Nucleic Acids Research, Vol. 18, No. 17 5113
Role of TATA-element in transcription from glucocorticoid
receptor-responsive model promoters
Stefan Wieland, Michael D.Schatt and Sandro Rusconi*
Institute for Molecular Biology 2, University of Zurich, Honggerberg ETH/HPM, CH-8093 Zurich,
Switzerland
Received June 4, 1990; Revised and Accepted July 31, 1990
ABSTRACT
Transcription activation properties of the rat
glucocorticoid receptor (GR) on minimal, TATA-box
containing or depleted promoters have been tested. We
show that a cluster of Glucocorticoid Responsive
Elements (GRE), upon activation by the GR, is sufficient
to mediate abundant RNA-polymerase II transcription.
We find that in absence of a bona fide TATA-element
transcription initiates at a distance of 45 - 55bp from
the activated GRE cluster with a marked preference for
sequences homologous to the initiator element (Inr).
Analyzing defined, bi-directional transcription units we
demonstrate that the apparent reduction of specific
transcription in strong, TATA-depleted promoters, is
mainly due to loss of short-range promoter polarization.
The implications for long-range promoter/enhancer
communication mechanisms are also discussed.
INTRODUCTION
Typical RNA polll promoters consist of proximal cis-elements
such as the TATA box and the transcription initiator region (1-3)
as well as a combination of upstream or far upstream cis-elements
(4,5). Glucocorticoid Response Elements (GREs) occur at various
positions in regulated promoters (reviewed by 6 and 7) and
control transcription in synergism with other ubiquitous ciselements (8,9,10,11). We (12,13,14) and others (15) have
demonstrated earlier that extremely efficient glucocorticoiddependent transcriptional stimulation can be obtained simply by
linking multiple GREs in proximity of a TATA box. At the same
time, studies with purified mammalian cell extracts have led to
the identification of the TFIID protein fraction which contains
at least a protein which binds to the TATA box (16,17,18) and
whose gene has been recently cloned (17). The requirement of
this protein fraction for accurate in vitro transcription and its
cooperative behaviour with other defined upstream binding
transactivators has been documented (18, and references therein).
However, several cellular promoters have been characterized
which do not contain any obvious sequence which can be related
to the TATA element and yet allow for accurate and regulatable
transcription in vitro and in vivo (3,19 and references therein).
It has been reported that weakly conserved sequences overlapping
* To whom correspondence should be addressed
the initiation region of some genes can directly respond to suitably
placed transcriptional stimulators such as the ubiquitous
transactivator Spl whose binding sites are often found in the
above mentioned TATA-less promoters (3,19). Here, we
demonstrate that the same holds true for a transcription factor
whose binding sites have been found and characterized so far
exclusively in TATA-containing promoters. With our set of
deletion mutants we wanted to establish directly whether the
TATA box is required a priori for efficient transcriptional
stimulation by the glucocorticoid receptor. For our studies we
have used a truncated version of the glucocorticoid receptor (aa
3—556) without the hormone binding domain. This protein is
a strong, highly GRE-specific and constitutively active
transactivator (12 -14) which shows no apparent interference with
the endogenous receptor. In our experiments, there is no need
for a hormone (i.e. dexamethasone) induction, thus we try to
avoid possible side-effects of the hormone on the cell metabolism.
By studying bi-directional transcription, we suggest some simple
explanations about the observed synergistic behaviour of TATA
box and upstream promoter elements. The implications of our
observations on the mechanisms of interaction between a remote
enhancer and its target promoter are also discussed.
MATERIALS AND METHODS
Plasmids
The reporter gene P4OVEC (12) contains a modified rabbit /3globin gene with sequences from -1221 to +3325 cloned into
pUC18 (20). All promoter sequences except the TATA-box and
the initiator region have been deleted and replaced by a synthetic
oligonucleotide bearing four palindromic GREs shown in Fig.
