Journal
of General Virology (1997), 78, 435–443. Printed in Great Britain
...........................................................................................................................................................................................................................................................................................
Persistence of ribosomal protein synthesis after infection of
HeLa cells by herpes simplex virus type 1
Denis Simonin, Jean-Jacques Diaz, Thierry Masse! and Jean-Jacques Madjar
Immuno-Virologie Mole! culaire et Cellulaire CNRS UMR5537, Faculte! de Me! decine Lyon-RTH Lae$ nnec, Rue Guillaume Paradin,
69372 Lyon CEDEX 08, France
Because synthesis of rRNA persists late during
herpes simplex type 1 infection and because S6
phosphorylation is always correlated with efficient
translation of ribosomal protein mRNA, we tested
the hypothesis that ribosomal protein synthesis and
ribosome biogenesis could persist after infection.
At different times after infection, proteins were
labelled with 35S for 1 h before harvesting and
ribosomes were purified. Measurement of radioactivity incorporated into individual ribosomal
proteins separated by two-dimensional PAGE
demonstrated that ribosomal proteins are still
synthesized and assembled into mature ribosomes
up to late times during infection, while synthesis of
Introduction
The initial shutoff of host protein synthesis occurs very
early after herpes simplex virus type 1 (HSV-1) infection and
does not require de novo protein synthesis. This inhibition of
cellular protein synthesis involves at least one structural
component of the virion, the virion host shutoff (VHS) protein.
The VHS protein brought into the cell by the infecting virion
is responsible, at least in part, for the destabilization of
polyribosomes containing cellular or α, β and γ viral mRNAs
(Roizman & Sears, 1990, 1993). The gene encoding the VHS
protein has been mapped and the UL41 protein has been
identified as the most probable vhs gene product (Kwong &
Frenkel, 1989). Even though UL41 protein participates actively
in the HSV-1-induced cellular shutoff of host protein synthesis,
probably by inducing degradation of host mRNA, it remains
possible that other mechanisms are required to achieve an
effective inhibition of host protein synthesis and a selective
translation of viral mRNA. Indeed, the HSV-1-induced disAuthor for correspondence : Jean-Jacques Madjar.
Fax ­33 4 78 77 87 18. e-mail madjar!cimacpcu.univ-lyon1.fr
β-actin is severely inhibited. During expression of
late genes, ribosome biogenesis was estimated to
be 58 % of that of the control as judged by
[3H]uridine incorporation into rRNA. As for β-actin
mRNA, the level of ribosomal protein mRNA decreased progressively from the beginning of infection, reaching about 30 % of the control level
during expression of late genes. Taken together,
these results demonstrate that ribosomal proteins
are still synthesized up to the late time of infection
and efficiently assembled into mature ribosomes,
while there is a severe shutoff of the synthesis of
other cellular proteins.
sociation of polyribosomes (Sydiskis & Roizman, 1966, 1967)
cannot be explained by VHS protein-induced degradation of
mRNA alone, suggesting that other mechanisms are also
involved in inhibiting cellular protein synthesis (Garcin et al.,
1990 ; Nishioka & Silverstein, 1978 ; Schek & Bachenheimer,
1985 ; Silverstein & Engelhardt, 1979). Because HSV-1 infection induces important post-translational modifications of
ribosomal proteins, occurring sequentially together with the
expression of the different classes of viral genes, it has been
suggested that ribosomes might be involved in the regulation
of viral and cellular gene expression (Diaz et al., 1993 ; Masse!
et al., 1990 b). Phosphorylation of S6 ribosomal protein is
induced during the adsorption step of HSV-1 infection
(Fenwick & Walker, 1979 ; Kennedy et al., 1981 ; Masse! et al.,
1990 a, b). In addition, two other phosphorylated proteins are
associated with subcellular fractions containing ribosomes
(Masse! et al., 1990 b). One of them has been identified as the
product of the HSV-1 US11 true late gene. The US11 product,
an RNA-binding basic phosphoprotein that is capable of
oligomerization and accumulates in nucleoli of infected cells, is
probably involved in post-transcriptional regulation of gene
expression following HSV-1 infection (Diaz et al., 1993, 1996).
0001-4310 # 1997 SGM
EDF
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
D. Simonin and others
Despite the HSV-1-induced shutoff of most host protein
synthesis, a few cellular proteins are still synthesized after
infection (Estridge et al., 1989 ; Everett, 1985 ; Kemp &
Latchman, 1988 a, b ; Latchman et al., 1987 ; Mosca et al., 1992 ;
Notarianni & Preston, 1982 ; Preston, 1990). The sustained
synthesis of some cellular proteins suggests they might play an
important role in virus–cell interactions, in particular in
determining the outcome of infection.
Synthesis of ribosomal proteins is under translational
control during embryogenesis, differentiation and activation of
protein synthesis by mitogens (for a review see Kaspar et al.,
1993). A short stretch of pyrimidines located at the 5« end of
ribosomal protein mRNA is sufficient to confer this translational control (Kaspar et al., 1993 ; Meyuhas et al., 1996).
Activation of S6 phosphorylation is correlated with the
recruitment into polyribosomes of mRNA containing a
polypyrimidine tract (Kaspar et al., 1993 ; Jefferies et al., 1994).
Therefore, S6 phosphorylation appears essential for the
synthesis of ribosomal proteins and of some other factors
involved in translation (Jefferies et al., 1994).
