4170
Erratum
The function of the M-line protein obscurin in controlling the symmetry of the
sarcomere in the flight muscle of Drosophila
Anja Katzemich, Nina Kreisköther, Alexander Alexandrovich, Christopher Elliott, Frieder Schöck,
Kevin Leonard, John Sparrow and Belinda Bullard
Journal of Cell Science 125, 4170
ß 2012. Published by The Company of Biologists Ltd
doi: 10.1242/jcs.119552
There was an error published in J. Cell Sci. 125, 3367-3379.
In the section ‘Effect of reduced obscurin expression on other proteins in IFM’, the second sentence was published omitting the term
‘M-line’. The correct sentence should read as follows:
In wild-type myofibrils, zormin was in both Z-disc and M-line (supplementary material Fig. S3A).
On p.3373, left column, second paragraph, second line, the word ‘line’ was published twice.
We apologise for these mistakes.
Research Article
3367
The function of the M-line protein obscurin in
controlling the symmetry of the sarcomere in the flight
muscle of Drosophila
Anja Katzemich1,*, Nina Kreisköther1,2,`, Alexander Alexandrovich3, Christopher Elliott1, Frieder Schöck4,
Kevin Leonard5, John Sparrow1 and Belinda Bullard1,§
1
Department of Biology, University of York, York YO10 5DD, UK
Fachbereich Biologie, Philipps-Universität Marburg, Karl-von-Frisch-Straße 8, 35043 Marburg, Germany
King’s College London, The Randall Division for Cell and Molecular Biophysics, New Hunt’s House, London SE1 1UL, UK
4
Department of Biology, McGill University, Montreal, Quebec 1B1, Canada
5
EMBL-EBI, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire CB10 1SD, UK
2
3
*Current address: Department of Biology, McGill University, Montreal, Quebec H3A 1B1, Canada
`
Current address: Merck KGaA, Frankfurter Str. 250, 64293 Darmstadt, Germany
§
Author for correspondence ([email protected])
Journal of Cell Science
Accepted 27 February 2012
Journal of Cell Science 125, 3367–3379
2012. Published by The Company of Biologists Ltd
doi: 10.1242/jcs.097345
Summary
Obscurin (also known as Unc-89 in Drosophila) is a large modular protein in the M-line of Drosophila muscles. Drosophila obscurin is
similar to the nematode protein UNC-89. Four isoforms are found in the muscles of adult flies: two in the indirect flight muscle (IFM) and
two in other muscles. A fifth isoform is found in the larva. The larger IFM isoform has all the domains that were predicted from the gene
sequence. Obscurin is in the M-line throughout development of the embryo, larva and pupa. Using P-element mutant flies and RNAi
knockdown flies, we have investigated the effect of decreased obscurin expression on the structure of the sarcomere. Embryos, larvae and
pupae developed normally. In the pupa, however, the IFM was affected. Although the Z-disc was normal, the H-zone was misaligned.
Adults were unable to fly and the structure of the IFM was irregular: M-lines were missing and H-zones misplaced or absent. Isolated thick
filaments were asymmetrical, with bare zones that were shifted away from the middle of the filaments. In the sarcomere, the length and
polarity of thin filaments depends on the symmetry of adjacent thick filaments; shifted bare zones resulted in abnormally long or short thin
filaments. We conclude that obscurin in the IFM is necessary for the development of a symmetrical sarcomere in Drosophila IFM.
Key words: M-line, Obscurin, Unc-89, Thick filament, Drosophila, Muscle
Introduction
The sarcomeres of striated muscle are composed of parallel thick
and thin filaments. Thin filaments from neighbouring sarcomeres
are crosslinked in the Z-disc, and thick filaments within a
sarcomere are crosslinked in the M-line. These links hold the
filaments in register as the fibres contract, and prevent them
coming out of alignment when fibres are stretched. In vertebrate
muscle fibres, the M-line region is more prone to distortion under
stress than the Z-disc (Agarkova and Perriard, 2005; Gautel,
2011; Linke, 2008). A well-ordered sarcomere is essential for the
oscillatory contraction of the indirect flight muscle (IFM) of
insects. The muscle is activated by periodic stretches and
oscillations are maintained by the alternating contraction of
opposing muscles (Pringle, 1978). The response of IFM to a rapid
stretch depends on the match between myosin crossbridges on
thick filaments and actin target sites on thin filaments (ALKhayat et al., 2003; Perz-Edwards et al., 2011; Tregear et al.,
1998; Wu et al., 2010). The fibres must be stiff to sense small
length changes at high frequency. The proteins responsible for
the stiffness of Drosophila IFM have a modular structure made
up of immunoglobulin- (Ig) and fibronectin-like (Fn3) domains.
The Drosophila gene sallimus encodes for isoforms of Sls (also
known as Titin). There are two isoforms in IFM: kettin (540 kDa)
and Sls700 (700 kDa), both of which link actin near the Z-disc to
the end of the thick filament (Bullard et al., 2005; Burkart et al.,
2007). Another Sls isoform, zormin, is found both in the Z-disc
and in the M-line.
The M-line protein UNC-89 was originally identified in
Caenorhabditis elegans (Benian et al., 1996). UNC-89 has SH3
and DH-PH (RhoGEF) signalling domains near the N-terminus,
and two kinase domains near the C-terminus (Qadota et al., 2008;
Small et al., 2004). The protein is needed for the integration of
myosin into regular A-bands in the body-wall muscle: unc-89
mutants have disorganised myofibrils and M-lines are often absent,
but motility of the worms is hardly affected. A protein with a
sequence similar to that of the C-terminal region of UNC-89 was
predicted from the Drosophila genome (Small et al., 2004) and
identified in the M-line of the IFM (Burkart et al., 2007).
The vertebrate homologue of UNC-89, obscurin, has a similar
domain structure, except that the SH3 and DH-PH domains are
near the C-terminus (Bang et al., 2001; Fukuzawa et al., 2008;
Russell et al., 2002; Young et al., 2001). Obscurin-A and
obscurin-B are isoforms that have either an ankyrin-binding
region or two kinase domains near the C-terminus. In mature
skeletal fibres, obscurin is at the periphery of myofibrils,
predominately in the M-line region (Fukuzawa et al., 2008;
Journal of Cell Science
3368
Journal of Cell Science 125 (14)
Kontrogianni-Konstantopoulos et al., 2003). Obscurin-A binds to
ankyrins in the sarcoplasmic reticulum (SR), and this may create
a link between the SR and the myofibril (Bagnato et al., 2003;
Kontrogianni-Konstantopoulos et al., 2006; KontrogianniKonstantopoulos et al., 2003; Lange et al., 2009; Porter et al.,
2005). There is a second protein, similar to obscurin, in vertebrate
fibres: Obsl1 has Ig and Fn3 domains in a pattern that is similar to
that seen in the N-terminal region of obscurin, but lacks the SH3,
DH-PH and kinase domains, as well as the ankyrin-binding
region near the C-terminus (Fukuzawa et al., 2008; Geisler et al.,
2007). Obsl1 is in the M-line of skeletal muscle and, in contrast
to obscurin, Obsl1 is in the interior of myofibrils, rather than at
the periphery (Fukuzawa et al., 2008).
The vertebrate M-line is composed of a network of proteins,
including titin, myomesin, obscurin and Obsl1, crosslinked
through interacting Ig domains (Fukuzawa et al., 2008; Gautel,
2011; Kontrogianni-Konstantopoulos et al., 2009). The function
of the obscurin homologue (Unc-89) in Drosophila is rather
different. The M-line does not contain titin or myomesin. In
Drosophila, titin is replaced by the smaller proteins Sls and
projectin (Bullard et al., 2005); of these, only the Sls isoform
zormin has been found in the M-line. The Drosophila genome
does not encode myomesin (Irina Agarkova, Functional diversity
of contractile isoproteins: Expression of actin and myomesin
isoforms in striated muscle, PhD thesis, Swiss Federal Institute of
Technology, Zurich, 2000).
The aim of the study we describe here was to find out how
obscurin stabilises the M-line in IFM of Drosophila. The position
of obscurin in the sarcomere was followed during development of
the embryo, larva and pupa. In flies with reduced expression of
obscurin, the regular structure of IFM sarcomeres was lost and
flies were unable to fly. We show here that the symmetry of the
thick filament and the length and polarity of the thin filament are
dependent on obscurin. Obscurin is essential for the development
and maintenance of the precise structure of the IFM that is
needed for oscillatory contraction, whereas other muscles can
function with a reduced amount of obscurin.
Results
The Drosophila obscurin gene and its expression products
The obscurin gene (Unc-89) is located at chromosome arm
2R and annotated as CG33519 or CG30171 in Flybase. The
Drosophila genome sequence predicts a gene of about 18 kb with
36 exons (Fig. 1A). The largest possible isoform obtained by
exon splicing would have a predicted molecular mass of
475 kDa. The predicted domain structure of the entire gene has
an SH3 domain near the N-terminus, followed by DH-PH
domains. Further downstream, 21 Ig domains, two Fn3 domains,
and two kinase domains are predicted (Fig. 1B). The largest
Drosophila obscurin isoform is smaller than the nematode and
vertebrate homologues: it has fewer Ig domains and lacks the IQ
domain of the vertebrate protein.
The sequence of the cDNA that corresponds to the largest
transcript in IFM contains all exons predicted in Flybase, except the
75 bp exon 15. Therefore, the largest transcript in IFM is derived
from 35 exons. Prediction of the domains encoded by individual
exons shows that single Ig domains are often encoded by two, or
sometimes three, exons. The core sequence of kinase 1 is encoded
by two exons, and kinase 2 by one exon; the regulatory domains of
the kinases are encoded by exons downstream of the catalytic
sequences. Exons coding for domains in the largest isoform of
obscurin in IFM are shown in supplementary material Table S1.
The isoforms of obscurin that are present in the larva, and those
in the muscles of the fly thorax and isolated IFM, were identified in
western blots by using antibodies against Ig14, Ig15, Ig16
(hereafter referred to as Ig14-16) and kinase 1 (Fig. 1C). We
detected four isoforms in the thorax, two of which (isoforms A and
C) were in the IFM. The larva contained a single isoform (isoform
E), which differed in size from the isoforms found in the adult fly.
We cannot exclude the possibility that there is more than one
isoform in individual bands on the blot. The western blot shows
that Ig14-16 and kinase 1 domains are in all five isoforms. In
experiments that are described in the following, we used anti-Ig1416 antibody, except when indicated otherwise. Isoforms in the
thorax of the late pupae, newly eclosed flies and mature wild-type
adult flies were compared (supplementary material Fig. S1A).