1 A. Recombinant reporter genes without a TATA-box (Fig. IB)
were generated by repair-ligase or by introducing synthetic
oligonucleotides into the corresponding region of P4-OVEC. The
clone P4(39) AT arose from incomplete repair reaction. Reporter
genes for the investigation of bi-directional transcription contain
the same rabbit /3-globin gene (20) (called /32). Reporter genes
1 and 2 correspond to P4OVEC and P4(50)AT, respectively.
Constructs 3 to 6 (in Fig. 4) contain an additional modified |3globin gene (21) pointing in the opposite direction (left-pointing
arrows). Both, /32 and /31 have the same sequence from - 1 5
5114 Nucleic Acids Research, Vol. 18, No. 17
to +130, and thus contain the same initiator region. All
recombinants were verified by enzymatic sequencing. The
eucaryotic expression vectors encoding as transcriptional
activators the rat Glucocorticoid Receptor aa 3 to 556 or aa 407
to 556 (22,23,24) are driven by the human cytomegalovirus
enhancer/promoter (CMV). Translational initiation is provided
by the AUG and two additional amino acids of the herpes simplex
virus thymidine kinase leader (TK).
Transient transfection and cytoplasmic RNA analysis
10 /zg of reporter gene plasmid were transfected in HeLa cells
as described (20, and references therein). Other plasmids were
included in the transfection cocktail as indicated in Fig. 2 and
4, in the following amounts: 0.5 /tg of OVEC-ref. plasmid (20),
1 /tg of pSTC:GR3-556 and 5 /tg of pSTC:GR407-556
transact!vating plasmids. After 2 days cytoplasmic RNA was
harvested. 20 /tg of RNA were subjected to Sl-nuclease (Fig.
2) or RNase (Fig. 4) mapping as described (20 and references
therein). Nuclease-protected material was electrophoresed at high
resolution. Chemically cleaved (26) size markers were included
in Fig. 2, lanes 6 and 7. The probe used for the Sl-nuclease
mapping in Fig. 2. is identical to the one described by Westin
et al. (20) and consists of a synthetic oligonucleotide
corresponding to the antisense sequence of the /3-globin gene from
+75 to —11 (Fig. 1A). For the RNAase mapping in Fig. 4, a
radiolabelled RNA probe (Rsa-Saul, 21) was used allowing for
the simultaneous detection of either the /31 or /S2 transcripts
generated by the bi-directional reporter genes (Fig. 4A). All
manipulations were performed according to standard procedures
(27) and by following the NIH guidelines for recombinant DNA.
Calculations in Figures 2 and 4
The autoradiographic signals were quantitated by scintillation
counting of the corresponding bands excized from the gels. For
every reporter gene, the expression level was normalized to the
reference signal. In Fig. 3, the weak signals corresponding to
position +10 to +20 deriving from the reference /3-globin
transcription (see lanes 1 and 2 of Fig. 2) were subtracted. Signals
corresponding to each individual start were further standardized
by taking the sum of all signals in each lane as 100% value. The
histograms give such a relative value (for individual positions
between —9 and +20) for the relevant TATA-less constructs
and the TATA-containing P4-OVEC. In Fig. 4, the expression
level of £1 and /32 was also corrected for the length of the
protected probe fragment.
RESULTS
Constructs and nomenclature
The promoters used in this report are illustrated in Fig. 1. The
parent construct plasmid is P4-OVEC (Fig. 1 A). In this plasmid,
the centres of the palindromic GREs are separated by 28 bp (12).
A series of TATA box-depleted mutants (designated by the suffix
AT) has been generated by substituting the region between —10
and - 3 7 of P4-OVEC with modified polylinker DNA (see Fig.
IB). The ATmutants still contain the GRE cluster (called P4),
placed at different positions relative to the initiation site. In our
nomenclature (e.g. P4(36)AT, P4(50)AT), the number in brackets
represents the distance in base pairs between the centre of the
proximal GRE palindrome and the +1 position (see Fig. IB for
details).
