PGC1a (A). ACAT2 mRNA expression levels were analyzed by real-time PCR (B). (C,D) HuH7 cells were infected with HA tagged
SHP adenovirus for 36 h. Cells were collected for an analysis of HA-SHP expression by western blot analysis using a primary antibody against HA (C).
ACAT2 mRNA expression levels were analyzed by real-time PCR (D). (E) In HeLa cells, the wild-type ACAT2 gene promoter pGL3-hACAT2-1299 and
the internal control phRL-TK were cotransfected without/with HNF4a, PGC1a, and/or SHP expression plasmids for 36 h, cells were lysed and
dual-luciferase activities were determined. Values were normalized to internal control. In the columns 5 – 12, PGC1a or SHP expression plasmids were
added in a dose-dependent manner. **P , 0.01.
inhibited transactivation effect of HNF4a [Fig. 1(D)]. We
focused on fragment (21299 to 2897) and fragment
(2208 to þ8) and found two novel cis-elements site I
(21006 to 2898) and site II (238 to 229). Mutation of
site I and site II, particularly site II, greatly destroyed
ACAT2 gene promoter activity in HepG2 cells in
which HNF4a is endogenously expressed [Fig. 1(E)]
and impaired HNF4a induction effect in 293T cells
[Fig. 2(B –D)]. Thus, site I and site II, particularly site II,
are essential for HNF4a effect. ACAT2 gene promoter is
lack of TATA box or CCAAT box. Site II (238 to 229)
is adjacent to the transcriptional start site. HNF4a binding
to site II could easily recruit Transcription Factor IID
(TFIID) or Transcription Factor IIB (TFIIB) and other
protein components to initiate transcription [42,43]. We
suggest that site II plays a fundamental role in maintaining
liver-specific ACAT2 gene promoter activity, while other
sites may cooperate with site II to synergistically regulate
ACAT2 expression.
Although ACAT2 gene promoter activity is regulated by
HNF4a, whether ACAT2 gene expression is indeed regulated by HNF4a at mRNA level is unknown. Here, using
diverse approaches, we clearly demonstrate that ACAT2 expression levels are actually induced by HNF4a.
Overexpression of HNF4a increased, while knockdown of
HNF4a decreased, ACAT2 expression. More convincingly,
in non-hepatic 293T cells in which ACAT2 expression is
absent [28], HNF4a overexpression reliably induced
ACAT2 mRNA expression strongly. Thus, HNF4a directly
induces ACAT2 gene expression. PGC1a is an HNF4a
coactivator [23], while SHP is an HNF4a corepressor [25].
We here find that PGC1a activated ACAT2 expression,
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 169
Two novel cis-elements for HNF4a regulation of ACAT2
while SHP inhibited ACAT2 expression. It is possible that
SHP competes with PGC1a for binding to HNF4a and
thereby inhibits HNF4a transcriptional activity [44].
Overexpression of HNF4a could induce ACAT2 gene
promoter activity and mRNA expression in 293T cells and
HeLa cells, so HNF4a itself could induce ACAT2 transcription. ACAT2 could also be regulated by HNF1a. The interaction between HNF4a and HNF1a [28], and the
regulation of HNF1a gene expression by HNF4a [45], put
ACAT2 gene expression under the complex and precise
control by HNF4a and HNF1a. Together from previous
results and our results, we summarize that HNF4a can
bind to site (21006 to 2898), site (238 to 229), site
(around 2247), and site (around 2311), while HNF1a
could bind to site (2868 to 2863), site (around 2220),
and site (around 2276) [28,40]. Among these sites, the
neighboring HNF4a and HNF1a binding sites would
cause synergistic effect on ACAT2 gene promoter activity.
Further experiments to analyze the different combinations
among these sites would help to demonstrate which sites
would have synergistic effects. We show that at cellular
level HNF4a regulates ACAT2 expression. However,
whether HNF4a directly regulates ACAT2 expression and
cholesterol metabolism in vivo is unknown. In future,
experiments are needed to demonstrate the effect of
HNF4a in vivo. The effect of HNF4a may be due to
HNF1a. To exclude the interference of HNF1a, overexpression or knocking down of HNF4a in HNF1a knockout
mice would be a best model.