Pharate pupae contain the larger IFM isoform A and small amounts
of the two non-IFM isoforms B and D. Young flies contain the
pupal isoforms and traces of the IFM isoform C. Mature (6-dayold) flies contain more of IFM isoform C. Mass spectroscopy of
peptides derived from the isoform that appeared after eclosion of
pupae showed that the protein is likely to be a product of gene
splicing, rather than protein cleavage. The most N-terminal
peptides identified were about 53 kDa downstream of the Nterminus. The most C-terminal peptides were 12 residues from the
C-terminus. If 53 kDa were cleaved from the N-terminus, the
remaining protein would be 422 kDa. Obscurin isoform C is about
370 kDa, or 105 kDa smaller than isoform A. Therefore, more than
53 kDa is missing from isoform C, which is consistent with gene
splicing.
Position of obscurin in embryonic, larval, and pupal
muscles
In our experiments, obscurin was first detected in the embryo at
early stage 16 and in the M-line of somatic muscles during late
stage 17. Obscurin was seen across the muscle in a striped
Fig. 1. The obscurin gene, domains in the protein and
isoforms in the muscles. (A) Exons in the gene are numbered
1–36. Epgy2 marks the position of the P-element insertion.
Lines above the gene show exons encoding the RhoGEF (DHPH) and the two kinase domains (Kin1 and Kin2).
(B) Domains predicted in the protein. Lines above domains
show regions that were used to raise antibodies.
(C) Western bots of isoforms in larva (L), adult thorax (T) and
IFM (F). Blots were incubated with anti-Ig14-16 or antikinase1 antibodies. There are at least four isoforms in the
thorax. Isoforms A and C are in IFM; the larva has isoform E
only. Both antibodies reacted with all five obscurin isoforms.
Obscurin in the flight muscle M-line
Journal of Cell Science
pattern and was positioned laterally to the sites at which muscles
are attached to the epidermis (Fig. 2A). The Z-disc protein kettin
is close to the epidermal attachment sites in embryonic and larval
3369
muscle (Kreisköther et al., 2006) and obscurin is further from the
attachment sites than kettin (Fig. 2B). The position of obscurin in
unc89[EY15484] mutant embryos in which a P-element was
inserted near the start of the obscurin gene (see below) is similar
to that of wild-type embryos (Fig. 2C).
We found that obscurin of larval body wall muscles is in the
M-line, by labelling larvae from a fly line expressing GFP-Sls
with anti-obscurin antibody (Fig. 2D). GFP-Sls marks the Z-disc
(Burkart et al., 2007) and was resolved as a doublet at the
epidermal attachment site (Fig. 2D). Obscurin was midway
between Z-discs and further from the attachment site than kettin,
as was seen in the embryo.
During development of the pupa, obscurin transcripts could be
amplified from IFM at 32 hours after puparium formation (APF)
and, more strongly, at 48 hours (data not shown). The position of
obscurin in the pupal IFM was followed from 30 hours APF to
the newly emerged adult (Fig. 2E). At 30 hours, obscurin showed
signs of periodicity, while the Z-disc protein kettin was in
undifferentiated strands. At 48 hours, obscurin and kettin
appeared as broad striations at the M-line and Z-disc; the
striations were formed by labelled dots in narrow myofibrils lined
up closely side-by-side. Striations of both obscurin and kettin
became better defined at 72 hours, as sarcomere length increased
and myofibrils were more separated. The narrow myofibrils at 72
hours gave the M-line and Z-disc a dot-like appearance. After
eclosion of pupae, myofibrils were wider than at 72 hours and
obscurin and kettin appeared in a striped pattern. The early
pattern of labelling shows that obscurin begins to assemble into
discrete structures before kettin (Fig. 2E).
Reduction of obscurin expression
Fig. 2. Obscurin in the embryo, larva and pupa of wild-type flies. Muscles
were labelled with anti-obscurin. (A) Wild-type embryo (late stage 17)
showing striations across the muscles, with a gap at the epidermal attachment
site (arrows). (B) Embryo labelled with anti-obscurin (green) and anti-kettin
(an isoform of Sls) (red). Obscurin is either side of the epidermal attachment
site. (C) Embryo of P-element mutant. Labelling is similar to that of the wildtype embryo. (D) Larval body wall muscle, from a fly line with a GFP-sls
gene. Anti-obscurin (red); GFP-kettin (green) marks the Z-discs and is in a
doublet closer to the epidermal attachment site than obscurin in the M-line.
(E) IFM in pupa at 30 hours, 48 hours and 72 hours APF and after eclosion (at
25 ˚C); anti-obscurin (green) and anti-kettin (magenta). At 30 hours, obscurin
has a punctate distribution and kettin is in amorphous strands. At 48 hours,
myofibrils are closely packed and obscurin labelling appears as a broad band
in the M-line and kettin at the Z-disc; at 72 hours, myofibrils are further apart
and labelling of the narrow myofibrils appears as dots at the M-line and Zdisc. Myofibrils become wider in the adult, and obscurin and kettin are
labelled in striations. Scale bars: 5 mm.
We studied the function of obscurin in the assembly of the IFM
sarcomere in flies in which the protein was reduced or absent.
Obscurin expression was reduced by P-element insertion and by
expression of siRNA targeting obscurin. The insertion of a
P-element transposon into a gene can result in reduced expression
of the gene. The mutant, unc89[EY15484], in which a P-element
is inserted close to the start of the first intron of the obscurin gene
was used here (Fig. 1A) and is refererred to as a P-element
mutant. siRNA combined with the GAL4-UAS system with an
appropriate driver can be used to target particular muscles in the
fly. Driver lines were UH3-GAL4, which promotes expression in
IFM, and Mef2-GAL4, which promotes expression in all muscles
(Cripps, 2006; Dietzl et al., 2007; Ranganayakulu et al., 1996).
Driver lines were crossed with two different UAS-unc89-IR lines,
one targeted to exon 34 of the obscurin gene that encodes kinase
2 and the preceding Ig and Fn3 domains, the other to exon 12 that
encodes Ig domains 5, 6 and 7 (supplementary material Table
S1). The effect on the muscles was the same for the two lines,
showing that off-target effects of the siRNA were unlikely.
Results for the exon 34 target are described in this article. The
fly lines UH3-GAL4; UAS-unc89-IR and MEF2-GAL4; UASunc89-IR are referred to as RNAi lines.
Developmental effects of reduced obscurin expression
The effectiveness with which obscurin was knocked down in the
larvae and pupae by siRNA using UH3-GAL4 and Mef2-GAL4
drivers was assessed in western blots. Like the wild-type, larvae
of UH3-GAL4; UAS-unc89-IR flies had the larval obscurin
isoform; the pupae had the two non-IFM isoforms, traces of
the IFM isoform A and some remaining larval isoform
Journal of Cell Science 125 (14)
Journal of Cell Science
3370
Fig. 3. Obscurin and myosin in the IFM of the pupa. IFM was labelled with anti-obscurin (green), anti-myosin (magenta) and phalloidin (red). Pupae were
grown at 29 ˚C. (A) Wild-type pupa. At 30 hours APF, obscurin is labelled in broad striations and myosin is in amorphous strands; at 48 hours, there are
H-zones and obscurin and myosin are labelled in dots at the M-line; at 72 hours, obscurin and myosin striations are sharper and there is a doublet in the myosin
label near the Z-disc; in the adult, myosin is labelled at the Z-disc in a single band. From 48 hours APF to the adult, myofibrils become wider, the H-zone better
defined and sarcomeres longer. (B) Mef2-GAL4; UAS-unc89-IR pupa. There is no obscurin in the IFM at any stage. At 30 hours APF, myosin is in amorphous
strands; at 48 hours, there are no H-zones and myosin appears in broad striations (the fibres were too fragile to isolate single myofibrils); at 72 hours, myosin
striations are in the M-line region; in the adult, myosin labelling is in a dot at the M-line and in a single band at the Z-disc. Myofibrils are narrower than in the
wild-type. Inserts are single myofibrils at 1.56 the magnification of the main panels. Scale bars: 5 mm.
Journal of Cell Science
Obscurin in the flight muscle M-line
(supplementary material Fig. S1B). Therefore, the IFM-specific
UH3-GAL4 driver does not appreciably reduce obscurin levels in
non-flight muscles. No obscurin could be detected in the larvae
and pupae of Mef2-GAL4; UAS-unc89-IR flies. The assembly of
the IFM in the pupae of flies lacking obscurin was compared with
that of wild-type pupae. The position of obscurin, myosin and
actin was followed in pupal stages from 30 hours APF to the
newly emerged adult. In wild-type pupae at 30 hours APF,
obscurin was in broad striations, and myosin and actin in
undifferentiated strands – like kettin at the same stage (Fig. 3A).
At 48 hours, obscurin and myosin were in the M-line. Narrow
myofibrils were packed closely together, and dots of antibody
label at the M-line were seen best in single myofibrils. At 72
hours, myofibrils were wider and the M-line was better defined;
myosin was labelled at the M-line and in a doublet close to the Zdisc. In the adult fly, myosin was labelled at the M-line and in a
single band close to the Z-disc. The monoclonal anti-myosin
antibody used here labels adult IFM in the H-zone and at the end
of the A-band, probably because the epitopes are hidden in the
rest of the A-band. The change in myosin labelling from a double
to a single band close to the Z-disc is likely to be due to
lengthening of the A-band between 72 hours and the adult stage.
Lack of obscurin affected the assembly of myosin during pupal
development. Mef2-GAL4; UAS-unc89-IR pupae had no detectable
obscurin (Fig. 3B). Myosin labelling at 30 hours and 48 hours APF
was similar to that of myofibrils from wild type, although no H-zones
were visible in phalloidin-stained myofibrils at 48 hours. At 72 hours,
fuzzy dots of myosin within the M-line were more separated than at
48 hours, but there were no regular sarcomeres like those seen in
wild-type flies at this stage. In the adult fly, myosin was detected as a
dot at the M-line and also in a band close to the Z disc. The dot-like
3371
labelling at the M-line may be due to a better-defined H-zone in the
core of the myofibrils, allowing better penetration of antibody. The
late appearance of antibody labelling near the Z-disc suggests that
elongation of the A-band was delayed. Developmental changes in the
distribution of kettin (Fig. 2E) were unaffected in Mef2-GAL4; UASunc89-IR flies (not shown), and the position of kettin was the same as
for the wild type in adult IFM (supplementary material Fig. S3B).
Reduced obscurin expression in adult flies
The flight capability of flies was tested to check the effect of
reduced obscurin levels on the function of the IFM. Flies that
were homozygous for the P-element insertion were flightless
(Fig. 4A). To confirm that the phenotype of the P-element mutant
was solely due to an effect on the obscurin gene, the mutant was
rescued by precise excision of the P-element. The rescued flies
could fly as well as the wild-type, showing that the wild-type
obscurin gene was restored. UAS-unc89-IR flies driven by either
UH3-GAL4 or Mef2-GAL4 were flightless, showing that the IFM
was affected.