-155
. . A&AACA61C 7677BGA6ATCCGTAGCT
A&AACA&TC rerTTTEASATCCGTAGCT
TC ffiTrffGASATCCGTAGCT
^
Pi
-5?
.
-4?
.
»..••*•
-2Q
fc
AGMCABJC rflrrCTBAGATCCTCTAGAGTCGACCTTGGGCATAAAAGGCAG
.
10
.
+1
.
+10
.
+20
.
+M
AGCACT6CAGCTGCTCCTTACACTTGCTTTTGACACAACTGTGTTTACTTGC
.
+40
.
+50
.
+60
.
+70
AATCCCCCAAAACAGACA6AATGGTGCATCTGTCCAGTGAG6A6AAGTC. . .
-if
B
-30
0Q
(Q
(y
.TCCTCTA6A6TC6ACCTT66KATAAAA6GCA6A6CACTGCA6CT6CTCCTTACAC.
. . . rerrC7EA6ATCCTCTAGCCT«A6CT6CTCCTTACAC.
. . . rG77rreA6ATCCTCTAGA6CCT6CA£CTGCTCCTTACAC.
. . . rSTTCTEA6ATCCTCTAGC6ACCTGCAGCT6CTCCTTACAC.
. . . 75rTC7BA6ATCCTCTA6ASTC6ACCTSCAGCTGCTCCTTACAC.
. . . r6rTC7BA6ATCCTCTAGAGTCSATCGACCTGCA6CTSCTCCTTACAC.
Pi
*•
. . . rS7TC75AGAKCTCTA6CTA6A6TC6ATC6ACCTGCA6CTSCTCCTTACAC.
D
-M
H
H
-«7
556
Figure 1. GR-regulated Reporter Promoters. (A) The structure of P4-OVEC,
in which four synthetic GREs are linked to the rabbit /3-globin minimal promoter
(12,20). Symbols: wavy line, plasmid sequences; straight line, globin flanking
sequences ; hatched box, rabbit $-globin coding sequences; black boxes, GRE
palindromes; broken arrow, transcription initiation. Boxed area; sequence details
from position -155 to +82. Arrows above italicized sequences, GRE palindromes;
Pt, P2, etc., denote palindromic GREs in proximal to distal order; asterisks
indicate TATA box region; continuous line, star, dashed line and dotted line
below the sequence symbolize the extent of the synthetic SI-probe. (B) At the
top, sequence of P4-OVEC from -52 to +4. Asterisks indicate location of the
TATA box or the DNA segment at corresponding position in the mutated
promoters. The TATA box-deleted constructs (designated with the A7" suffix)
are aligned under the P4-OVEC sequence; only half of the most proximal GRE
palindrome is shown, see arrow above italicized sequence. In the plasmid
nomenclature, the number in brackets indicates the distance in base pairs between
the centre of the most proximal palindromic GRE (see P, in (A)) and the natural
initiation site of |3-globin. ( O Top: Structure of the rat Glucocorticoid receptor
showing the three operationally defined domains (25): P, potentiator domain;
D, the smallest unit conferring transactivation and bearing the DNA-binding
domain; EfhE, Hormone binding domain. Bottom: Eucaryotic expression vectors
encoding rat GR aa 3-556 (pSTC:GR3-556) and rat GR aa 407-556
(pSTC:GR407-556). Symbols: empty box, CMV promoter; filled box, rGR
cDNA; thick line, rabbit jS-globin splice/polyadenylation signals.
Nucleic Acids Research, Vol. 18, No. 17 5115
Transactivator: - - - - (a)
(a) (a) (a) (a) (a) (a) (b) (a)
GRE-distance: 64 42 64 42 42
36 38 39 42 46 50 64 64
TATAbox:
+ - + - -
OVEC-Ftef.:
+ + - - +
Read-
f
a
through
1
;J
I
1
••
Starts
--•
Reference I * « * ,
signals
1
*
+1
+5
+10
+15
+20
~ +25
+30
Lane:
12
3 45
- -
8
~
-
9 10 11 12 13 14 15
Figure 2. GR-stimulation of promoters containing or lacking the TATA box.