Even though the role of translational initiation factors and
of mRNA structure in the dramatic changes to protein
synthesis induced by some viruses has been somewhat clarified
(for a review see Mathews, 1996), little is known about the
involvement of ribosomes in translational control. Based upon
the assumption that HSV-1-induced stimulation of S6 ribosomal protein phosphorylation should lead to an increase in
ribosomal protein synthesis, and because ribosomal RNA
synthesis still occurs even late after infection when synthesis of
most cellular RNAs is inhibited (Wagner & Roizman, 1969 ;
Besse & Puvion-Dutilleul, 1996), the hypothesis that ribosome
biogenesis could persist after HSV-1 infection was proposed.
Here we show that ribosomal protein synthesis persists up to
late times of infection while β-actin synthesis is strongly
inhibited. This is not due to a selective degradation of some
mRNAs because ribosomal protein mRNAs appear to be
degraded at a rate similar to that of β-actin mRNA. In addition,
these newly synthesized ribosomal proteins are assembled into
ribosomes, although their relative rate of incorporation into
new ribosomes appears somewhat modified.
Methods
+ Virus and cells. The HSV-1 macroplaque (MP) strain was obtained
from B. Jacquemont (Laboratoire de Neuro-Virologie Mole! culaire, Lyon,
France) and was a gift from B. Roizman (Marjorie B. Kovler Oncology
Laboratories, Chicago, Ill., USA). HeLa cells were grown as monolayers
in Eagle’s minimum essential medium (MEM) supplemented with 10 %
heat-inactivated newborn calf serum (NBCS).
+ Infection of cells and 35S-labelling. HeLa cells were infected at
pre-confluency at an m.o.i. of 50 p.f.u. per cell in medium 199 (ICN Flow
Laboratories) supplemented with 1 % inactivated NBCS, and incubated
for 1 h at 33 °C. The inoculum was replaced by medium 199 containing
1 % inactivated NBCS and the cells were incubated at 37 °C for different
periods of time as indicated in the figure legends. For $&S-labelling, the
medium was removed 1 h before harvesting and replaced by methionine-
EDG
and cysteine-free MEM (ICN Flow Laboratories) supplemented with a
mixture of -[$&S]methionine and -[$&S]cysteine at a final concentration
of 1±85¬10' Bq}ml (50 µCi}ml) and 0±925¬10' Bq}ml (25 µCi}ml)
respectively (PRO-MIX cell labelling mix, Amersham). The labelling medium was also supplemented with 1 % inactivated and dialysed NBCS.
+ Rate of protein synthesis. HeLa cells (3¬10&) in 35 mm diameter
Petri dishes were infected with HSV-1 for 2, 4, 6 and 8 h and $&S-labelled
for 1 h before harvesting. Uninfected cells were labelled under the same
conditions. After the labelling period, cells were washed three times with
ice-cold PBS (130 mM NaCl, 4 mM Na HPO .2H O, 1±5 mM KH PO ),
#
% #
# %
and the cell content was solubilized with 25 mM Na CO , 50 mM
# $
NaOH. Three aliquots of each sample containing an identical amount of
protein (Bradford, 1976), were loaded onto 3MM Whatman paper and
dried. For determination of the radioactivity incorporated into trichloroacetic acid (TCA)-precipitable material, the three aliquots were
incubated in 10 % ice-cold TCA for 10 min, then in 5 % boiling TCA for
5 min and rinsed three times with 5 % TCA. Radioactivity was then
measured using a liquid scintillation counter (Minaxiβ Tri-Carb, Packard).
+ Preparation of ribosomal proteins and electrophoresis
procedures. $&S-labelled ribosomal proteins were purified from cytoplasmic ribosomes of uninfected and infected HeLa cells as previously
described (Madjar, 1994 ; Masse! et al., 1990 a). They were separated by
two-dimensional (2D)-PAGE as described in detail elsewhere (Madjar et
al., 1979 a). In brief, the first dimension separation was carried out in a 4 %
(w}v) polyacrylamide gel containing 8 M urea at pH 8±6. The second
dimension separation was performed in a 12±5 % polyacrylamide gel
containing 6 M urea at pH 6±75 in the presence of SDS. Gels were stained
with Coomassie brillant blue (R250), dried under vacuum and submitted
to autoradiography for 12 h with Hyperfilm-βmax (Amersham).
+ Quantification of rRNA synthesis. HeLa cells (3¬10') were
infected for 4 h with HSV-1. One hour before harvesting, cells were
incubated in medium 199 supplemented with 1 % inactivated NBCS and
with [5,6-$H]uridine (Amersham) at a final concentration of 0±6 TBq}ml
(15 µCi}ml). Uninfected cells were labelled under the same conditions. At
the end of the labelling period, cells were washed with ice-cold PBS
containing 10−% M uridine and a post-mitochondrial supernatant was
prepared as previously described (Madjar, 1994 ; Masse! et al., 1990 a).
This supernatant was treated first for 15 min at 0 °C followed by 10 min
at 37 °C with puromycin at a final concentration of 10−% M and then
adjusted to 100 mM CaCl before treatment with 100 units}ml micro#
coccal nuclease (Boerhinger) for 15 min at 20 °C. Ribosomes were
purified by centrifugation through a 1 M sucrose cushion containing
0±5 M KCl and quantified. An amount of ribosomes corresponding to one
A unit was mixed with 5 ml of an emulsifier containing scintillator and
#'!
the amount of radioactivity was measured as above.
+ Immunoprecipitation procedure. Immunoprecipitations of proteins were performed as previously described (Simonin et al., 1995 b).