Obscurin present in the total thoracic muscles and in isolated
IFM of obscurin knockdown flies was compared with that of
wild-type flies (Fig. 4B). The thoracic muscles of the Pelement mutant, unc89[EY15484], lacked all but the smallest
obscurin isoform D, whereas the IFM retained traces of the two
IFM isoforms. The larval isoform was unaffected by the Pelement insertion. As expected, the thoracic muscles of the
UH3-GAL4; UAS-unc89-IR line had the two non-IFM isoforms
B and D, and there was no detectable obscurin in the IFM. The
Mef2-GAL4; UAS-unc89-IR line had no detectable obscurin in
the thoracic muscles or in the IFM. Since siRNA was targeted to
the kinase 2 domain, abolition of the expression of all five obscurin
Fig. 4. Effect of reduced obscurin expression.
(A) Flight tests of wild-type, P-element, and RNAi
knockdown flies; the proportion of flies able to fly
is shown, n520 for each genotype. The
unc89[EY15484] mutant and RNAi lines were
flightless; flight was restored by excising the Pelement. Control flies with UAS-RNAi (dsRNAi) or
GAL4 drivers flew. (B) Obscurin isoforms in Pelement and obscurin RNAi knockdown flies.
Western blots of thorax (T), IFM (F) and larva were
incubated with anti-obscurin (top) or anti-Sls as a
loading control (bottom). The P-element mutant had
the smallest thoracic isoform, reduced IFM
isoforms and a wild-type larval isoform. UH3GAL4; UAS-unc89-IR flies had the two non-IFM
isoforms; there was no obscurin in the Mef2-GAL4;
UAS-unc89-IR flies. Thoraces had three isoforms of
Sls (kettin is the 540 kDa isoform): the lack of the
largest Sls isoform in IFM confirms the purity of the
sample. (C) Obscurin in the IFM. Myofibrils were
labelled with anti-obscurin (green), anti-a-actinin
(magenta) antibodies, and phalloidin (red).
Obscurin in the wild-type M-line is reduced in the
unc89[EY15484] mutant and missing in the RNAi
lines. H-zones (arrowheads) are missing in the
RNAi lines. Z-stacks (top) show obscurin across the
diameter of the myofibril. Scale bar: 5 mm.
3372
Journal of Cell Science 125 (14)
isoforms by the Mef2-GAL4 driver, shows that all these isoforms
have the kinase 2 domain, as well as the kinase 1 domain.
Journal of Cell Science
Structure of myofibrils in obscurin knockdown flies
The effect of the P-element mutation on the structure of the IFM
in adult flies was compared with that of the two RNAi lines
(Fig. 4C). Obscurin in the M-line was distributed throughout the
cross section of the myofibril in wild-type flies; this was the case
for myofibrils labelled with antibodies against Ig14-16 or
kinase 1. Myofibrils in all three knockdown IFMs were
narrower than in the wild-type. Faint labelling of obscurin was
detected in the M-line of the P-element mutant, but there was
none in the UAS-unc89-IR lines driven by UH3-GAL4 or Mef2GAL4. The H-zone in the wild-type sarcomere was resolved in
the P-element mutant but not in the RNAi lines. A similar effect
on the H-zone as a result of downregulating obscurin has been
described (Schnorrer et al., 2010). The narrower H-zone and the
slightly longer sarcomere in the P-element mutant, suggests that
thin filaments were somewhat longer than in the wild type. The
lack of an H-zone in the sarcomeres of the RNAi lines showed
that the ends of the thin filaments in a half sarcomere were not in
register. By contrast, regular a-actinin labelling in all the IFMs
showed that thin filaments were well-aligned where they enter
the Z-disc. Therefore, the misalignment of filament ends in the
H-zone of the IFM in obscurin knockdown flies is probably due
to variability in thin filament length.
We did not expect obscurin in the larval muscle or the jump
muscle (tergal depressor of the trochanter, TDT) of the MEF2-GAL4;
UAS-unc89-IR flies. Obscurin was missing from the muscles,
whereas Z-discs appeared normal (supplementary material Fig.
S2A,B). This confirmed that non-flight muscles were affected in
these flies. The crawling ability of Mef2-GAL4; UAS-unc89-IR
larvae lacking obscurin was slightly reduced compared with control
larvae, whereas UH3-GAL4; UAS-unc89-IR larvae crawled as well
as the controls (supplementary material Fig. S2C). Flies in both
RNAi lines were able to jump as well as control flies. The power for
jumping comes from the action of the TDT on the middle leg (Elliott
et al., 2007). Therefore, obscurin is needed neither for larval crawling
nor for fly jumping.
Effect of reduced obscurin expression on other proteins
in IFM
Reducing the amount of obscurin was likely to affect other
M-line proteins. In wild-type myofibrils, zormin was in both Zdisc and (supplementary material Fig. S3A). In the P-element
mutant, zormin was in the Z-disc – as in the wild-type – whereas
zormin in the M-line was predominately in the core of the
myofibril. In UAS-unc89-IR flies driven by UH3-GAL4 and
Mef2-GAL4, zormin was more diffuse in both the Z-disc and the
M-line. Z-discs were regularly spaced, but in knockdown flies
with the Mef2-GAL4 driver, the edges of Z-discs occasionally
appeared abnormal.
Tropomodulin caps the pointed end of thin filaments at the
borders of the H-zone in Drosophila IFM (Mardahl-Dumesnil
and Fowler, 2001) and misaligned thin filament ends were
expected to affect the position of tropomodulin. In the wild-type
IFM, tropomodulin was in the H-zone (supplementary material
Fig. S3B). In the P-element mutant and UAS-unc89-IR with both
drivers, tropomodulin was confined to the core of the myofibril in
the H-zone, whereas kettin in the Z-disc was unaffected.
Although there was no clear H-zone in myofibrils of the RNAi
lines, tropomodulin was apparently bound to the pointed ends of
thin filaments in the core. It is possible that some thin filaments
were not capped by tropomodulin, resulting in variable filament
lengths as actin polymerized and depolymerized. In IFMs of
obscurin knockdown flies, the weaker staining of tropomodulin
in the M-line and the appearance of non-specific staining at the
Z-disc, may mean that less tropomodulin is specifically
associated with the pointed ends of the thin filaments. Thin
filaments at the periphery of the knockdown myofibrils bypassed
tropomodulin in the core. This suggests that the ends of thin
filaments in the core are better aligned than at the periphery, and
deviation in the length of filaments is more extreme at the
periphery.
The fine structure of IFM in obscurin knockdown flies
The structure of the IFM in the P-element mutant and RNAi lines
was compared with that of wild-type flies. Electron micrographs
(EMs) showed abnormalities in the H-zone and M-line, which
were more severe in RNAi lines than in the P-element mutant.
The H-zone in the wild-type IFM is a clear region across the
middle of the sarcomere, with the denser M-line marking the
mid-point (Fig. 5). The phenotype of the P-element mutant
varied in severity; in mild cases, the H-zone wandered from the
middle of the sarcomere, and the M-line was broken up into
electron-dense aggregates. In a more severe phenotype, H-zones
were shifted further from the middle of the sarcomere. The
abnormalities in sarcomere structure were reversed by excision of
the P-element, confirming that when the wild-type obscurin gene
was restored, the ability to fly was accompanied by normal
muscle structure. IFMs in the RNAi lines showed more extreme
shifts in the H-zone. The core of the myofibril was less affected
than the periphery, where some filaments bypassed the Z-disc.
An overview of myofibrils in wild-type and knockdown IFMs
shows the extent of disruption in the sarcomeres (supplementary
material Fig. S4).
The shift in the position of the H-zone in the sarcomere was
due to asymmetry of thick filaments. The H-zone is formed by
alignment of thick filaments in the middle of the sarcomere,
where the rod regions of myosin molecules are assembled in antiparallel fashion to form the bare zone. In the normal IFM
sarcomere, thin filaments extend to the edge of the bare zone, and
in rigor conditions, crossbridges between thick and thin filaments
appear as arrowheads with the barbed end towards the Z-disc
(Reedy, M. K. and Reedy, M. C., 1985). Thin filaments in half
sarcomeres either side of the bare zone have the opposite
polarity, which can be recognised by the direction of rigor
crossbridges (Fig. 6A). In the P-element mutant, the bare zones
of thick filaments were in the displaced H-zone. The polarity of
crossbridges was reversed either side of the bare zone, and thin
filaments were longer in one half sarcomere than the other. The
effect was more pronounced in the RNAi lines (shown for Mef2GAL4; UAS-unc89-IR in Fig. 6A). The thick filaments were
asymmetrical, with some bare zones far from the middle of the
sarcomere. The polarity of thin filaments followed that of
adjacent thick filaments, resulting in abnormally long or short
thin filaments. Had thin filaments retained the normal length, the
polarity of crossbridges would have been the same either side of a
displaced thick filament bare zone; this was not observed. In both
the P-element mutant and RNAi lines, thin filaments sometimes
extended into the H-zone. A model for the effect of lack of
Journal of Cell Science
Obscurin in the flight muscle M-line
3373
Fig. 5. Structure of the IFM in flies with
reduced obscurin. (A–F) EM images of
(A) wild-type, (B,C) unc89[EY15484],
(D) unc89[EY15484] rescued, (E) UH3GAL4; UAS-unc89-IR and (F) Mef2GAL4; UAS-unc89-IR flies. The H-zone of
the P-element mutant is wavy compared
with the wild-type and there are
aggregates in the H-zone (white arrow). In
a more severe case, bare zones of thick
filaments (black arrows) are shifted from
the middle of the sarcomere. Excision of
the P-element rescues the phenotype.
IFMs in the RNAi lines have more
irregular H-zones and shifted bare zones.
Some filaments bypass the Z-disc at the
myofibril periphery (asterisks). Scale bar:
0.6 mm.
obscurin on the symmetry of thick filaments and the length and
polarity of thin filaments is shown in Fig. 6B.
The extent to which obscurin had been displaced from the
M-line line or was lacking from the sarcomere, was seen in EMs
of cryosections of IFMs labelled with anti-obscurin antibody
and Protein-A–gold (Fig. 7). Gold particles were uniformly
distributed across the M-line region in wild-type IFM, confirming
that obscurin is distributed throughout the cross-section of the Mline. Some obscurin remained in the H-zone of the P-element
mutant. Obscurin was sparsely distributed in UH3-GAL4;
UAS-unc89-IR flies, and there was a negligible amount in the
Mef2-GAL4; UAS-unc89-IR flies.