The quantity of ACAT2 is important for ACAT2 function in cholesterol ester metabolism [4–6]. Thus, maintaining precise control of the ACAT2 expression level is
important. HNF4a regulates ACAT2 gene promoter activity.
In MODY-1 patients, HNF4a mutations are associated
with reduced ACAT2 gene promoter activity and lower
levels of esterified cholesterol in VLDL and low-density
lipoprotein particles [28]. We here show that two novel
cis-elements are important for ACAT2 expression. We
suppose that mutations or polymorphisms influencing
ACAT2 transcription would, possibly, affect ACAT2 expression and its role in lipid metabolism.
Together, our results indicate that ACAT2 expression is
positively regulated by HNF4a and reveal two elements
for HNF4a effect. These results provide more insights into
the regulation of ACAT2 expression. As liver ACAT2 quantity is important for cholesterol ester synthesis and secretion, our results contribute to elucidate the detailed
mechanisms for controlling cholesterol ester metabolism.
Acknowledgements
We thank Lei Li, Lu Lu, Guowei Zhao, Beibei Mao, and
Huan Gong for technical assistance.
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 170
Funding
This work was supported by grants from the National Basic
Research Program of China (2006CB503801, 2011CB
503902), the Special Fund of the National Laboratory of
China (2060204), the National Natural Science Foundation
of China (30721063, 31021091, 31028005), and the
National 863 Project (2006AA02A406).
References
1 Chang TY, Li BL, Chang CC and Urano Y. Acyl-coenzyme A:cholesterol
acyltransferases. Am J Physiol Endocrinol Metab 2009, 297: E1– 9.
2 Chang TY, Chang CC, Lin S, Yu C, Li BL and Miyazaki A. Roles of
acyl-coenzyme A:cholesterol acyltransferase-1 and -2. Curr Opin Lipidol
2001, 12: 289 – 296.
3 Joyce C, Skinner K, Anderson RA and Rudel LL. Acyl-coenzyme
A:cholesteryl acyltransferase 2. Curr Opin Lipidol 1999, 10: 89 – 95.
4 Liang JJ, Oelkers P, Guo C, Chu PC, Dixon JL, Ginsberg HN and Sturley
SL. Overexpression of human diacylglycerol acyltransferase 1, acylcoa:cholesterol acyltransferase 1, or acyl-CoA:cholesterol acyltransferase 2
stimulates secretion of apolipoprotein B-containing lipoproteins in
McA-RH7777 cells. J Biol Chem 2004, 279: 44938– 44944.
5 Temel RE, Hou L, Rudel LL and Shelness GS. ACAT2 stimulates cholesteryl ester secretion in apoB-containing lipoproteins. J Lipid Res 2007, 48:
1618– 1627.
6 Bell TA, III, Brown JM, Graham MJ, Lemonidis KM, Crooke RM and
Rudel LL. Liver-specific inhibition of acyl-coenzyme a:cholesterol
acyltransferase 2 with antisense oligonucleotides limits atherosclerosis development in apolipoprotein B100-only low-density lipoprotein
receptor2/2 mice. Arterioscler Thromb Vasc Biol 2006, 26: 1814– 1820.
7 Lee RG, Shah R, Sawyer JK, Hamilton RL, Parks JS and Rudel LL.
ACAT2 contributes cholesteryl esters to newly secreted VLDL, whereas
LCAT adds cholesteryl ester to LDL in mice. J Lipid Res 2005, 46:
1205– 1212.
8 Rudel LL, Lee RG and Parini P. ACAT2 is a target for treatment of coronary heart disease associated with hypercholesterolemia. Arterioscler
Thromb Vasc Biol 2005, 25: 1112– 1118.
9 Sladek FM, Zhong WM, Lai E and Darnell JE, Jr. Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor
superfamily. Genes Dev 1990, 4: 2353– 2365.
10 Watt AJ, Garrison WD and Duncan SA. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 2003, 37: 1249– 1253.
11 Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, Prezioso
VR and Bachvarova RF, et al. Disruption of the HNF-4 gene, expressed in
visceral endoderm, leads to cell death in embryonic ectoderm and impaired
gastrulation of mouse embryos. Genes Dev 1994, 8: 2466 –2477.