Briefly, HeLa cells infected for 4 h with HSV-1 and uninfected were
labelled with $&S, lysed in buffer (0±1 % SDS, 1 % Triton X-100, 1 % sodium
deoxycholate, 150 mM NaCl, 10 mM Tris–HCl pH 7±4, 1 mM EDTA)
and incubated for 16 h at 4 °C with either a polyclonal anti-US11
antibody (Diaz et al., 1993) or a monoclonal anti-β-actin antibody (Clone
AC-15, Sigma) at a 100-fold dilution. Antigen–antibody complexes were
collected with protein A coupled to Sepharose CL-4B beads (Pharmacia).
Immunoprecipitated proteins were then analysed by SDS–PAGE
(Laemmli, 1970). Gels were dried and submitted to autoradiography for
19 h.
+ Analysis of mRNA levels following infection. At different times
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
Ribosomal protein synthesis after HSV-1 infection
post-infection, total cytoplasmic RNA was purified following the SDS–
proteinase K method (Ausubel et al., 1987). Total cytoplasmic RNA was
also purified from uninfected cells by the same method. RNA was
separated by electrophoresis through a 1±2 % agarose gel in the presence
of 0±22 M formaldehyde (Tsang et al., 1993) and blotted onto positively
charged nylon membranes (Appligene). Hybridization was performed at
65 °C with different cDNAs previously labelled with $#P by random
priming following standard protocols. The $#P-labelled probe used to
detect hsp70 mRNA was obtained by labelling the 900 bp EcoRI-SaII
fragment of plasmid pST19}BB5 (Hunt & Morimoto, 1985) ; the probe
used to detect cytoplasmic β-actin mRNA was obtained by labelling the
1100 bp PstI-PstI fragment of plasmid pAL41-β (Hanahan, 1983). For the
detection of S14 and S17 mRNA, the 546 bp and 400 bp PstI-PstI
fragments of pCS14–12 (Rhoads et al., 1986) and pCS17–6 (Chen &
Roufa, 1988), respectively, were labelled with $#P. The cDNA used to
detect human L24 mRNA was obtained after reverse transcription of 1 µg
total RNA purified from HeLa cells followed by PCR amplification. The
cDNA was first heated for 3 min at 94 °C before addition of 0±2 units
BioTaq (Bioprobe) in 50 µl 20 mM Tris–HCl pH 8±0, 2 mM MgCl ,
#
100 µg}ml BSA and 2 µM of each oligonucleotide, 5« GGAATTCCGTGGAGCTGTCGCCATGA 3« and 5« GGAATTCCAACTCGGGGAGCTGAAAC 3«. Oligonucleotides were designed to amplify the entire
L24 coding sequence (Johnson, 1993). Amplification was performed
using 35 cycles (20 s at 92 °C, 30 s at 55 °C and 1 min at 72 °C). The
amplified DNA fragment was cloned into pBluescript (Stratagene) and
labelled with $#P as above for the other cDNAs. After autoradiography
of the blots for 16 h, fragments of membrane containing different
hybridized mRNAs were cut out from the filters and the radioactivity was
measured by scintillation counting.
Results
Protein synthesis in HeLa cells after infection with
HSV-1
To determine the rate of protein synthesis in HeLa cells
after HSV-1 infection, cells were infected at an m.o.i. of
50 p.f.u. per cell for 2, 4, 6 and 8 h, and labelled for 1 h with a
mixture of [$&S]methionine and [$&S]cysteine just before
harvesting. Radioactivity incorporated into proteins was
determined during the course of infection by measuring hotTCA-precipitable material. At 2 h post-infection, the rate of
protein synthesis decreased to 37 % of that in uninfected cells
(Table 1). This rate increased slightly, to 40±5 % at 4 h post-
Coomassie
blue staining
Autoradiogram
(a)
(b)
(c)
Fig. 1. Ribosomal protein synthesis in uninfected cells (a) and in cells
infected with HSV-1 for 4 h (b) and 8 h (c). Ribosomal proteins were
labelled with a mixture of [35S]methionine and [35S]cysteine for 1 h before
harvesting. After purification of the ribosomes, proteins were extracted and
separated by 2D-PAGE. Left panel, Coomassie brilliant blue staining ; right
panel, autoradiograms after 12 h exposure. Positions of unphosphorylated
S6 (a) and of the fully phosphorylated form (b, c) are shown. S2a and
L30a are phosphorylated derivatives of S2 and L30. Positions of L10 and
L24, the synthesis of which persists up to late times during infection, are
indicated on both panels. Positions of US11 protein and of non-ribosomal
protein V3, as well as that of a few other non ribosomal-proteins (NRP)
are indicated on the right panel.
infection, reached a maximum at 6 h post-infection (60±3 %)
and finally declined to 37 % of that in uninfected cells at 8 h
post-infection. Therefore, under these experimental conditions
Table 1. Protein synthesis in HeLa cells after infection with HSV-1
Cells were infected as described in Methods and the amount of radioactivity incorporated into hot-TCAprecipitable material was measured at 2, 4, 6 and 8 h after infection.
Infected cells
10$¬Radioactivity incorporated (c.p.m.}µg protein)*
Rate of protein synthesis (% of control)
Uninfected
cells
2h
4h
6h
8h
116³5
100
43³6
37
47³2
40±5
70³5
60±3
43³2
37±0
* Data are means from three aliquots of each sample.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
EDH
D. Simonin and others
Table 2. Synthesis of individual 40S ribosomal subunit proteins in HeLa cells 4 h after
infection with HSV-1
Incorporated radioactivity (c.p.m.)