The autoradiogram shows the Sl-nuclease mapping of transcripts generated in
transiently transfected HeLa cells by the reporter genes illustrated in Fig. 1. For
experimental details see Materials and Methods. The relevant components of the
transfection mixture are tabulated above the lanes: Transactivator. ' - ' , no
transactivator, (a), plasmid pSTC:GR3-556 (9); (b), plasmid pSTC:GR4O7-556
(9); GRE distance, distance of proximal GRE from + 1 ; TATA box, indicates
TATA box presence/absence in the corresponding reporter gene; OVEC-rtf., +/ —
indicates the presence/absence of the reference /3-globin plasmid in the transfection
cocktail. The position of the expected Sl-resistant fragments is indicated at the
left. Lanes marked G and A/G (6 and 7) were loaded with corresponding Maxam
and Gilbert (15) purine-specific reactions of the endlabelled probe.
Transcription in TATA-depletcd constructs
The reporter genes were expressed transiently in HeLa cells by
co-transfection with the GR expression vector pSTC:GR3 —556
(12). The RNA was isolated and assayed by Sl-nuclease
protection of an end-labelled oligonucleotide probe (see Fig. 1A
for details). The results are shown in Fig. 2. In the absence of
transactivator (lanes 1 to 4) there are no detectable transcripts
deriving from the reporter genes, regardless of the presence or
absence of a TATA box. The signals seen in lanes 1 and 2 arise
from transcription of the reference plasmid (20). In contrast, very
strong signals are detected (lanes 5 and 8 to 15) when a plasmid
encoding the constitutively active GR is co-transfected. The
scattered initiation detected in most of the AT mutants was
expected, given the established properties of the TATA box as
a selector for correct initiation (2 and references therein, 28).
Upon progressive upstream shifting of the GRE-cluster, the
pattern of initiation gradually changes from more downstream
starts (lanes 8 and 9) to a higher proportion of intermediate starts
(lanes 10 and 11) until the positioning of the GRE cluster allows
for an almost 'normal' pattern of initiation (lanes 12 and 13).
Quantitative evaluation of transcription start site usage upon
GRE-cluster shifting and influence of the amount of
cotransfected transactivator
A quantitative evaluation of the autoradiographic signals is given
in Fig. 3A where the histograms represent the relative selection
frequency of individual start sites from - 9 to +24 for the
reporter promoters in which the centre of the proximal GRE was
situated at 36, 38, 39, 42, 46 or 50 bp from the natural start.
This finding suggests that the activated GRE-cluster may represent
a strong centre of attraction for the transcription complex (or a
rate-limiting general factor belonging to it) and that in the absence
of further signals, transcription begins in the proximity of the
activated cluster, with marked peaks around sequences with
homology to the initiator region(s) YYCAYYYYY (3, 29, see
sequence in Fig. 3A). The rate of utilization of such genuine or
cryptic initiation sites reaches a maximum at a distance of 45 - 5 5
bp from the activated GRE cluster. This observation is in
agreement with previous reports which describe an apparent
optimal 4 0 - 5 0 bp distance between the binding site for the
activator Spl and the Inr (29). Given these features, we expected
for the constructs P4(46)AT and P4(50)ATa strongly favoured
transcription initiation at the natural /3-globin initiator region.