The structure of IFM thick filaments in obscurin
knockdown flies
The asymmetry of thick filaments in the IFM of flies with
reduced obscurin was seen in EM images of isolated filaments.
Thick filaments from the wild-type IFM had a clear bare zone in
the middle of the filament, whereas in the IFM of knockdown
flies, the bare zone was frequently shifted towards one end of the
filament (Fig. 8A). The majority of filaments from the P-element
mutant unc89[EY15484] had a central bare zone, and there were
also filaments with a variable shift in the bare zone (Fig. 8B).
Some filaments from the RNAi lines had a central bare zone
but, in the majority, the bare zone was shifted. UH3-GAL4;
UAS-unc89-IR flies had a greater proportion of filaments with
central bare zones than the line driven by Mef2-GAL4. The
majority of thick filaments in knockdown flies had a length that
was similar to that of the wild-type filaments, although there was
more variability in the length of filaments in the RNAi lines, and
a few filaments were more than twice the normal length. It is
likely that long thick filaments originated from the periphery of
the myofibril, where the filaments bypassed the Z-disc.
Association of obscurin with thick filaments
The abnormalities in the assembly of thick filaments in
sarcomeres lacking obscurin suggest that the protein is
associated with thick filaments. It had previously been shown
that obscurin and myosin exist in a complex in vertebrate skeletal
muscle (Kontrogianni-Konstantopoulos et al., 2004), and the
same was found for the IFM (Fig. 9A). Further confirmation that
obscurin is associated with thick filaments came from EM images
of labelled cryosections. In parts of the sections, thick filaments
were separated from thin filaments and obscurin was in a discrete
region of the filaments, probably corresponding to the mid-region
of the filament at the M-line (Fig. 9B).
Discussion
The function of obscurin in development and integrity of the
flight muscle sarcomere was studied by reducing the expression
of the protein. The advantage of using Drosophila is that obscurin
is encoded by a single gene, which can be downregulated either
by P-element transformation or by using RNAi. The two genes in
higher vertebrates that encode obscurin and the smaller
homologue Obsl1, have not – so far – been knocked out
simultaneously, leaving the possibility that they compensate for
each other (Lange et al., 2009). In zebrafish, there are two
obscurin and two obsl1 genes, which compounds the problem
(Geisler et al., 2007; Raeker et al., 2006; Raeker et al., 2010). The
single gene in C. elegans that encodes UNC-89 has been targeted
by siRNA directed to the body wall muscle. These RNAi
experiments have shown that UNC-89 is needed for the overall
organisation of the muscle (Small et al., 2004). Here, we have
taken advantage of the regularity in the structure of Drosophila
IFM to show how the lack of obscurin affects the lattice of thick
and thin filaments.
The largest isoform of Drosophila obscurin is a little over half
the size of the largest isoform of C. elegans UNC-89 or vertebrate
Journal of Cell Science 125 (14)
Journal of Cell Science
3374
Fig. 6. See next page for legend.
Journal of Cell Science
Obscurin in the flight muscle M-line
obscurin; this is largely due to the number of Ig domains: 21 in
Drosophila, 53 in the nematode and up to 67 in vertebrate obscurinB. The domain architecture of the Drosophila protein is similar to
that of the nematode UNC-89, with SH3 and DH–PH domains near
the N-terminus, and two kinase domains at the C-terminus. The
invertebrate proteins resemble vertebrate obscurin-B in having
kinase domains at the C-terminus, rather than the ankyrin-binding
domain of obscurin-A. The five isoforms we have identified in
Drosophila muscles have Igs from the tandem Ig region and both
the kinase domains. The main isoform in the IFM has all the
domains illustrated in Fig. 1B. The appearance of a smaller IFM
isoform after eclosion of the pupa was unexpected. However,
changes in the amounts of obscurin and Sls isoforms have been
observed throughout the lifespan of Drosophila, and isoform shifts
in these proteins may affect fibre stiffness (Miller et al., 2008).
The distribution of obscurin throughout the M-line region of
the sarcomere is in contrast to the arrangement of the larger
obscurin isoforms in vertebrates, where obscurin-A and -B are
confined to the periphery of the myofibril, and Obsl1 is inside
(Fukuzawa et al., 2008; Kontrogianni-Konstantopoulos et al.,
2003). As the ankyrin-binding region at the C-terminus of the
vertebrate obscurin-A is not present, it is unlikely that Drosophila
obscurin is directly linked to the SR. The much reduced SR of
Drosophila IFM is in the form of small vesicles positioned
midway between the Z-disc and the M-line and there is no
network of SR extending longitudinally along myofibrils, like
that found in vertebrate skeletal muscle (Shafiq, 1964; Razzaq
et al., 2001). Obscurin with 21 Ig domains might extend 80–
100 nm along the sarcomere from the M-line; as the SR vesicles
would be about 800 nm from the M-line, it is unlikely there
would be any interaction between obscurin and the SR.
Obscurin in developing muscles of embryo and larva
Obscurin is in the M-line in somatic muscles throughout
development. Unlike vertebrate obscurin, it was never observed
in the Z-disc (Carlsson et al., 2008; KontrogianniKonstantopoulos et al., 2009; Young et al., 2001). The protein
is concentrated in the M-line relatively late in embryogenesis,
during stage 17, when sarcomeres are being assembled. Myofilin
and paramyosin, in the core of thick filaments, accumulate at the
same time and expression peaks late in embryogenesis (Qiu et al.,
2005; Vinós et al., 1992). Thus, the association of myosin with
subsidiary thick filament proteins occurs as the filaments are
assembled in the sarcomere.
Fig. 6. Symmetry of thick and thin filaments in the IFM. (A) In the wildtype, the M-line appears as a broadening of the thick filament. In
unc89[EY15484] flies, the M-line is replaced by dense aggregates between
thick filaments (white arrow). Bare zones (black arrows) are more shifted in
Mef2-GAL4; UAS-unc89-IR flies. Myofibrils are in rigor and chevrons
(crossbridges) on thin filaments show that the polarity of filaments changes
either side of a shifted thick filament bare zone. M, M-line or mid-point of the
sarcomere. Rows of chevrons (indicated by asterisks and arrowheads) are best
viewed obliquely. Scale bar, 200 nm. (B) Model for the structure of the IFM
sarcomere. Top, wild-type: the bare zone on thick filaments is central and the
polarity of crossbridges on thin filaments is symmetrical. Variation in the
length of thin filaments in the bare zone by a tropomyosin unit is shown
(Haselgrove and Reedy, 1984). Bottom, flies lacking obscurin: thin (actin)
filaments are longer on one side of a shifted bare zone than the other. The
polarity of crossbridges is determined by the thin filament, and stays the same
up to the edge of a shifted bare zone. My, myosin; Ac, actin.
3375
Fig. 7. Obscurin in the IFM. Cryosections were labelled with anti-obscurin
and Protein-A–gold. Histograms below the EM images show the distribution
of gold particles. (A) In wild-type IFM, obscurin is in the M-line. (B) In the
unc89[EY15484] mutant, remaining obscurin is in the M-line region.
(C) There are obscurin remnants in the distorted H-zone of the UH3-GAL4;
UAS-unc89-IR sarcomere. (D) The Mef2-GAL4; UAS-unc89-IR sarcomere has
negligible obscurin. Knockdown of obscurin in IFM is partial in the P-element
mutant and effectively complete in the RNAi lines. Scale bars: 500 nm.
Embryonic and larval development was unaffected in both the
P-element and the RNAi knockdown flies, and pupae eclosed
normally. The position of obscurin in the embryo of the Pelement mutant, and the amount expressed in the larva were
similar to that of the wild type. There are internal promoter sites
in the C. elegans unc89 gene (Small et al., 2004) and in the
vertebrate obscurin gene (Fukuzawa et al., 2005; Russell et al.,
2002), which can lead to expression of smaller isoforms. The
larval isoform is one of the smallest; if the Drosophila gene has
multiple promoter sites, the larval isoform might be regulated by
an internal promoter that was not affected by the P-element
insertion in the first intron. Interestingly, the smallest isoform in
the thoracic muscles of adult flies having the P-element insertion
is expressed normally, whereas expression of the larger isoforms
is considerably reduced (Fig. 3B). The small isoform might also
be the result of transcription from an internal promoter.
Although larval muscles of progeny from the Mef2-GAL4;
UAS-unc89-IR flies had no detectable obscurin, the ability of the
larvae to crawl was only slightly less than that of wild-type
larvae, and they were able to develop into adult flies. There are
no well-defined H-zones or M-lines in the body-wall muscle of
the wild-type larva (Ball et al., 1985), and obscurin might not be
essential for maintaining the rather irregular striations in this
muscle type. Similarly, although the TDT in adult flies from the
same RNAi line had no detectable obscurin in the M-line, the
sarcomeres showed regular striations and flies were able to jump
as well as wild-type flies. Other muscles in the thorax of these
flies also lacked obscurin; in the case of the leg muscles, this did
not prevent the flies from walking. Therefore, the less well
ordered muscles like the TDT, and other non-flight muscles in the
Journal of Cell Science
3376
Journal of Cell Science 125 (14)
Fig. 8. Structure of thick filaments in the IFM. (A) Isolated
thick filaments negatively or positively-stained: the bare zone
of the wild-type filament is central and those of RNAi lines
driven by UH3-GAL4 or Mef2-GAL4 are offset. The filament
in the bottom panel is 7.8 mm long, over twice the wild-type
length. Scale bars, 500 nm. (B, top) The shortest distance from
the end of the filament to the centre of the bare zone, relative
to the length of the filament was measured. All samples had
some filaments with central bare zones (shown as 0.5 in the
figure). The position of the bare zone varied most in the RNAi
lines. (B, bottom) The length of the majority of filaments in
IFM of knockdown flies was close to that of wild-type flies
(3.2 mm).
thorax, can tolerate some misalignment of the thick filaments
during development of the muscles in the larva, pupa and adult.