Analysis 1
Analysis 2
Analysis 1
Analysis 2
Percentage of
ribosomal protein
synthesis remaining
4 h after infection
7 767
7 656
4 623
3 132
1 850
8 048
1 281
1 947
4 949
11 390
4 853
2 778
1 879
1 021

7 021
8 446
5 365
2 413
1 665
8 434
3 580
2 024
5 313
10 488
5 425
3 421
2 690
1 113
2 118
7 099
5 089
2 019
1 640
1 018
4 597
2 028
1 399
4 779
7 609
2 890
2 092
2 112
845
1 339
6 394
5 327
1 746
1 453
1 068
4 522
1 895
1 314
4 202
8 010
2 697
2 454
2 904
635
1 421
91
65
38
56
59
55
81
68
88
71
54
73
110
69
65
Uninfected cells
Ribosomal
protein
S2
S4
S6
S8
S9
S11
S13
S14
S17
S19
S20
S26
S27
S28
S30
Infected cells
, Not determined.
of infection, the MP strain of HSV-1 efficiently induced
inhibition of HeLa cell protein synthesis.
Synthesis of ribosomal proteins and ribosomal RNA
during infection by HSV-1
To determine whether ribosomal proteins were still
synthesized and assembled into ribosomes after HSV-1
infection, HeLa cells were infected and proteins were labelled
for 1 h before harvesting. $&S-labelled ribosomal proteins were
purified from total cytoplasmic ribosomes of cells infected for
4 and 8 h and from uninfected cells. Equal amounts of total
ribosomal proteins were separated by 2D-PAGE (Fig. 1). In
these 2D gels, the position of each individual spot, as well as
the radioactivity incorporated into ribosomal proteins, was
extremely reproducible (Madjar, 1994 ; Madjar et al., 1979 a, b ;
Madjar & Traut, 1980). After Coomassie blue staining, patterns
of ribosomal proteins purified from uninfected (Fig. 1 a) and
from infected cells (Fig. 1 b, c) were very similar. As expected,
based upon mobility of the spots, S6 was fully phosphorylated
in cells infected for 4 and 8 h (Fenwick & Walker, 1979 ;
Kennedy et al., 1981 ; Masse! et al., 1990 b) and a significant
proportion of L30 became phosphorylated in cells infected for
8 h (Simonin et al., 1995 a).
Under the experimental conditions defined above, 1 h
incubation of cells with a mixture of [$&S]methionine and
[$&S]cysteine was sufficient to obtain a significant incorporation
of these radioactive amino acids into each ribosomal protein
EDI
assembled into ribosomes of uninfected cells (Fig. 1 a, right
panel). However, the radioactivity incorporated into individual
ribosomal proteins differed. These differences in labelling
reflect both the methionine and cysteine contents of the
different ribosomal proteins and the order of assembling of
ribosomal proteins into ribosomes because the labelling was
carried out for 1 h immediately before harvesting (see
Discussion). At 4 h post-infection the labelling of ribosomal
proteins (Fig. 1 b, right panel) was very similar to that of
uninfected cells (Fig. 1 a, right panel). In addition, as expected
at 4 h post-infection with an m.o.i. of 50 p.f.u. per cell, the
HSV-1 US11 protein (Diaz et al., 1993 ; Masse! et al., 1990 b ;
Roller & Roizman, 1992) and the non-ribosomal protein V3
(Masse! et al., 1990 b) appear among the ribosomal proteins. At
8 h post-infection, only two ribosomal proteins, L10 and L24,
were labelled, whereas a few non-ribosomal proteins (labelled
NRP in Fig. 1 c), US11 protein and V3 are strongly labelled
(Fig. 1 c).
To compare precisely ribosomal protein labelling of cells
infected for 4 h versus that of uninfected cells (autoradiograms
of Fig. 1 a, b), the radioactivity incorporated into individual
ribosomal proteins was measured (Tables 2 and 3). These
measurements were performed only for proteins fully resolved
by 2D-PAGE. The radioactivity incorporated into 15 out of
the 33 proteins of the 40S subunits and into 31 out of the 45
proteins of the 60S subunits (Wool et al., 1996) was measured
by scintillation counting. The ratio between the radioactivity
incorporated into ribosomal proteins of infected cells versus
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
Ribosomal protein synthesis after HSV-1 infection
Table 3. Synthesis of individual 60S ribosomal subunit proteins in HeLa cells 4 h after
infection
Incorporated radioactivity (c.p.m.)
Analysis 1
Analysis 2
Analysis 1
Analysis 2
Percentage of
ribosomal protein
synthesis remaining
4 h after infection
1 076
2 108
1 679
827
381
2 412
4 141
3 386
48 677
904
734
844
1 529
1 279
1 524
1 054
965
671
23 032
887
918
1 794
6 160
1 379
849
1 619
920
2 521
3 766
203
1 846
1 023
2 157
1 752
928
275
2 477
4 225
3 485
54 984
687
1 182
1 088
1 571
1 410
1 674
1 474
717
457
25 238
888
1 522
2 078
7 608
2 155
754
1 027
729
2 717
5 210
175
2 045
994
2 787
999
391
143
1 326
1 886
2 763
49 221
763
775
666
1 083
1 180
1 268
837
853
435
17 403
726
1 175
1 108
4 037
875
926
936
912
2 017
3 540
132
2 044
955
2 239
1 160
432
184
1 179
2 091
2 748
51 917
933
939
780
1 073
1 167
1 422
926
1 008
542
21 067
821
1 369
1 048
4 943
1 068
929
906
929
2 119
4 512
108
2 234
93
118
63
47
50
51
48
80
98
107
89
75
70
87
84
70
111
87
80
87
104
56
65
55
116
70
112
79
90
63
110
Uninfected cells
Ribosomal
protein
L3
L4
L5
L6
L7
L7a
L8
L9
L10
L11
L12
L13
L13a
L14
L18
L19
L22
L23
L24
L26
L27
L27a
L28
L29
L30
L31
L35
L36a
L37a
L38
L39
Infected cells
that of uninfected cells was calculated. This ratio, expressed as
a percentage, reflects the remaining rate of synthesis and
assembly of ribosomal proteins occurring between 3 and 4 h
post-infection. Under these conditions, the rate of incorporation of amino acids into ribosomal proteins being
assembled into the 40S subunits ranged from 110 % for S27 to
38 % for S6 ; for the 60S subunits, it varied from 118 % for L4
to 47 % for L6. Some proteins of the 60S subunits, L4, L10, L11,
L22, L27, L30, L35 and L39, were labelled to about the same
extent whether HeLa cells were infected or not. In addition,
these data also reveal that the radioactivity incorporated into
S19, L10 and L24 is much higher than that incorporated into
the other ribosomal proteins, both in control and infected cells.