Indeed, these two reporter genes show an almost normal initiation
pattern (Fig. 2 and 3A) with P4(46)ATstill having some further
downstream initiating transcripts and P4(50)ATalready showing
significant initiation upstream of the genuine /3-globin +1
position. We wanted to determine whether the apparent difference
of the overall transcription level between a TATA-containing and
a TATA-deprived promoter is maintained or becomes more
pronounced upon reduction of the amounts of specific
transactivator (Fig. 3B, from 1000 ng to 50 ng of co-transfected
trans-activator encoding plasmid). In these experiments, we
observed that the difference between TATA-containing and
TATA-depleted constructs does not change even when very small
amounts of effector plasmid are offered in the co-transfection
cocktail (see experimental values at top and standardized values
in the bottom plot of Fig. 3B). This shows that the presence of
a TATA box contributes only marginally to the transcription rate
from promoters consisting of high affinity binding sites for
upstream factors, and this even under conditions in which the
specific regulatory factor is rate-limiting. In fact, the transcription
from the TATA-box depleted promoter P4(50)AT reaches
approximatively half of the level measured from a TATA-box
containing promoter (P4-OVEC) (Fig. 3A, 6 and 7). Thus, we
propose that the most important function of a TATA-box may
be to 'polarize' transcription activity from natural promoters by
providing an independent, high affinity, a-symmetrically placed
site for the RNA polymerase via the cognate TATA-box binding
factor. Consistent with this idea, divergent transcription has been
observed in several cellular genes lacking a TATA box
(29,30,31,32) or containing two, divergently oriented TATA
boxes (33 and references therein).
Analysis of bi-directional transcription reveals polarizing
function of the /3-globin TATA-box
To analyze bi-directional transcription from our test promoters,
we designed the experiment illustrated in Fig. 4. We constructed
reporter genes (Fig. 4A) which allow for the simultaneous
detection of transcription in either direction with the same
radiolabelled RNA (21, see legend to Fig. 4). We also tested
with this probe transcripts generated by the activated constructs
P4-OVEC and P4(50)AT (see lanes 1 and 2 in Fig. 4B) and
5116 Nucleic Acids Research, Vol. 18, No. 17
B
TATA
bo*
mh.
NO
(a)
(b)
(signal / ref.)
I- 16.0
36 bp 11 %
8.0
NO 38 bp 14%
lna_
NO
39 bp 16 %
50 100
500(ni pGR3-5J6) 1000
50 100
500(ng pGR 3-556) 1000
NO 42 bp 18 %
NO 46 bp 26 %
NO 50 bp 40 %
7{
lliL_.~__
. . .LlU.lU.Hi
-s »i »i
•is •»
YES 64 b p 100 %
..<- rabbit p-globin
<— start position
Figure 3. Quantitative evaluation of transcription in promoters lacking or including the TATA box. The quantitative analysis is described in Materials and Methods.
(A) The relevant features of each promoter are given at the right: first column, presence of TATA box; column (a), distance of GRE; column (b), relative strength
of maximal transcription, obtained by integrating the signals from - 5 to +18, dividing by the signal corresponding to the reference plasmid and comparing the
quotient to the corresponding value of P4-OVEC (taken as 100%). (B) The Sl-signals (from - 1 to +5) measured from cells transfected with P4OVEC (continuous
line) and the TATA-less construct P4(50)AT (dashed line) in the presence of decreasing amounts of trans-activating plasmid pSTC:GR3-556 have been quantitated
from autoradiograms (not shown). The lines connect experimental data from a representative transfection series. In Graph 1, the y-axis gives the actual transcription
levels expressed as: (cpm of pooled signals from - 1 to +5) / (cpm of reference signal). In Graph 2, the transcription level obtained when 1000 ng trans-activator
plasmid are co-transfectcd is taken arbitrarily as 100% for either reporter gene. This representation better illustrates the absolutely parallel response of either construct
(TATA-less or TATA-containing) to decreasing amounts of trans-activator.