12 Hayhurst GP, Lee YH, Lambert G, Ward JM and Gonzalez FJ. Hepatocyte
nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance
of hepatic gene expression and lipid homeostasis. Mol Cell Biol 2001, 21:
1393– 1403.
13 Shih DQ, Dansky HM, Fleisher M, Assmann G, Fajans SS and Stoffel M.
Genotype/phenotype relationships in HNF-4alpha/MODY1: haploinsufficiency is associated with reduced apolipoprotein (AII), apolipoprotein
(CIII), lipoprotein(a), and triglyceride levels. Diabetes 2000, 49: 832 – 837.
14 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K
and Blumberg B, et al. The nuclear receptor superfamily: the second
decade. Cell 1995, 83: 835 –839.
15 Rada-Iglesias A, Wallerman O, Koch C, Ameur A, Enroth S, Clelland G
and Wester K, et al. Binding sites for metabolic disease related
Two novel cis-elements for HNF4a regulation of ACAT2
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
transcription factors inferred at base pair resolution by chromatin immunoprecipitation and genomic microarrays. Hum Mol Genet 2005, 14:
3435– 3447.
Ladias JA, Hadzopoulou-Cladaras M, Kardassis D, Cardot P, Cheng J,
Zannis V and Cladaras C. Transcriptional regulation of human apolipoprotein genes ApoB, ApoCIII, and ApoAII by members of the steroid
hormone receptor superfamily HNF-4, ARP-1, EAR-2, and EAR-3. J Biol
Chem 1992, 267: 15849– 15860.
Chan J, Nakabayashi H and Wong NC. HNF-4 increases activity of the rat
Apo A1 gene. Nucleic Acids Res 1993, 21: 1205 – 1211.
Sheena V, Hertz R, Nousbeck J, Berman I, Magenheim J and Bar-Tana J.
Transcriptional regulation of human microsomal triglyceride transfer
protein by hepatocyte nuclear factor-4alpha. J Lipid Res 2005, 46:
328– 341.
Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM and Puigserver P.
Nutrient control of glucose homeostasis through a complex of PGC-1alpha
and SIRT1. Nature 2005, 434: 113– 118.
Rhee J, Ge H, Yang W, Fan M, Handschin C, Cooper M and Lin J, et al.
Partnership of PGC-1alpha and HNF4alpha in the regulation of lipoprotein
metabolism. J Biol Chem 2006, 281: 14683– 14690.
Shin DJ, Campos JA, Gil G and Osborne TF. PGC-1alpha activates
CYP7A1 and bile acid biosynthesis. J Biol Chem 2003, 278:
50047– 50052.
Liu C and Lin JD. PGC-1 coactivators in the control of energy metabolism. Acta Biochim Biophys Sin 2011, 43: 248– 257.
Lin J, Handschin C and Spiegelman BM. Metabolic control through the
PGC-1 family of transcription coactivators. Cell Metab 2005, 1: 361 –370.
Rhee J, Inoue Y, Yoon JC, Puigserver P, Fan M, Gonzalez FJ and
Spiegelman BM. Regulation of hepatic fasting response by PPARgamma
coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor
4alpha in gluconeogenesis. Proc Natl Acad Sci USA 2003, 100:
4012– 4017.
Bavner A, Sanyal S, Gustafsson JA and Treuter E. Transcriptional corepression by SHP: molecular mechanisms and physiological consequences.
Trends Endocrinol Metab 2005, 16: 478 – 488.
Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB
and Galardi C, et al. A regulatory cascade of the nuclear receptors FXR,
SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000, 6:
517– 526.
Hirokane H, Nakahara M, Tachibana S, Shimizu M and Sato R. Bile acid
reduces the secretion of very low density lipoprotein by repressing microsomal triglyceride transfer protein gene expression mediated by hepatocyte
nuclear factor-4. J Biol Chem 2004, 279: 45685– 45692.
Pramfalk C, Karlsson E, Groop L, Rudel LL, Angelin B, Eriksson M and
Parini P. Control of ACAT2 liver expression by HNF4alpha: lesson from
MODY1 patients. Arterioscler Thromb Vasc Biol 2009, 29: 1235– 1241.
Song BL, Qi W, Yang XY, Chang CC, Zhu JQ, Chang TY and Li BL.