All three proteins are known to be assembled, and eventually
exchanged, into ribosomes in the cytoplasm and not in the
nucleolus (Lastick & McConkey, 1976) which may account for
their higher level of labelling.The amount of radioactivity
correlated very well with the intensity of the different spots as
estimated by visual inspection of the autoradiograms. Altogether, these data show that ribosomal proteins are still
synthesized and assembled into ribosomes after 4 h of
infection. In addition, synthesis and assembly of L10 and L24
occurs until 8 h post-infection. These data also indicated that
the overall process of synthesis and}or assembling of different
ribosomal proteins is not identical upon infection. To evaluate
by a different method the remaining level of ribosome
biogenesis after 4 h of infection, [$H]uridine incorporation into
total rRNA was measured. Uninfected and infected cells were
labelled for 1 h before harvesting. The radioactivity was
measured in an amount of ribosomes corresponding to one
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
EDJ
D. Simonin and others
Uninfected
Infected
(a)
Uninfected Infected
(b)
100
S14
50
94 000
0
67 000
100
S17
β-actin
50
43 000
0
100
30 000
L24
50
0
Us11
20 100
1
2
3
4
5
6
7
β-actin
50
0
140
100
8
Fig. 2. Immunoprecipitation of β-actin and of US11 protein in cells infected
for 4 h and uninfected cells. After 1 h labelling, β-actin and US11 protein
were immunoprecipitated from total cell lysates, with mouse anti-β-actin
monoclonal antibody (lanes 1 and 3) and rabbit anti-US11 protein
polyclonal antibody (lanes 5 and 7), respectively. As controls, cell lysates
were treated with mouse ascites fluid (lanes 2 and 4) and with rabbit preimmune serum (lanes 6 and 8). No detectable labelled β-actin or US11
protein was immunoprecipitated after a second round of
immunoprecipitation. Positions of proteins of known molecular mass are
indicated on the right in Da.
A unit. The percentage of radioactivity incorporated into
#'!
rRNA of infected cells was about 58 % of that incorporated
into rRNA of uninfected cells (1786³217 vs 1030³79 c.p.m.,
means of three independent determinations). From these data,
it can be concluded that ribosomal protein synthesis and
ribosome biogenesis persist up to late times of HSV-1 infection.
Synthesis of β-actin in cells infected with HSV-1
To evaluate the efficiency of the shutoff of host protein
synthesis, the rate of β-actin synthesis was estimated after
immunoprecipitation of the $&S-labelled protein. After separation of the proteins by SDS–PAGE and subsequent
autoradiography (Fig. 2), intensities of the bands corresponding to β-actin were quantified by optical densitometry. The
amount of radiolabelled β-actin was only 4 % of that found in
uninfected cells. As a control, $&S-labelled US11 protein from
the same infected cells was immunoprecipitated (Fig. 2) using
a polyclonal anti-US11 antibody (Diaz et al., 1993). These
results confirmed the HSV-1-induced shutoff of β-actin synthesis (Inglis, 1982 ; Mayman & Nishioka, 1985 ; Schek &
Bachenheimer, 1985). However, from these data alone we
cannot conclude whether this inhibition of β-actin synthesis
reflects a selective decrease in the level of β-actin mRNA in the
cytoplasm or a decrease in its translational efficiency or both.
EEA
100
hsp70
50
C
0
2
4
6 8
Time (h post-infection)
0
C 0 2 4 6 8
Time (h post-infection)
Fig. 3. Fate of mRNA encoding three ribosomal proteins (S14, S17 and
L24), β-actin and hsp70 during infection. After Northern blot analyses
(panel a), the amount of radioactivity was measured for the different
relevant probes and plotted as the percentage of the controls (C)
measured in uninfected cells (panel b).
Fate of β-actin, hsp70 and ribosomal protein mRNA in
infected cells
To determine whether the shutoff of β-actin synthesis was
due only to a decrease in its mRNA level, the fate of mRNA
coding for β-actin and for three ribosomal proteins was
compared during the course of infection. In addition, because
HSV-1 induces a stimulation of hsp70 synthesis (Estridge et al.,
1989 ; Notarianni & Preston, 1982), the fate of hsp70 mRNA
was also monitored in parallel. Total cytoplasmic RNA was
purified from uninfected cells and from infected cells at 0, 2, 4,
6 and 8 h post-infection and analysed by Northern blotting
(Fig. 3 a). mRNA coding for ribosomal proteins S14, S17 and
L24, β-actin and hsp70 was detected using the corresponding
$#P-labelled cDNA. The amount of radioactive cDNA hybridized to specific mRNA was measured by liquid scintillation
counting. The ratio between the radioactivity obtained at the
different times post-infection and that obtained for uninfected
cells was calculated and plotted (Fig. 3 b). The level of hsp70
mRNA increased after the adsorption step of the virus (0 h
post-infection) and reached a maximum at 2 h post-infection. It
then returned to its basal level at 4 h post-infection and finally
decreased below this value between 6 and 8 h post-infection.