A
B
1 2
3
4
5
6
n n n n r» n
(32
Figure 4. Testing bi-directional transcription in presence and absence of TATA-box. (A) Constructs used: boxed 01 and 02, initiator regions; boxed T, /3-globin
TATA-box, cross on line, mutated TATA-box region (corresponding to P4(50)AT), empty boxes, palindromic GREs; arrows, direction of transcription (the thickness
is proportional to the measured transcription level (see data in section B); numbers in brackets, Kcpm evaluated from 01-and 02 signals of the radiogram in Fig.
4B. (B) RNA analysis with the riboprobe described in Materials and Methods. Cells were transfected with the reporter genes described in Fig. 4A either in presence
or absence ( + / - sign at bottom of autoradiogram) of pSTC:GR3— 556. Symbols: lane numbers, analysis of cells transfected with the corresponding constructs (same
code as in Fig. 4A); 01 and 02, signals corresponding to correctly initiated transcripts from the corresponding moiety; a and c, readthrough signals from the 01,
respectively 02 gene; b, signal corresponding to the Ref. gene. To reduce the amount of side-product signals, the amount of Ref. gene was reduced 5-fold in the
co-transfections in which GR encoding plasmid was added.
Nucleic Acids Research, Vol. 18, No. 17 5117
observed, as expected, only the transcript from the standard
OVEC coding sequence (band labeled /32). As anticipated, the
RNA corresponding to the deleted /3-globin transcript /31, appears
only in cells transfected with the constructs containing the
corresponding sequence cloned upstream of the P4 promoter (see
lanes 3—6 in Fig. 4B and corresponding constructs in Fig. 4A).
These bi-directional /3-globin reporter plasmids were tested in
several versions either with or without TATA-boxes (see numbers
3 to 6 in Fig. 4A and data in Fig. 4B). Two major conclusions
could be drawn from these results: (1) the overall transcription
level remains within the same range (see the sum of upstream
+ downstream transcription in scheme of Fig. 4A); (2) as a
consequence, when only one TATA-box is present, transcription
in one particular direction is augmented at the expense of
transcription in the opposite direction. Our findings allow for
a simple explanation for the nearly complete loss of specific
transcription observed upon deletion of the TATA-box region
of natural promoters (34,35,36): we propose that in these cases
there are cryptic TATA-boxes upstream of the tested promoters
which efficiently concentrate transcription in the upstream
direction. These data further support the notion that the TATAbox has a major qualitative (rather than quantitative) role in
controlling transcription from a strong cellular promoter.
Furthermore, it becomes evident that the upstream transcription
factor binding sites are the major rate limiting elements controlling
the overall transcription level. It remains to be verified, whether
this applies also to the situation in which the promoter consists
of weak binding sites for the upstream regulatory factor(s). It
must be also noted that our experiments do not address the
question of whether or not the factor TFTJD is involved in the
transcription of the TATA-less promoters.
DISCUSSION
Transcriptional activity in absence of a TATA box has been
reported for the yeast activator GCN4 and one of its target
promoters (37). In vertebrates, at least two classes of 'TATAless' promoters can be distinguished (3 and references therein).
In one class, which contains many so-called house keeping genes
(38), the sequence adjacent to the initiation site is significantly
rich in GC boxes which are expected to be targets for the
ubiquitous transcription factor Spl (39). Not surprisingly, a recent
report demonstrates that Spl can indeed promote transcription
in absence of a bona fide TATA box (19). Our data extend this
finding now to include the glucocorticoid receptor, whose target
site has so far only been found in TATA-containing promoters.
The importance of another type of cis-elements, called the initiator
region (Inr, 3), and its ability to stimulate transcription in
conjunction with GC-boxes has also been documented (3). The
rabbit /3-globin natural start region shares some homology with
the described Inr element (see Fig. 1). Additional sequences
downstream and, in particular, the region around +16 and +30
also resemble the Inr-motif and are preferentially utilized in some
of our TATA-less promoters (see Fig. 3 for details).
We have shown above that the TATA-box can be seen as a
polarizing element which can divert polymerase from sterile
transcription from an adjacent cluster of upstream binding factors.