Organization of human ACAT-2 gene and its cell-type-specific promoter
activity. Biochem Biophys Res Commun 2001, 282: 580 – 588.
Lerin C, Rodgers JT, Kalume DE, Kim SH, Pandey A and Puigserver P.
GCN5 acetyltransferase complex controls glucose metabolism
through transcriptional repression of PGC-1alpha. Cell Metab 2006, 3:
429– 438.
31 Kim JY, Chu K, Kim HJ, Seong HA, Park KC, Sanyal S and Takeda J,
et al. Orphan nuclear receptor small heterodimer partner, a novel corepressor for a basic helix-loop-helix transcription factor BETA2/neuroD. Mol
Endocrinol 2004, 18: 776– 790.
32 Prieur X, Schaap FG, Coste H and Rodriguez JC. Hepatocyte nuclear
factor-4alpha regulates the human apolipoprotein AV gene: identification
of a novel response element and involvement in the control by peroxisome
proliferator-activated receptor-gamma coactivator-1alpha, AMP-activated
protein kinase, and mitogen-activated protein kinase pathway. Mol
Endocrinol 2005, 19: 3107– 3125.
33 Li ZY, Xi Y, Zhu WN, Zeng C, Zhang ZQ, Guo ZC and Hao DL, et al.
Positive regulation of hepatic miR-122 expression by HNF4alpha.
J Hepatol 2011, 55: 602 –611.
34 Ho SN, Hunt HD, Horton RM, Pullen JK and Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene
1989, 77: 51 – 59.
35 Schreiber E, Matthias P, Muller MM and Schaffner W. Rapid detection of
octamer binding proteins with ‘mini-extracts’, prepared from a small
number of cells. Nucleic Acids Res 1989, 17: 6419.
36 Li YJ, Wei YS, Fu XH, Hao DL, Xue Z, Gong H and Zhang ZQ, et al.
The apolipoprotein CIII enhancer regulates both extensive histone modification and intergenic transcription of human apolipoprotein AI/CIII/AIV
genes but not apolipoprotein AV. J Biol Chem 2008, 283: 28436– 28444.
37 Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM and Kelly
DP. Peroxisome proliferator-activated receptor gamma coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 2000, 106:
847– 856.
38 Costa RH, Grayson DR and Darnell JE, Jr. Multiple hepatocyte-enriched
nuclear factors function in the regulation of transthyretin and alpha
1-antitrypsin genes. Mol Cell Biol 1989, 9: 1415 – 1425.
39 Song BL, Wang CH, Yao XM, Yang L, Zhang WJ, Wang ZZ and Zhao
XN, et al. Human acyl-CoA:cholesterol acyltransferase 2 gene expression
in intestinal Caco-2 cells and in hepatocellular carcinoma. Biochem J
2006, 394: 617 –626.
40 Pramfalk C, Davis MA, Eriksson M, Rudel LL and Parini P. Control of
ACAT2 liver expression by HNF1. J Lipid Res 2005, 46: 1868– 1876.
41 Lee RG, Willingham MC, Davis MA, Skinner KA and Rudel LL.
Differential expression of ACAT1 and ACAT2 among cells within liver,
intestine, kidney, and adrenal of nonhuman primates. J Lipid Res 2000,
41: 1991– 2001.
42 Malik S and Karathanasis SK. TFIIB-directed transcriptional activation by
the orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol
1996, 16: 1824 –1831.
43 Takahashi H, Martin-Brown S, Washburn MP, Florens L, Conaway JW
and Conaway RC. Proteomics reveals a physical and functional link
between hepatocyte nuclear factor 4alpha and transcription factor IID.
J Biol Chem 2009, 284: 32405– 32412.
44 Borgius LJ, Steffensen KR, Gustafsson JA and Treuter E. Glucocorticoid
signaling is perturbed by the atypical orphan receptor and corepressor
SHP. J Biol Chem 2002, 277: 49761 –49766.
45 Jung D and Kullak-Ublick GA. Hepatocyte nuclear factor 1 alpha: a key
mediator of the effect of bile acids on gene expression. Hepatology 2003,
37: 622 –631.
Acta Biochim Biophys Sin (2012) | Volume 44 | Issue 2 | Page 171