Conversely, levels of β-actin mRNA, as well as that of S14, S17
and L24, declined in parallel, reaching 30 % of that of the
control uninfected cells at 4 h post-infection. These data show
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
Ribosomal protein synthesis after HSV-1 infection
that mRNAs encoding ribosomal proteins S14, S17 and L24
and β-actin undergo the same rate of degradation after HSV-1
infection.
Discussion
In this report, we have analysed the synthesis of ribosomal
proteins in cells infected with HSV-1, to challenge the
hypothesis that their synthesis could persist while the synthesis
of most other host proteins is inhibited. The typical variations
of protein synthesis in response to infection were observed
with, first, a dramatic decrease, followed by a resumption
occurring before the final decline. More specifically, at 4 h
post-infection the residual rate of β-actin synthesis was only
4 % of that in uninfected cells. In addition, at 4 h post-infection,
US11 protein, a true late gene product, had already been
synthesized, indicating that, under these experimental conditions, viral protein synthesis was effective.
Notwithstanding this obvious shutoff of host protein
synthesis, ribosomal protein synthesis and ribosome biogenesis
persist after HSV infection. Even after 4 h of infection, 58 % of
ribosomal RNA is still synthesized and assembled into
ribosomes. However, the radioactivity incorporated into each
individual protein varied from 38 to 118 %. From a theoretical
point of view, after 1 h labelling the amount of [$&S]methionine
and [$&S]cysteine incorporated into each individual protein
should depend upon (i) the methionine and cysteine contents
of the mature proteins, (ii) their rates of synthesis and
subsequent assembling into mature ribosomes, and (iii) their
order of assembly into these ribosomes. The course of labelling
being only a few times longer than the time required for
ribosomes to be fully assembled, the last protein to be
assembled is expected to be the most labelled for a given
number of methionine and cysteine residues. However, even
though the sequences of all ribosomal protein cDNAs are
available, at least for rats (Wool et al., 1996), it is not known
whether the first methionine is present or not at the N-terminal
end. Therefore, from the present data alone, the order of
ribosomal protein assembly cannot be determined.
What can be compared is the level of radioactivity
incorporated into a given protein before and after infection.
Unexpectedly, the variation in radioactivity incorporated
before and after infection is not uniform from one protein to
another. Some proteins (S2, S27, L4, L10, L11, L22, L27, L30,
L35, L39) incorporate almost the same amount of radioactivity
while others (S6, S8, L6, L8, L27a, L29, L38) incorporate half or
less of the amount of radioactivity incorporated by the
controls, the remainder ranging between these two groups. If
technical bias can be excluded, what is the explanation for such
variation in the amount of ribosomal proteins incorporated
into newly assembled ribosomes between 3 and 4 h after
infection? A possible and trivial explanation is that preparations
of ribosomes are contaminated by fragments or parts of
ribosomal particles co-sedimenting with intact ribosomes
during the cell fractionation procedure due to some nuclear
membrane breakdown. This is clearly not the case, since
ribosomal protein patterns are free of histones whose positions
are known in the analytical electrophoretic system used (Fig.
1). A priori, a modification of the order of assembly of
ribosomal proteins after infection can also reasonably be
excluded. However, what can be changed after infection is the
relative rate of synthesis of the different ribosomal proteins,
and also their rate of assembly into mature ribosomes. After
2 h of infection, more than 50 % of the mRNA coding for S14,
S17 and L24 has been degraded and 70 % after 4 h of infection.
In spite of this dramatic decrease in these individual mRNAs,
the corresponding proteins are still synthesized and efficiently
assembled into mature ribosomes. This leads to the conclusion
that the remaining mRNA must be translated very efficiently,
and especially, that the newly synthesized proteins must be
more efficiently assembled into new ribosomes. This would be
possible if the assembly of some ribosomal proteins is
accelerated, perhaps at the price of a less accurate process.
Although such acceleration of ribosome biogenesis still
remains to be proved, two other conclusions can be drawn
from these results. First, there is a translational control leading
to the persistence of ribosomal protein synthesis, thus
involving some selectivity in the cellular mRNAs which are
translated. This translational control probably requires mechanisms different from those allowing translation of viral mRNA
during the shutoff of host cell protein synthesis. A selective
reinitiation of translation might remain possible after HSV-1
infection for ribosomal protein mRNA but not other cellular
mRNAs such as β-actin mRNA. The 5«-terminal polypyrimidine tract of each ribosomal protein mRNA may be
responsible for such a translational control (Meyuhas et al.,
1996). Since ribosome biogenesis persists after infection by
HSV-1, viral protein synthesis could take place, at least in part,
on these newly synthesized and assembled ribosomes. If this
were the case, a specific mechanism should exist for driving
viral mRNAs selectively to these newly made ribosomes.
This work was supported by the Centre National de la Recherche
Scientifique and Universite! Claude Bernard Lyon 1. We thank K.
Kindbeiter and A. Torre for their valuable help with artwork.
References
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G.,
Smith, J. A. & Struhl, K. (1987). Current Protocols in Molecular Biology.
New York : John Wiley.