Obscurin in IFM of pupa and adult fly
In contrast to the non-flight muscles in the thorax, the IFM cannot
function without obscurin. None of the obscurin knockdown flies
was able to fly. This is expected because the regularity of the
filament lattice is essential for oscillatory contraction of flight
muscle (Dickinson et al., 1997). During development in the pupa,
the IFM sarcomere is assembled by addition of thick and thin
filaments to an initial array of interdigitating filaments between
Z-bodies: new filaments are formed as they associate with the
existing sarcomere (Reedy and Beall, 1993). Evidently, obscurin
is needed to ensure that the middle of a growing thick filament is
in the middle of the sarcomere. Reedy and Beall show the first
thick filaments forming a sarcomere at 40 hours APF (at 22 ˚C),
and broad density appearing at the M-line at 42 hours, becoming
narrower at 60 hours, by which time recognisable sarcomeres
with well-defined Z-discs are formed. Here, we found that
obscurin has a rudimentary periodicity in the IFM at 30 hours
APF, before kettin, actin or myosin. Interestingly, kettin is
distributed in strands along the developing myofibril, before
migrating to the Z-disc at 48 hours. The development of the Zdisc is independent of obscurin and largely unaffected in obscurin
knockdown. Myosin assembles into periodic structures in the
absence of obscurin, although the distribution of myosin is
abnormal in the mid-region of the sarcomere, where there is no
regular H-zone. Therefore, although obscurin becomes periodic
before kettin or myosin, it is not necessary for their subsequent
arrangement into repeating structures. Obscurin is needed for the
assembly of myosin into symmetrical A-bands.
The length of the IFM sarcomere is dependent on the length of
thick filaments. On the outside of the thick filament, flightin
limits the growth of the filaments and prevents the formation of
excessively long sarcomeres (Contompasis et al., 2010; Reedy
et al., 2000). The effect of a null mutation in the flightin gene
(fln0) on the structure of the IFM is more extreme than the effect
Fig. 9. Association of obscurin with myosin. (A) SDS-PAGE of proteins
bound to anti-obscurin. Protein-A beads with (lanes 1 and 3) and without (lane
2) anti-obscurin, were incubated with an extract of proteins from the fly
thorax. Proteins pelleted with anti-obscurin were obscurin (Obs) and myosin
(Myo). (B) EM image of a cryosection of thick filaments in IFM labelled with
anti-obscurin antibody and Protein–A-gold. Obscurin is confined to a small
area of the thick filaments. Scale bar: 200 nm.
Obscurin in the flight muscle M-line
of lack of obscurin: sarcomeres are up to 30% longer than in the
wild type wild-type and become increasingly disordered in the
adult fly. Obscurin has little effect on sarcomere length, although
it limits the range of thick filament lengths and influences the
length of thin filaments.
Journal of Cell Science
Obscurin and sarcomere assembly
The less severe effect of the P-element mutation on the structure
of the IFM, compared with that of the RNAi lines, might be due
to a low level of obscurin in the muscles. A limited amount of
obscurin produced early in sarcomere assembly would result in a
core of thick filaments with near-central bare zones and
peripheral filaments that were asymmetrical. Zormin was
confined to the myofibril core in the obscurin P-element
mutant and dislodged from the M-line in the RNAi lines; this
suggests that obscurin and zormin are associated in the M-line.
Zormin in the Z-disc was also affected, although there is no
obscurin in the Z-disc of wild-type myofibrils; it is possible that
zormin, once freed from the M-line, bound irregularly to a
binding partner in the Z-disc.
The length and polarity of thin filaments are determined by the
symmetry of thick filaments. The finding that thin filaments stop
growing once they reach the H-zone, even if the H-zone is shifted
to one side of the sarcomere, is consistent with a dynamic model
for filament assembly in IFM (Mardahl-Dumesnil and Fowler,
2001). These authors showed that thin filaments grow from the
pointed end (near the H-zone) and propose that uncapping of
tropomodulin from the ends of the filaments is favoured by
actomyosin interactions. A premature end to the actomyosin
interactions, due to a shifted H-zone, would promote capping of
thin filaments and prevent further elongation, resulting in
variable thin filament lengths. Partial extension of some thin
filaments into the H-zone is likely to be due to rigor contraction.
Asymmetrical thick filaments have been observed in the leg
muscles of a crab (Franzini-Armstrong, 1970). In these muscles,
the length of the thin filaments is proportional to the length of the
thick filaments in a half sarcomere. Whole A-bands have
uniformly asymmetric thick filaments, which is unlike the
pattern in the IFM of obscurin knockdown flies, where the bare
zone is variably shifted in individual thick filaments. The crab
muscles have no M-line and obscurin – if present – does not
produce uniformly symmetrical sarcomeres.
So far, obscurin and zormin are the only proteins containing Ig
domains that have been identified in the M-line of Drosophila
IFM. Obscurin is associated with myosin in the thick filaments,
but it is not clear why binding is restricted to the M-line. In the
vertebrate sarcomere, binding sites in the C-terminal region of
titin can dock obscurin and myomesin in the M-line. It is possible
that obscurin and zormin bind specifically to an anti-parallel
array of the rod regions of myosin molecules. Obscurin is
predicted to be at least 80 nm long. Zormin, with nine Ig domains
as well as other stretches of sequence, would be 40 to 50 nm
long. The centre-to-centre distance between thick filaments is 56
nm in Drosophila IFM (Irving and Maughan, 2000), the
interfilament spacing is 36 nm, so both molecules would easily
span the distance between neighbouring filaments. The two
proteins might form a complex that crosslinks thick filaments in
the M-line, although this is likely to be simpler than the
arrangement in the M-line of vertebrate muscles in which titin,
myomesin and obscurin are all linked (Fukuzawa et al., 2008;
Gautel, 2011).
3377
The part played by the signalling domains in Drosophila
obscurin may have something in common with the betterunderstood function of those domains in the nematode and in
vertebrates. The effect of reducing obscurin expression with
siRNA is similar in Drosophila IFM, C. elegans body wall
muscle and vertebrate skeletal muscle: M-lines are missing and
A-bands disordered, whereas Z-discs are little affected
(Kontrogianni-Konstantopoulos et al., 2006; Raeker et al.,
2006; Small et al., 2004). In the case of the IFM (and possibly
also C. elegans body-wall muscle), abnormalities in the A-band
occur during development; they can be understood from the
evidence that obscurin controls myosin assembly into
symmetrical filaments throughout the sarcomere. In vertebrate
skeletal muscle, the large obscurin isoforms at the periphery of
the myofibril would be in the wrong place to nucleate the
assembly of thick filaments within the sarcomere; in these
muscles, the signalling domains of obscurin might indirectly
influence recruitment of myosin into the A-band. However, the
muscles of a mouse in which the obscurin gene was knocked out
had normal sarcomere structure, although showing some changes
in SR architecture (Lange et al., 2009). The obscurin signalling
domains were evidently not necessary for A-band assembly. A
study of the function of the signalling domains in Drosophila
obscurin, for which there is a single gene, may help resolve these
inconsistencies.
In summary, obscurin in Drosophila IFM controls the
incorporation of myosin molecules into the thick filament, a
process that determines the symmetry of the filament. This, in
turn, affects the length and polarity of thin filaments. Obscurin is
needed in the IFM to maintain the particular lattice structure that
is all-important for this unusual muscle.
Materials and Methods
Genetic crosses, pupal aging, larval crawling, fly jumping and flight tests
Fly strain y’w67c23; P{w+y+EPgy2} [EY15484] contains a P-element in the first
intron of the obscurin gene (CG30171) and was obtained from the Bloomington
Drosophila Stock Center. To mobilize the P-element, virgin flies homozygous for
the P-element were crossed en masse with males of the active transposase-coding
line y w/Y; CyO/Sp; TM6b/2-3 Dr. Male y w/Y; P{EPgy2}Unc-89EY15484/CyO; D23 Dr progeny were crossed with virgin y w; CyO/Sco and jumpouts were identified
by screening the progeny for y w; CyO, non-Dr males with white eyes. A
homozygous line was established for each jumpout recovered, and analyzed by
isolating genomic DNA by using PURGENE DNA Isolation Kit (Gentra Systems)
and by performing PCR reactions across the former P-element insertion site.
Primers are in listed in supplementary material Table S2.
For RNAi experiments, obscurin UAS-responder lines (transformant IDs 29413
and 24378) were obtained from the Vienna Drosophila RNAi Center
(stockcenter.vdrc.at) and crossed with the transgenic driver lines Mef2-GAL4
and UH3-GAL4 (from Upendra Nongthomba, IISc, Bangalore, India). Crosses
were performed at 29 ˚C. Pupae were staged as described (Reedy and Beall, 1993):
white pre-pupae with everted spiracles (defined as 0 hour APF) were collected and
kept at 25 ˚C or 29 ˚C for a specified time.
Larval crawling and fly jumping were tested as described (Elliott et al., 2007;
Vincent et al., 2012). Three-day-old flies were flight tested (Cripps et al., 1994).
Flies were released inside a perspex box illuminated from above, and scored for
the ability to fly up, horizontally or down.
Sequence analysis and protein expression
mRNA was extracted from IFMs of late pupae (96 hours APF) with RNeasy Mini
kit (Qiagen), and cDNA synthesised with First Strand cDNA synthesis kit
(Stratagene). Predicted intron–exon junctions (www.flybase.org) were analysed
using combinations of 16 sense and 16 reverse primers (supplementary material
Table S2), and PCR products were sequenced. Confirmed exons and encoded
domains were analysed with SMART, (http://smart.embl.de), (Letunic et al.,
2004).
Kinase 1 cDNA encoding amino acid residues 3159–3538 was cloned into a
modified pENTR gateway vector with an N-terminal 6His-tag (Mathias Gautel,
King’s College, London, UK). The coding sequence was recombined into
3378
Journal of Cell Science 125 (14)
BaculoDirect Linear DNA (Invitrogen) and expressed in sf9 cells; kinase 1 protein
was purified on Ni-NTA agarose (GE Healthcare).
Antibodies
Antibodies used here were rabbit anti-obscurin Ig14-16 and anti-zormin (B1)
(Burkart et al., 2007); rat anti-tropomodulin serum (from Velia Fowler, Scripps
Research Institute, CA); rat monoclonal anti-kettin (anti-Sls), MAC 155 and antia-actinin, MAC 276 (Lakey et al., 1990); rat monoclonal anti-myosin, MAC 147
(Qiu et al., 2005). Rabbit antibody was raised against kinase1, and IgG was
isolated from the rabbit serum (Biogenes, Berlin).
Journal of Cell Science
Immunolabelling and microscopy
Staged embryos were dechorionated and hot fixed, or fixed in 4% paraformaldehyde,
and devitellinised before labelling, dehydrating and embedding (Kreisköther et al.,
2006). Third instar larvae of wild-type flies or flies expressing GFP-tagged Sls
(Morin et al., 2001) were fixed as described above, washed in PBS supplemented
with 0.5% Triton X-100 (PBT), then labelled with primary and secondary antibodies.
IFMs were dissected from glycerinated half thoraces and washed in relaxing solution
(0.1 M NaCl, 20 mM Na-phosphate pH 7.2, 5 mM MgCl2, 5 mM ATP, 5 mM
EGTA) with protease inhibitors, and separated into myofibrils (Burkart et al., 2007).