Work in our laboratory indicates that this polarizing function by
the sole TATA-box works only over relatively short distances
(20, 22). We speculate that a similar polymerase diversion might
apply to the long distance enhancer/promoter interactions.
According to this view, the polymerase would first accumulate
at the enhancer location and, in absence of other high affinity
binding sites, initiate sterile and scattered transcription (see Fig.
4, construct 3) of the surrounding sequences. Furthermore, the
presence of a complete promoter (i.e., TATA-box plus at least
one upstream factor site) would become the second-order
polarizing element which prevents dispersal of polymerase
attracted by the enhancer (22). This model is currently being
tested experimentally. The physical distance between an enhancer
and a promoter should not represent a major barrier for such
diffusion-driven communication since, for example, 2 kbp of
intervening DNA packaged into a regular and flexible chromatin
structure (i.e 10 nucleosomes) represents an average distance of
only 50 nm to a maximum of 100 run. Such a distance is only
few times the average diameter expected for a large protein
complex such as the RNA polymerase II holoenzyme. We want
to emphasize that, in the light of recent evidence (40), it is
unlikely that the proposed diffusion would occur monodimensionally (i.e., along the DNA fibre). We do not rule out
the possibility that, in particular cases, a remote enhancer and
its target promoter might have evolved to undergo more direct
interactions, although we have so far been unable to detect
preferences or incompatibilities by combining specific enhancers
with defined promoters (20, 22, M.Kermekchiev, M. S., and
W. Schaffner, in preparation). In light of these data, a diffusioncontrolled model for enhancer action would provide the simplest
explanation for the apparent promiscuity in the interplay between
remote and proximal regulatory sites.
ACKNOWLEDGEMENTS
We are indebted to Markus Thali, Rainer Heuchel, Christine Hug
and Fritz Ochsenbein for: gift of some clones, technical assistance
and artwork, respectively. We want to thank Walter Schaffner
for stimulating ideas, support and critical reading. Furthermore,
we are grateful to Keith Harshman and Deborah Maguire for
critical reading and suggestions. This work has been supported
by the Kanton Zurich and the Schweizerischer Nationalfonds
(grant Nr.31-25682.88).
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Breathnach, R& Chambon, P. (1981) Annu. Rev. Biochem. 50, 349-383.
Guarente, L. (1987) Annu. Rev. Genet. 21, 425-392.
Smale, S. T. & Baltimore, D. (1989) Cell 57, 103-113.
Me Knight, S. & Tjian, R. (1986) Cell 46, 795-805.
Maniatis, T., Goodboum, S & Fischer, J.A. (1987) Science 236, 1237-1245.
Yamamoto, K.R. (1985) Annu, Rev. Genet. 19, 209-246.
Beato, M. (1989) Cell 56, 335-338.
Schule, R., MQller, M., Otsuka-Murakami, H. & Renkawitz, R. (1988)
Nature 332, 87-90.
Schule, R., MQller, M., Kaltschmid, C & Renkawitz, R. (1988) Science
242, 1418-1420.
Miksiceck, R. , Borgmeyer, U & Nowock, J.(\98T) EMBOJ. 6, 1355-1360
Buetti, E. , KQhnel, B & Diggelmann, H. (1989) Nucl. Acids Res. 17,
3065-3078.
Seveme, Y., Wieland, S., Schaffner, W. & Rusconi, S. (1988) EMBOJ.
7, 2503-2508.
Wieland, S., Galli, I., Schatt, M.D., Severne, Y. & Rusconi, S. in: Molecular
Mechanisms and Consequences of Activation of Hormone and Growth Factor
Receptors. NATO/ASI series C, volume 295, Ed. C.E. Sekeris, Khiwer
Acad. Publishers, 1988, page 215-225.
Schatt, M.D., Wieland, S. & Rusconi, S. in: Hormones and Cell Regulation.