Besse, S. & Puvion-Dutilleul, F. (1996). Intranuclear retention of
ribosomal RNAs in response to herpes simplex virus type 1 infection.
Journal of Cell Science 109, 119–129.
Bradford, M. M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle of
protein–dye binding. Analytical Biochemistry 72, 248–254.
Chen, I.-T. & Roufa, D. J. (1988). The transcriptionally active human
ribosomal protein S17 gene. Gene 70, 107–116.
Diaz, J.-J., Simonin, D., Masse! , T., Deviller, P., Kindbeiter, K., Denoroy,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
EEB
D. Simonin and others
L. & Madjar, J.-J. (1993). The herpes simplex virus type 1 US11 gene
Latchman, D. S., Estridge, J. K. & Kemp, L. M. (1987). Transcriptional
product is a phosphorylated protein found to be non-specifically
associated with both ribosomal subunits. Journal of General Virology 74,
397–406.
induction of the ubiquitin gene during herpes simplex virus infection is
dependent upon viral immediate-early ICP4. Nucleic Acids Research 15,
7283–7293.
Madjar, J.-J. (1994). Preparation of ribosomes and ribosomal proteins
from cultured cells. In Cell Biology : A Laboratory Handbook, pp. 657–661.
Edited by J. E. Celis. London : Academic Press.
Madjar, J.-J. & Traut, R. R. (1980). Differences in electrophoretic
behaviour of height ribosomal proteins from rat and rabbit tissues and
evidence for proteolytic action on liver proteins. Molecular & General
Genetics 179, 89–101.
Madjar, J.-J., Arpin, M., Buisson, M. & Reboud, J.-P. (1979 a). Spot
position of rat liver ribosomal proteins by four different two-dimensional
electrophoreses in polyacrylamide gel. Molecular & General Genetics 171,
121–134.
Madjar, J.-J., Michel, S., Cozzone, A. J. & Reboud, J.-P. (1979 b). A
method to identify individual proteins in four different two-dimensional
gel electrophoresis systems : application to Escherichia coli ribosomal
proteins. Analytical Biochemistry 92, 174–182.
Masse! , T., Garcin, D., Jacquemont, B. & Madjar, J.-J. (1990 a). Herpes
simplex virus type-1-induced stimulation of ribosomal protein S6
phosphorylation is inhibited in neomycin-treated human epidermoid
carcinoma 2 cells and in ras-transformed cells. European Journal of
Biochemistry 194, 287–291.
Masse! , T., Garcin, D., Jacquemont, B. & Madjar, J.-J. (1990 b).
Ribosome and protein synthesis modifications after infection of human
epidermoid carcinoma cells with herpes simplex virus type 1. Molecular
& General Genetics 220, 1–12.
Mathews, M. B. (1996). Interactions between viruses and the cellular
machinery for protein synthesis. In Translational Control, pp. 505–548.
Edited by J. Hershey, M. Mathews & N. Sonenberg. Cold Spring Harbor,
NY : Cold Spring Harbor Laboratory.
Mayman, B. A. & Nishioka, Y. (1985). Differential stability of host
mRNA in Friend erythroleukemia cells infected with herpes simplex virus
type 1. Journal of Virology 53, 1–6.
Meyuhas, O., AA vni, D. & Shama, S. (1996). Translational control of
ribosomal protein mRNAs in eukaryotes. In Translational Control, pp.
363–389. Edited by J. Hershey, M. Mathews & N. Sonenberg. Cold
Spring Harbor, NY : Cold Spring Harbor Laboratory.
Mosca, J. D., Pitha, P. M. & Hayward, G. S. (1992). Herpes simplex
virus infection selectively stimulates accumulation of beta interferon
reporter gene mRNA by a posttranscriptional mechanism. Journal of
Virology 66, 3811–3822.
Nishioka, Y. & Silverstein, S. (1978). Requirement of protein synthesis
for the degradation of host mRNA in Friend erytholeukemia cells infected
with herpes simplex virus type 1. Journal of Virology 27, 619–627.
Notarianni, E. L. & Preston, C. M. (1982). Activation of cellular stress
protein genes by herpes simplex virus temperature sensitive mutants
which overproduce immediate early polypeptides. Virology 123,
113–122.
Preston, V. G. (1990). Herpes simplex virus activates expression of a
cellular gene by specific binding to the cell surface. Virology 176,
474–482.
Rhoads, D. D., Dixit, A. & Roufa, D. J. (1986). Primary structure of
human ribosomal protein S14 and the gene that encodes it. Molecular and
Cellular Biology 6, 2774–2783.
Roizman, B. & Sears, A. E. (1990). Herpes simplex viruses and their
replication. In Virology, 2nd edn, pp. 1795–1841. Edited by B. N. Fields,
D. M. Knipe, R. M. Chanock, M. S. Hirsch, J. L. Melnick, T. P. Monath &
B. Roizman. New York : Raven Press.
Diaz, J.-J., Duc Dodon, M., Schaerer-Uthurralt, N., Simonin, D.,
Kindbeiter, K., Gazzolo, L. & Madjar, J.-J. (1996). Post-transcriptional
transactivation of human retroviral envelope glycoprotein expression by
herpes simplex virus Us11 protein. Nature 379, 273–277.
Estridge, J. K., La Thangue, N. B., Mann, B. S., Tyms, A. S. & Latchman,
D. S. (1989). The herpes simplex virus type 1 immediate-early protein
ICP27 is obligately required for the accumulation of a cellular protein
during viral infection. Virology 168, 67–72.