These were labelled with primary antibody and rhodamine-phalloidin (Sigma),
washed in relaxing solution, then labelled with secondary antibody. Pupal IFMs
and TDT were dissected in relaxing solution, fixed immediately in 4%
paraformaldehyde, washed in relaxing solution, and labelled with primary and
secondary antibodies. Antibodies were diluted in relaxing solution (IFM and TDT)
or PBT (embryo and larval muscle). Antibodies against obscurin (Ig14-16), kettin,
myosin, zormin and a-actinin were affinity-purified IgG, diluted 1:100 (or, in the
case of zormin, 1:50), to about 10 mg/ml. Anti-tropomodulin serum was diluted
1:200. Biotinylated secondary antibodies were used for embryos (Vector
Laboratories, USA) and fluorescently labelled antibodies for double-labelled
embryos, larvae and IFM (Jackson ImmunoResearch, USA). Samples were
examined with a Zeiss LSM510 or Axioskop 50 confocal microscope with 636
oil-immersion objective and processed with LSM software.
Electron microscopy
Half thoraces were glycerinated in relaxing solution and processed as described
(Farman et al., 2009; Reedy and Beall, 1993; Reedy et al., 1989). Thoraces were
washed six times in rigor solution (40 mM KCl, 5 mM MOPS, pH 6.8, 5 mM
EGTA, 5 mM MgCl2, 5 mM NaN3), fixed in 3% glutaraldehyde, 0.2% tannic acid,
and washed in rigor solution, then in 100 mM Na-phosphate pH 6.0, 10 mM
MgCl2. Secondary fixation in 1% osmium tetroxide, block staining in 2% uranyl
acetate and dehydration in ethanol and embedding in Araldite were as before.
Sections (25–50 nm) were stained with 7% uranyl acetate for 30 minutes to
1 hour, followed by Sato lead stain for 1 min.
For cryosectioning and immuno-EM, IFMs in relaxing solution with protease
inhibitors were fixed in 4% paraformaldehyde and infiltrated with 2.1 M sucrose
(Burkart et al., 2007; Lakey et al., 1990). Samples were frozen in liquid N2,
sectioned, then blocked with 5% foetal calf serum and labelled with anti-obscurin
IgG (0.1 mg/ml), and Protein-A–gold (10 nm). Sections were stained with methyl
cellulose and uranyl acetate. Thick filament preparations were negatively stained
with 1% uranyl acetate. Samples were examined with a FEI Tecnai BioTWIN
electron microscope at 120 kV.
SDS-PAGE and immunoblotting
Samples were analysed using 3% SDS-PAGE with 1.5% agarose (Tatsumi and
Hattori, 1995). Third instar larvae in cold PBS were decapitated and internal
tissues removed. The cuticle with body-wall muscles was transferred to sample
buffer. Pupae were removed from puparia at specific times APF. A mid-line dorsal
incision was made and the abdomen removed. Cold PBS was aspirated through the
incision to remove sarcolytes, then the head was removed and the thorax
transferred to sample buffer. Adult thoraces were frozen in liquid N2 immediately
after dissection. IFMs were dissected from glycerinated thoraces. Tissues were
homogenized in sample buffer with 6 M urea and protease inhibitors, and gels
were immuno-blotted and developed using a chemiluminescent substrate
(Millipore) (Burkart et al., 2007). Anti-kettin (Sls) hybridoma supernatent was
diluted 1:1000. Anti-obscurin (Ig14-16) IgG was 1 mg/ml, anti-obscurin (kinase1)
IgG was 20 mg/ml and anti-myosin IgG was 0.4 mg/ml.
Co-immunoprecipitation assay
Proteins bound to obscurin were detected by precipitation with Protein-A beads
coated with antibody (Bullard et al., 2004). Glycerinated half thoraces were
washed in rigor solution, then homogenised in extraction buffer (1 M NaCl, 50
mM Na-phosphate pH 7.2, 2 mM MgCl2, 5 mM DTT) and incubated on ice for
2 hours. The homogenate was diluted in binding buffer (0.2 M NaCl, 20 mM Naphosphate pH 7.2, 2 mM MgCl2, 0.1% Triton X-100, 2 mM DTT) and
centrifuged. Protein-A beads with bound anti-obscurin IgG, in binding buffer,
were incubated with the muscle extract at 4 ˚C. Beads were washed with binding
buffer and proteins were eluted with SDS-sample buffer. Bands on SDS-gels were
analysed by MALDI-TOF mass spectroscopy on an Applied Biosystems 4700
Proteomics analyser. Proteins were identified from a Drosophila database by using
MASCOT.
Thick filaments
Thick filaments were released from myofibrils by mild digestion with calpain to
separate them from the Z-disc (Contompasis et al., 2010; Reedy et al., 1981).
Myofibrils, prepared from glycerinated IFMs of 10–20 wild-type or obscurin
knockdown flies, were suspended in relaxing solution (10 mM NaCl, 20 mM
MOPS pH 6.8, 5 mM Mg-acetate, 5 mM EGTA, 5 mM ATP, 2 mM DTT, 5 mM
NaN3), then centrifuged and resuspended in 30 ml of 20 mM imidazole pH 6.8,
1 mM EDTA, 1 mM EGTA, 5 mM mercaptoethanol, 30% glycerol with
15 mM mcalpain (Calbiochem); CaCl2 was added to 2 mM and myofibrils
incubated at room temperature for 30 min. Relaxing solution (100 ml) and 100 mM
calpain inhibitor were added, and the suspension was passed through a 20G needle
five times to separate the filaments. The suspension was centrifuged at 1500 g for
3 minutes to remove undissociated myofibrils.
Acknowledgements
We are grateful to Upendra Nongthomba for UH3-GAL4 driver flies
and to Velia Fowler for anti-tropomodulin serum. Meg Stark assisted
with EM and Adam Dowle with mass-spectroscopy (York
Technology Facility). We thank Sean Sweeney, Peter Harrison and
Mathias Gautel for helpful advice, and Renate Renkawitz-Pohl for
support. Mary Reedy made many suggestions on EM preparations
and this paper is dedicated to her memory.
Funding
The work was supported by a European Union FP6 Network of
Excellence grant, MYORES, project number 511978 to B.B.; a
Medical Research Council postdoctoral fellowship to A.A. in M.
Gautel’s group, King’s College, London; and a Canadian Institutes of
Health Research operating grant, number MOP-93727 to F.S.
Supplementary material available online at
http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.097345/-/DC1
References
Agarkova, I. and Perriard, J. C. (2005). The M-band: an elastic web that crosslinks
thick filaments in the center of the sarcomere. Trends Cell Biol. 15, 477-485.
AL-Khayat, H. A., Hudson, L., Reedy, M. K., Irving, T. C. and Squire, J. M. (2003).
Myosin head configuration in relaxed insect flight muscle: x-ray modeled resting
cross-bridges in a pre-powerstroke state are poised for actin binding. Biophys. J. 85,
1063-1079.
Bagnato, P., Barone, V., Giacomello, E., Rossi, D. and Sorrentino, V. (2003). Binding
of an ankyrin-1 isoform to obscurin suggests a molecular link between the
sarcoplasmic reticulum and myofibrils in striated muscles. J. Cell Biol. 160, 245-253.
Ball, E., Ball, S. and Sparrow, J. (1985). A mutation affecting larval muscle
development in Drosophila melanogaster. Dev. Genet. 6, 77-92.
Bang, M. L., Centner, T., Fornoff, F., Geach, A. J., Gotthardt, M., McNabb, M.,
Witt, C. C., Labeit, D., Gregorio, C. C., Granzier, H. et al. (2001). The complete
gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform,
and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ.
Res. 89, 1065-1072.
Benian, G. M., Tinley, T. L., Tang, X. and Borodovsky, M. (1996). The
Caenorhabditis elegans gene unc-89, required fpr muscle M-line assembly, encodes
a giant modular protein composed of Ig and signal transduction domains. J. Cell Biol.
132, 835-848.
Bullard, B., Ferguson, C., Minajeva, A., Leake, M. C., Gautel, M., Labeit, D., Ding,
L., Labeit, S., Horwitz, J., Leonard, K. R. et al. (2004). Association of the
chaperone alphaB-crystallin with titin in heart muscle. J. Biol. Chem. 279, 7917-7924.
Bullard, B., Burkart, C., Labeit, S. and Leonard, K. (2005). The function of elastic
proteins in the oscillatory contraction of insect flight muscle. J. Muscle Res. Cell
Motil. 26, 479-485.
Burkart, C., Qiu, F., Brendel, S., Benes, V., Hååg, P., Labeit, S., Leonard, K. and
Bullard, B. (2007). Modular proteins from the Drosophila sallimus (sls) gene and
their expression in muscles with different extensibility. J. Mol. Biol. 367, 953-969.
Carlsson, L., Yu, J. G. and Thornell, L. E. (2008). New aspects of obscurin in human
striated muscles. Histochem. Cell Biol. 130, 91-103.
Contompasis, J. L., Nyland, L. R., Maughan, D. W. and Vigoreaux, J. O. (2010).
Flightin is necessary for length determination, structural integrity, and large bending
stiffness of insect flight muscle thick filaments. J. Mol. Biol. 395, 340-348.
Cripps, R. M. (2006). The contribution of genetics to the study of insect flight muscle
formation. In Nature’s Versatile Engine- Insect Flight Muscle Inside And Out (ed. J.
Vigoreaux). Georgetown: Landes Bioscience.
Journal of Cell Science
Obscurin in the flight muscle M-line
Cripps, R. M., Ball, E., Stark, M., Lawn, A. and Sparrow, J. C. (1994). Recovery of
dominant, autosomal flightless mutants of Drosophila melanogaster and identification of a new gene required for normal muscle structure and function. Genetics 137,
151-164.
Dickinson, M. H., Hyatt, C. J., Lehmann, F. O., Moore, J. R., Reedy, M. C., Simcox,
A., Tohtong, R., Vigoreaux, J. O., Yamashita, H. and Maughan, D. W. (1997).
Phosphorylation-dependent power output of transgenic flies: an integrated study.
Biophys. J. 73, 3122-3134.
Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser, B.,
Kinsey, K., Oppel, S., Scheiblauer, S. et al. (2007). A genome-wide transgenic
RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151-156.
Elliott, C. J., Brunger, H. L., Stark, M. and Sparrow, J. C. (2007). Direct
measurement of the performance of the Drosophila jump muscle in whole flies. Fly
(Austin) 1, 68-74.
Farman, G. P., Miller, M. S., Reedy, M. C., Soto-Adames, F. N., Vigoreaux, J. O.,
Maughan, D. W. and Irving, T. C. (2009). Phosphorylation and the N-terminal
extension of the regulatory light chain help orient and align the myosin heads in
Drosophila flight muscle. J. Struct. Biol. 168, 240-249.