Eds J. Dumont & J. Nunez, John Ubbey Eurotext Ltd, London 1989, in press.
Strahle, U., Schmid, W. and SchOtz, G.(1988) EMBOJ. 7, 3389-3395
Sawadogo, M & Roeder, R. G. (1985) Cell 43, 165-175.
Horikoshi, M., Hai, T., Lin, Y-S., Green, M. R. & Roeder, R. G. (1988)
CW/54, 1033-1042.
5118 Nucleic Acids Research, Vol. 18, No. 17
18. Horikoshi, M., Carey, M. F. , Kakidani, H. and Roeder, R. G. (1988) Cell
54, 665-669
19. Schmidt, M. C , Zhou, Q. & Berk, A.(1989) Mot. Cell Bid. 9, 3299-3307
20. Westin, G., Gerster, T., Muller, M., Schaffher, G. & Schaffher, W. (1987)
Nucl. Acids Res. 15, 6787-6798.
21. Heuchel, R., Matthias, P. and Schaffner, W. (1989) Mud. Adds Res. 17,
8931-8947.
22. Schatt, M.D., Rusconi, S. and Schaffner, W. (1990) EMBO J. 9, 481 -487.
23. Rusconi, S., Severne, Y., Georgiev, O., Galli, I. and Wieland, S. (1990)
Gene 89, 211-221.
24. Godowski, P.J., Rusconi, S., Miesfeld, R. and Yamamoto, K.R. (1987)
Nature 324, 365-368.
25. Beato, M. (1989) Cell 56, 335-344
26. Maxam, A.M. & Gilbert, W. (1980) Meih. Enzymol. 65, 499-550.
27. Maniatis, T., Fritsch, E. F. & Sambrook, J. Molecular Cloning. A Laboratory
Manual. Cold Spring Harbor Laboratory Press, CcHd Spring Harbor, N
Y, 1982.
28. Grossschedl, R. & Bimstiel, M. L. (1980) Proc. Nail. Acad. Sci. USA 77,
1432-1436.
29. Corden, J., Wasylyk, B. Buchwalder, A., Sassone-Corsi, P., Kedinger, C.&
Chambon, P. (1980) Science 209, 1405-1414.
30. Queen, C , Lord, S T . , Me Cutchan, T. F. & Singer, M. F. (1981) Mol.
Cell. Biol. 1, 1061-1068.
31. Staffer, J.D. & Singer, M.F. (1984) Nucl. Adds Res. 12, 4769-4788.
32. Mitchell, PJ., Carothers, A.M., Han, J.H., Harding, J.D., Kas, E., Venolia,
L. & Chasin, L. A. (1986) Mol. Cell. Biol. 6, 365-440.
33. Doyen, N., Dreyfus, M. and Rougeon, F..(1989) Nucl. Adds Res. 17,
1977-1987.
34. Dierks, P., Wieringa, B., Marti, D., Reiser, J., van Ooyen, A., Meyer,
F., Weber, H. and Weissmarm, C. in: Developmental Biology Using Purified
Genes. ICN-UCLA Symposia on Molecular and Cellular Biology, volume
XXITJ, Ed. D. D. Brown, Academic Press (1981) page 347-366.
35. Wasylyk, B., Derbyshire, R., Guy, A., Molko, D., Goget, A., Teoule, R.
and Chambon, P. (1980) Proc. Natl. Acad. Sci. USA 77, 7024-7028.
36. Buetti, E. and KQhnel, B. (1986) Jour. Mol. Biol. 190, 379-389.
37. Chen, W. & Struhl, K. (1989) EMBO J. 8, 261-268.
38. Sehgal, A., Patil, N. & Chao, M. (1988) Mol. Cell. Biol. 8, 3160-3167.
39. Dynan, W. S. & Tjian, R. (1983) Cell 35, 7 9 - 8 7 .
40. Muller, H.P., Sogo, J. M. and Schaffner, W. (1989) Cell 85, 767-777.