Everett, R. D. (1985). Activation of cellular promoters during herpes
virus infection of biochemically transformed cells. EMBO Journal 4,
1973–1980.
Fenwick, M. L. & Walker, M. J. (1979). Phosphorylation of a ribosomal
protein and of virus-specific proteins in cells infected with herpes simplex
virus. Journal of General Virology 45, 397–405.
Garcin, D., Masse! , T., Madjar, J.-J. & Jacquemont, B. (1990). Herpes
simplex virus type I immediate-early gene expression and shut off of host
protein synthesis are inhibited in neomycin-treated human epidermoid
carcinoma 2 cells. European Journal of Biochemistry 194, 279–286.
Hanahan, D. (1983). Studies on transformation of E. coli with plasmids.
Journal of Molecular Biology 166, 557–580.
Hunt, C. R. & Morimoto, R. I. (1985). Conserved features of eukaryotic
hsp70 genes revealed by comparison with the nucleotide sequence of
human hsp70. Proceedings of the National Academy of Sciences, USA 82,
6455–6459.
Inglis, S. C. (1982). Inhibition of host protein synthesis and degradation
of cellular mRNAs during infection by influenza and herpes simplex virus.
Molecular and Cellular Biology 2, 1644–1648.
Jefferies, H. B. J., Reinhard, C., Kozma, S. C. & Thomas, G. (1994).
Rapamycin selectively represses translation of the ‘ polypyrimidine tract ’
mRNA family. Proceedings of the National Academy of Sciences, USA 91,
4441–4445.
Johnson, K. R. (1993). Characterization of cDNA clones encoding the
human homologue of Saccharomyces cerevisiae ribosomal protein L30.
Gene 123, 283–285.
Kaspar, R. L., Morris, D. R. & White, M. W. (1993). Control of ribosomal
protein synthesis in eukaryotic cells. In Translation Regulation of Gene
Expression, vol. 2, pp. 335–348. Edited by J. Ilan. New York : Plenum Press.
Kemp, L. M. & Latchman, D. S. (1988 a). Differential regulation of
octamer-containing cellular genes by the herpes simplex virus virion
protein Vmw65 is mediated by sequence differences in the octamer
element. EMBO Journal 7, 4239–4244.
Kemp, L. M. & Latchman, D. S. (1988 b). The herpes simplex virus type
1 immediate–early protein ICP4 specifically induces increased transcription of the human ubiquitin B gene without affecting the ubiquitin A
and C genes. Virology 166, 258–261.
Kennedy, I. M., Stevely, W. S. & Leader, D. P. (1981). Phosphorylation
of ribosomal proteins in hamster fibroblasts infected with pseudorabies
virus or herpes simplex virus. Journal of Virology 39, 359–366.
Kwong, A. D. & Frenkel, N. (1989). The herpes simplex virus virion host
shutoff function. Journal of Virology 63, 4834–4839.
Laemmli, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Lastick, M. S. & McConkey, E. H. (1976). Exchange and stability of
HeLa ribosomal proteins in vivo. Journal of Biological Chemistry 251,
2867–2875.
EEC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
Ribosomal protein synthesis after HSV-1 infection
Roizman, B. & Sears, A. E. (1993). Herpes simplex viruses and their
replication. In The human Herpes Viruses, pp. 11–68. Edited by B. Roizman,
R. J. Whitley & C. Lopez. New York : Raven Press.
Roller, R. J. & Roizman, B. (1992). The herpes simplex virus 1 RNA
binding protein Us11 is a virion component and associates with ribosomal
60S subunits. Journal of Virology 66, 3624–3632.
Schek, N. & Bachenheimer, S. L. (1985). Degradation of cellular
mRNAs induced by a virion-associated factor during herpes simplex
virus infection of vero cells. Journal of Virology 55, 601–610.
Silverstein, S. & Engelhardt, D. L. (1979). Alterations in the protein
apparatus of cells infected with herpes simplex virus. Virology 95,
334–342.
Simonin, D., Diaz, J.-J., Kindbeiter, K., Denoroy, L. & Madjar, J.-J.
(1995 a). Phosphorylation of ribosomal protein L30 after herpes simplex
virus type1 infection. Electrophoresis 16, 854–859.
Sydiskis, R. J. & Roizman, B. (1966). Polysomes and protein synthesis
in cells infected with a DNA virus. Science 153, 76–78.
Sydiskis, R. J. & Roizman, B. (1967). The disaggregation of host
polyribosomes in productive and abortive infection with herpes simplex
virus. Virology 32, 678–686.
Tsang, S. S., Yin, C., Guzzo-arkuran, V. S., Davison, A. J. & Davison, J.
(1993). Loss of resolution in electrophoresis of RNA : a problem
associated with the presence of formaldehyde gradients. BioTechniques
14, 380–381.
Wagner, E. K. & Roizman, B. (1969). Ribonucleic acid synthesis in cells
infected with herpes simplex virus. Journal of Virology 4, 36–46.
Wool, I. G., Chan, Y.-L. & Glu$ ck, A. (1996). Mammalian ribosomes : the
structure and the evolution of the proteins. In Translational Control, pp.
685–732. Edited by J. Hershey, M. Mathews & N. Sonenberg. Cold
Spring Harbor, NY : Cold Spring Harbor Laboratory.
Simonin, D., Diaz, J.-J., Kindbeiter, K., Pernas, P. & Madjar, J.-J.
(1995 b). Phosphorylation of herpes simplex virus type 1 Us11 protein
is independent of viral genome expression. Electrophoresis 16, 1317–1322.
Received 2 August 1996 ; Accepted 1 October 1996
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 15:06:14
EED