Franzini-Armstrong, C. (1970). Natural variability in the length of thin and thick
filaments in single fibres from a crab, Portunus depurator. J. Cell Sci. 6, 559-592.
Fukuzawa, A., Idowu, S. and Gautel, M. (2005). Complete human gene structure of
obscurin: implications for isoform generation by differential splicing. J. Muscle Res.
Cell Motil. 26, 427-434.
Fukuzawa, A., Lange, S., Holt, M., Vihola, A., Carmignac, V., Ferreiro, A., Udd, B.
and Gautel, M. (2008). Interactions with titin and myomesin target obscurin and
obscurin-like 1 to the M-band: implications for hereditary myopathies. J. Cell Sci.
121, 1841-1851.
Gautel, M. (2011). The sarcomeric cytoskeleton: who picks up the strain? Curr. Opin.
Cell Biol. 23, 39-46.
Geisler, S. B., Robinson, D., Hauringa, M., Raeker, M. O., Borisov, A. B., Westfall,
M. V. and Russell, M. W. (2007). Obscurin-like 1, OBSL1, is a novel cytoskeletal
protein related to obscurin. Genomics 89, 521-531.
Haselgrove, J. C. and Reedy, M. K. (1984). Geometrical constraints affecting
crossbridge formation in insect flight muscle. J. Muscle Res. Cell Motil. 5, 3-24.
Irving, T. C. and Maughan, D. W. (2000). In vivo x-ray diffraction of indirect flight
muscle from Drosophila melanogaster. Biophys. J. 78, 2511-2515.
Kontrogianni-Konstantopoulos, A., Jones, E. M., Van Rossum, D. B. and Bloch,
R. J. (2003). Obscurin is a ligand for small ankyrin 1 in skeletal muscle. Mol. Biol.
Cell 14, 1138-1148.
Kontrogianni-Konstantopoulos, A., Catino, D. H., Strong, J. C., Randall, W. R. and
Bloch, R. J. (2004). Obscurin regulates the organization of myosin into A bands. Am.
J. Physiol. Cell Physiol. 287, C209-C217.
Kontrogianni-Konstantopoulos, A., Catino, D. H., Strong, J. C., Sutter, S., Borisov,
A. B., Pumplin, D. W., Russell, M. W. and Bloch, R. J. (2006). Obscurin modulates
the assembly and organization of sarcomeres and the sarcoplasmic reticulum. FASEB
J. 20, 2102-2111.
Kontrogianni-Konstantopoulos, A., Ackermann, M. A., Bowman, A. L., Yap, S. V.
and Bloch, R. J. (2009). Muscle giants: molecular scaffolds in sarcomerogenesis.
Physiol. Rev. 89, 1217-1267.
Kreisköther, N., Reichert, N., Buttgereit, D., Hertenstein, A., Fischbach, K. F. and
Renkawitz-Pohl, R. (2006). Drosophila rolling pebbles colocalises and putatively
interacts with alpha-Actinin and the Sls isoform Zormin in the Z-discs of the
sarcomere and with Dumbfounded/Kirre, alpha-Actinin and Zormin in the terminal Zdiscs. J. Muscle Res. Cell Motil.27, 93-106.
Lakey, A., Ferguson, C., Labeit, S., Reedy, M., Larkins, A., Butcher, G., Leonard,
K. and Bullard, B. (1990). Identification and localization of high molecular weight
proteins in insect flight and leg muscle. EMBO J. 9, 3459-3467.
Lange, S., Ouyang, K., Meyer, G., Cui, L., Cheng, H., Lieber, R. L. and Chen, J.
(2009). Obscurin determines the architecture of the longitudinal sarcoplasmic
reticulum. J. Cell Sci. 122, 2640-2650.
Letunic, I., Copley, R. R., Schmidt, S., Ciccarelli, F. D., Doerks, T., Schultz, J.,
Ponting, C. P. and Bork, P. (2004). SMART 4.0: towards genomic data integration.
Nucleic Acids Res. 32, D142-D144.
Linke, W. A. (2008). Sense and stretchability: the role of titin and titin-associated
proteins in myocardial stress-sensing and mechanical dysfunction. Cardiovasc. Res.
77, 637-648.
Mardahl-Dumesnil, M. and Fowler, V. M. (2001). Thin filaments elongate from their
pointed ends during myofibril assembly in Drosophila indirect flight muscle. J. Cell
Biol. 155, 1043-1054.
Miller, M. S., Lekkas, P., Braddock, J. M., Farman, G. P., Ballif, B. A., Irving,
T. C., Maughan, D. W. and Vigoreaux, J. O. (2008). Aging enhances indirect flight
muscle fiber performance yet decreases flight ability in Drosophila. Biophys. J. 95,
2391-2401.
Morin, X., Daneman, R., Zavortink, M. and Chia, W. (2001). A protein trap strategy
to detect GFP-tagged proteins expressed from their endogenous loci in Drosophila.
Proc. Natl. Acad. Sci. USA 98, 15050-15055.
3379
Perz-Edwards, R. J., Irving, T. C., Baumann, B. A., Gore, D., Hutchinson, D. C.,
Kržič, U., Porter, R. L., Ward, A. B. and Reedy, M. K. (2011). X-ray diffraction
evidence for myosin-troponin connections and tropomyosin movement during stretch
activation of insect flight muscle. Proc. Natl. Acad. Sci. USA 108, 120-125.
Porter, N. C., Resneck, W. G., O’Neill, A., Van Rossum, D. B., Stone, M. R. and
Bloch, R. J. (2005). Association of small ankyrin 1 with the sarcoplasmic reticulum.
Mol. Membr. Biol. 22, 421-432.
Pringle, J. W. (1978). The Croonian Lecture, 1977. Stretch activation of muscle:
function and mechanism. Proc. R. Soc. Lond. B Biol. Sci. 201, 107-130.
Qadota, H., McGaha, L. A., Mercer, K. B., Stark, T. J., Ferrara, T. M. and Benian,
G. M. (2008). A novel protein phosphatase is a binding partner for the protein kinase
domains of UNC-89 (Obscurin) in Caenorhabditis elegans. Mol. Biol. Cell 19, 24242432.
Qiu, F., Brendel, S., Cunha, P. M., Astola, N., Song, B., Furlong, E. E., Leonard,
K. R. and Bullard, B. (2005). Myofilin, a protein in the thick filaments of insect
muscle. J. Cell Sci. 118, 1527-1536.
Raeker, M. O., Su, F., Geisler, S. B., Borisov, A. B., Kontrogianni-Konstantopoulos,
A., Lyons, S. E. and Russell, M. W. (2006). Obscurin is required for the lateral
alignment of striated myofibrils in zebrafish. Dev. Dyn. 235, 2018-2029.
Raeker, M. O., Bieniek, A. N., Ryan, A. S., Tsai, H. J., Zahn, K. M. and Russell,
M. W. (2010). Targeted deletion of the zebrafish obscurin A RhoGEF domain affects
heart, skeletal muscle and brain development. Dev. Biol. 337, 432-443.
Ranganayakulu, G., Schulz, R. A. and Olson, E. N. (1996). Wingless signaling
induces nautilus expression in the ventral mesoderm of the Drosophila embryo. Dev.
Biol. 176, 143-148.
Razzaq, A., Robinson, I. M., McMahon, H. T., Skepper, J. N., Su, Y., Zelhof, A. C.,
Jackson, A. P., Gay, N. J. and O’Kane, C. J. (2001). Amphiphysin is necessary for
organization of the excitation-contraction coupling machinery of muscles, but not for
synaptic vesicle endocytosis in Drosophila. Genes Dev. 15, 2967-2979.
Reedy, M. C. and Beall, C. (1993). Ultrastructure of developing flight muscle in
Drosophila. II. Formation of the myotendon junction. Dev. Biol. 160, 466-479.
Reedy, M. C., Beall, C. and Fyrberg, E. (1989). Formation of reverse rigor chevrons by
myosin heads. Nature 339, 481-483.
Reedy, M. C., Bullard, B. and Vigoreaux, J. O. (2000). Flightin is essential for thick
filament assembly and sarcomere stability in Drosophila flight muscles. J. Cell Biol.
151, 1483-1500.
Reedy, M. K. and Reedy, M. C. (1985). Rigor crossbridge structure in tilted single
filament layers and flared-X formations from insect flight muscle. J. Mol. Biol. 185,
145-176.
Reedy, M. K., Leonard, K. R., Freeman, R. and Arad, T. (1981). Thick myofilament
mass determination by electron scattering measurements with the scanning
transmission electron microscope. J. Muscle Res. Cell Motil. 2, 45-64.
Russell, M. W., Raeker, M. O., Korytkowski, K. A. and Sonneman, K. J. (2002).
Identification, tissue expression and chromosomal localization of human ObscurinMLCK, a member of the titin and Dbl families of myosin light chain kinases. Gene
282, 237-246.
Schnorrer, F., Schönbauer, C., Langer, C. C., Dietzl, G., Novatchkova, M.,
Schernhuber, K., Fellner, M., Azaryan, A., Radolf, M., Stark, A. et al. (2010).
Systematic genetic analysis of muscle morphogenesis and function in Drosophila.
Nature 464, 287-291.
Shafiq, S. (1964). An electron microscopical study of the innervation and sarcoplasmic
reticulum of the fibrillar flight muscle of Drosophila melanogaster. J. Cell Sci. 105,
1-6.
Small, T. M., Gernert, K. M., Flaherty, D. B., Mercer, K. B., Borodovsky, M. and
Benian, G. M. (2004). Three new isoforms of Caenorhabditis elegans UNC-89
containing MLCK-like protein kinase domains. J. Mol. Biol. 342, 91-108.
Tatsumi, R. and Hattori, A. (1995). Detection of giant myofibrillar proteins connectin
and nebulin by electrophoresis in 2% polyacrylamide slab gels strengthened with
agarose. Anal. Biochem. 224, 28-31.
Tregear, R. T., Edwards, R. J., Irving, T. C., Poole, K. J., Reedy, M. C., Schmitz, H.,
Towns-Andrews, E. and Reedy, M. K. (1998). X-ray diffraction indicates that active
cross-bridges bind to actin target zones in insect flight muscle. Biophys. J. 74, 14391451.
Vincent, A., Briggs, L., Chatwin, G. F., Emery, E., Tomlins, R., Oswald, M.,
Middleton, C. A., Evans, G. J., Sweeney, S. T. and Elliott, C. J. (2012). Parkininduced defects in neurophysiology and locomotion are generated by metabolic
dysfunction and not oxidative stress. Hum. Mol. Genet. 21, 1760-1769.
Vinós, J., Maroto, M., Garesse, R., Marco, R. and Cervera, M. (1992). Drosophila
melanogaster paramyosin: developmental pattern, mapping and properties deduced
from its complete coding sequence. Mol. Gen. Genet.231, 385-394.
Wu, S., Liu, J., Reedy, M. C., Tregear, R. T., Winkler, H., Franzini-Armstrong, C.,
Sasaki, H., Lucaveche, C., Goldman, Y. E., Reedy, M. K. et al. (2010). Electron
tomography of cryofixed, isometrically contracting insect flight muscle reveals novel
actin-myosin interactions. PLoS ONE 5, e12643.
Young, P., Ehler, E. and Gautel, M. (2001). Obscurin, a giant sarcomeric Rho guanine
nucleotide exchange factor protein involved in sarcomere assembly. J. Cell Biol. 154,
123-136.
A
475 kDa
1
2
_
_A
_
B
_C
_D
6
0
y
da
y
da
Pupa Pupa Pupa
t
ul
ad
pa
pu
t
ul
ad
e
at
ar
Ph
B
475 kDa
3
Larva Larva
Adult
Larva thorax
_
_A
_
B
_C
_D
_E
Myosin
pe
pe
-ty
ild
w
4; IR
AL 9G 8
2- nc
ef -u
M S
A
U
4; -IR
AL 9
G c8
3- n
H -u
U AS
U
-ty
ild
p
-ty
w
4; IR
AL 9G 8
2- nc
ef -u
M S
A
U
4; -IR
AL 9
G c8
3- n
H -u
U AS
U
e
ild
w
Supplementary Fig.S1
Fig. S1. Obscurin isoforms in wild-type and obscurin knockdown flies. (A) Western blot of the pupa just before
eclosion (lane 1), just after after eclosion (lane 2) and the thorax of 6 day old flies (lane 3). The larger IFM isoform is the
major isoform in the pupa and young adult. The smaller IFM isoform C is present in the 6 day old flies. (B) Western blot
of wild-type and obscurin knockdown larva and pupa. Larvae were third instar and pupae were 66h APF (at 25°C). The
wild-type larva had a single isoform E; the pupa had the larger IFM isoform A and two non-IFM isoforms B and D. The
larva of UH3-GAL4; UAS-unc89-IR flies had a single isoform similar to the wild-type larva (isoform E); the pupa had
non-IFM isoforms B and D, a trace of the larger IFM isoform A and some larval isoform E. The larva and pupa of Mef2GAL4; UAS-unc89-IR flies had no detectable obscurin. Anti-myosin was used as a loading control.
A
Larva
M
Obscurin
Kettin
Z
Merge
Kettin
Z
Merge
wild-type
Mef2-GAL4;
UAS-unc89-IR
B
TDT
Obscurin
M
wild-type
Mef2-GAL4;
UAS-unc89-IR
Larval crawling
Average speed (mm/s)
*
0.6
200
Peak beam deflection (mm)
C
Fly Jumping
150
0.4
100
0.2
0
50
0
4; -IR
AL 9
G c8
3- n
H -u
U S
A
U
4
AL
G
3H
U
4; IR
AL 9G 8
2- nc
ef -u
M AS
U
4
AL
G
2-
ef
M
4; -IR
AL 9
G c8
3- n
H -u
U AS
U
4
AL
G
3H
U
4; IR
AL 9G 8
2- nc
ef -u
M S
A
U
4
AL
G
2-
ef
M
Fig. S2. Obscurin in the non-flight muscles. Larval muscles and the TDT were labelled with anti-obscurin (green) and
anti-kettin (red) to mark the Z-disc. (A) Obscurin is in the M-line of wild-type larval muscle and (B) the M-line of TDT.
Obscurin was not detected in the muscles of the Mef2-GAL4; UAS-unc89-IR flies. Kettin labelling in the Z-disc of the
knockdown flies is the same as in the wild-type. Scale bars, 5 mm. (C) The effect of down-regulating obscurin on larval
crawling and fly jumping. The speed of crawling compared to that of control larvae with the driver alone was significantly
different for Mef2-GAL4; UAS-unc89-IR larvae (p=0.002), but not for UH3-GAL4; UAS-unc89-IR larvae (p=0.33). The
effect of down-regulating obscurin on fly jumping: beam deflection is a measure of the ability of the flies to jump (Elliott
et al., 2007). There was no significant difference in the jumping ability of the RNAi lines with either UH3-GAL4 or Mef2GAL4 drivers, compared with control flies (p=0.26 and 0.29). Values are average and SE for 15-17 larvae and 14-15 flies.
Supplementary Fig S2
A
wild-type
unc89[EY15484]
UH3-GAL4;
UAS-unc89-IR
Mef2-GAL4;
UAS-unc89-IR
B
wild-type
unc89[EY15484]
UH3-GAL4;
UAS-unc89-IR
Mef2-GAL4;
UAS-unc89-IR
Fig. S3. Effect of reduced obscurin expression on other IFM proteins. (A) Myofibrils were labelled with anti-zormin
(green),
anti-α-actinin
(magenta),
and phalloidin (red). Zormin is in the Z-disc and M-line of the wild-type, in the Z-disc
Supplementary
figure
S3
and the core of the myofibril at the M-line in the unc89[EY15484] flies, and displaced from the Z-disc and M-line
(arrowhead) in UH3-GAL4; UAS-unc89-IR and Mef2-GAL4; UAS-unc89-IR flies. Occasionally Z-discs appear abnormal
in the Mef2-GAL4; UAS-unc89 IFM (arrow). (B) Myofibrils were labelled with anti-tropomodulin (green), anti-kettin
(magenta), and phalloidin (red); kettin is an isoform of Sls. Tropomodulin is in the H-zone in the wild-type, and in the
core of the myofibril at the H-zone in the knockdown flies (arrowheads). There is some non-specific labelling by antitropomodulin at the Z-disc in the knockdown IFMs. The merged image shows that actin bypasses tropomodulin at the
periphery of the myofibril in knockdown flies; Z-discs are unaffected. Scale bars, 5 mm.
Wild-type
unc89[EY15484]
UH3-GAL4; UAS-unc89-IR
Mef2-GAL4; UAS-unc89-IR
Fig. S4. Overview of the effect of reduced obscurin on the IFM. Wild-type myofibrils have well-ordered H-zones.
unc89[EY15484] myofibrils have variably wavy H-zones; in UH3-GAL4; UAS-unc89-IR and Mef2-GAL4; UAS-unc89-IR
myofibrils, bare zones of thick filaments are shifted from the centre of the sarcomere and there are no regular H-zones;
The
Z-discs in the knockdown
IFMs appear nearly normal. Scale bar 2 mm.
Supplementary
Fig. S4
Table S1. Domains encoded by exons in the Drosophila obscurin gene.
Exon number
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Encoded domain
SH3
SH3, RhoGEF
RhoGEF
RhoGEF
RhoGEF, NM
Ig1
Ig1
Ig1
Ig2
Ig2
Ig3, Ig4
Ig5,Ig6, Ig7
Ig8
Ig8
spliced out
Ig9
Ig9
Ig10
Exon number
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
Encoded domain
Ig10, Ig11
Ig12
Ig12, Ig13
Ig13
Ig14
Ig14, Ig15, Ig16, Ig17
Ig18
Fn3(1)
Fn3(1)
NM
Ig19
Ig19, Ig20
Ig20, kinase1 (core)
kinase1 (core and RD)
kinase1 (RD)
Ig21, Fn3(2), kinase2 (core)
kinase2 (RD)
kinase2 (RD)
Exons shown in Fig. 1A are numbered and the domains predicted by SMART are listed.
The RhoGEF module is composed of DH-PH domains. The kinase domains consist of a
core catalytic sequence with a regulatory sequence (RD) at the C-terminus. Catalytic and
regulatory sequences of obscurin were assigned by comparison with the sequence in the
kinase domain at the C-terminus of vertebrate titin. NM, non-modular sequence.
Table S2. Primers used for linking exons in the gene and confirming P-element excision.
Sequence
Primer name
Sequence
Obsc_exon1,2F
GTGGCGGATATCGTGTTTGTG
Obsc_exon16-20F
CGCTCCCACATCGTTTTCCCT
Obsc_exon1,2R
CTTGATGTACTTCTCCACCAC
Obsc_exon16-20R
CACACCGCTATCACCGTCGAT
Obsc_exon2-5F
GTCTCGGTTAGAGACTCACGA
Obsc_exon20-24F
GGATTCTGAGCAATCACCTCGT
Obsc_exon2-5R
TGGAAACTGAGGAGGAGTTCT
Obsc_exon20-24R
AGGGAAAACGATGAGGGAGCG
Obsc_exon5aF
CAGATCCACTTGAGTCTGAAG
Obsc_exon24,25F
CGTAGAACAGCTCAGCATGGC
Obsc_exon5aR
TGGAGTAACCTCCTTGACTTG
Obsc_exon24,25R
ACGAGGTGATTGCTCAGAATC
Obsc_exon5bF
TCGCAGTCTGAGCCTGTCAAA
Obsc_exon25-30F
CTTAATGCGGGATGAGTCGAC
Obsc_exon5bR
GGGCATGCGCGTGAAGTTGGG
Obsc_exon25-30R
TGCCATGCTGAGCTGTTCTAC
Obsc_exon5,6F
CCCAACTTCACGCGCATGCCC
Obsc_exon30-32F
ATGCGTTCCTCGGGACTGTAA
Obsc_exon5,6R
GGTCGTAGTCCCGAGTTTTGG
Obsc_exon30-32R
GTCGACTCATCCCGCATTAAG
Obsc_exon6-10F
CCACTGTGGTGGCGATAGCCT
Obsc_exon32-34F
CCACCACCTTGTAGACTCCAA
Obsc_exon6-10R
GACTACGACCGGGGAACCTC
Obsc_exon32-34R
TTACAGTCCCGAGGAACGCAR
Obsc_exon10-12F
TCTCGGTCTCGTCGTGGTACC
Obsc_exon34-36F
CCAGCTTGTTGACCTTCTTGG
Obsc_exon10-12R
AGGCTATCGCCACCACAGTGG
Obsc_exon34-36R
TTGGAGTCTACAAGGTGGTGG
Obsc_exon12-16F
CCCATCGACGGTGATAGCGGT
EP1fwd
CCGATGTCCAATTTTACTGAG
Obsc_exon12-16R
GGTACCACGACGAGACCGAGA
EP1rev
CGTGTCCGGAAAATACACTA
Primers used in PCR reactions to link predicted exons in the obscurin gene are shown
(Obs_exon). The last two primers were designed to link sites in the first intron from
which the P-element was excised.