472500
ovel gammaherpesvirus in sun bearsLam et al.
VDIXXX10.1177/1040638712472500N
A novel gammaherpesvirus found in oral
squamous cell carcinomas in sun bears
(Helarctos malayanus)
Journal of Veterinary Diagnostic Investigation
25(1) 99­–106
© 2013 The Author(s)
Reprints and permission:
sagepub.com/journalsPermissions.nav
DOI: 10.1177/1040638712472500
http://jvdi.sagepub.com
Lydia Lam, Michael M. Garner, Christine L. Miller, Victoria E. Milne, Kimberly A. Cook,
Gary Riggs, James F. Grillo, April L. Childress, James F. X. Wellehan Jr.1
Abstract. A novel herpesvirus was detected in sun bears (Helarctos malayanus) with oral squamous cell carcinoma. Five
captive sun bears from 4 institutions in the United States presented with oral lesions ranging from erythema and mild erosions
to nodular, ulcerated masses. All 5 were diagnosed with squamous cell carcinoma. The tumors were treated with surgical
resection but recurrence, local extension, or appearance of new lesions was noted in all cases. Intralesional chemotherapy
was administered in 2 cases, and the nonsteroidal anti-inflammatory drug piroxicam was administered in 3 cases. Virus was
detected in 4 of the 5 bears’ tissue samples using a consensus herpesvirus polymerase chain reaction. Nucleotide sequencing
and phylogenetic analysis showed that this herpesvirus is in the subfamily Gammaherpesvirinae and distinct from other
known herpesviruses. The association between the herpesvirus and squamous cell carcinoma is unknown. The current study
presents a novel gammaherpesvirus within the order Ursidae, with the name Ursid herpesvirus 1 proposed.
Key words: Helarctos malayanus; herpesvirus; sun bears; squamous cell carcinoma; ursids.
Introduction
The smallest of the ursids, the sun bear (Helarctos malaya­
nus) is an omnivorous, terrestrial bear inhabiting the tropical
forests of Southeast Asia. Sun bear populations are threatened with extinction due to poaching for traditional medicine.26 They are currently listed by the International Union
for Conservation of Nature and Natural Resources (IUCN)
Red List as vulnerable (Fredriksson G, Steinmetz R,
Wong S, Garshelis DL: 2008, Helarctos malayanus. In:
IUCN 2011. IUCN Red List of Threatened Species. Version
2011.1). In captivity, bears are generally considered longlived and healthy species, with reported lifespans of over
20 years. The most frequently reported major health issues
are tumors of the hepatobiliary system and dermatopathies.
Dental problems, including periodontal disease and fractured
canines, are also common.22 There is 1 previous report of
a mandibular squamous cell carcinoma in a Malayan
sun bear.20
The presence of herpesviruses in Ursidae, the family containing all 8 living species of bear, has been infrequently
reported. Suid herpesvirus 1 (Pseudorabies virus) was isolated from an American black bear (Ursus americanus) and
4 captive European brown bears (Ursus arctos) with 100%
mortality.25,33 Another outbreak of pseudorabies involved 3
Asiatic black bears (Ursus thibetanus), a Kodiak bear (Ursus
arctos middendorffi), and 4 polar bears (Ursus maritimus) in
a traveling circus; 4 of the 8 bears died and 1 was euthanized.3
These infections were linked to the consumption of raw
pork. Equid herpesvirus 9 was reported in a captive polar
bear that was euthanized due to progressive meningoencephalitis. Zebra housed nearby were implicated as a possible
source of the virus.8 These cases likely represent crossspecies transmission of a herpesvirus from its natural host
reservoir to an aberrant host, with resultant severe disease
and mortality. To our knowledge, an endemic herpesvirus has
not yet been reported in an ursid.
Over 200 species of herpesviruses have been described.
Herpesviruses tend to be host-specific and often appear to
have co-diverged evolutionarily along with their hosts. Most
vertebrate species examined have 1 or more endemic herpesviruses; the true number in nature is likely to exceed the 200
thus far discovered. All herpesviruses investigated to date are
able to remain latent in specific cells of their natural host; they
also frequently undergo active shedding without associated
clinical symptoms, or with only mild symptoms. Fatal infections are usually rare in the natural, immunocompetent host.21
From the Department of Small Animal Clinical Sciences, College
of Veterinary Medicine, University of Florida, Gainesville, FL (Lam,
Childress, Wellehan); Northwest ZooPath, Snohomish, WA (Garner); Zoo
Miami, Miami, FL (Miller); El Paso Zoo, El Paso, TX (Milne); Akron
Zoo, Akron, OH (Cook); North Coast Bird & Exotic Specialties, Akron,
OH (Riggs); and Audubon Zoo, New Orleans, LA (Grillo).
1
Corresponding Author: James F. X. Wellehan Jr., PO Box 100126,
2015 SW 16th Avenue, Gainesville, FL 32608-0125. [email protected]
Downloaded from vdi.sagepub.com by guest on December 6, 2015
100
Lam et al.
Materials and methods
Animal information
Between September 2007 and August 2009, tissue samples
from oral lesions of 5 captive sun bears at 4 institutions in the
United States were submitted fresh frozen to the University
of Florida Zoological Medicine laboratory (Gainesville,
Florida) for viral polymerase chain reaction (PCR) panels,
and submitted fixed in neutral buffered 10% formalin to
Northwest ZooPath (Snohomish, Washington) for histopathology. Ages of the bears ranged from 8 to 19 years. Four
were captive born, and 1 was wild caught.
Histopathology
All tissues were embedded in paraffin blocks, sectioned at
5 µm, and stained with hematoxylin and eosin. Hyperplasia
of the oral mucosa or epidermis was characterized by hyperplasia of the epithelium with orderly maturation and no
breach of the basement membrane. Dysplasia was characterized by hyperplasia with disorderly maturation, with mitotic
figures appearing within the granular layers, and no breach
of the basement membrane. Squamous cell carcinoma was
characterized as orderly and disorderly proliferation of the
epithelium into the submucosa or dermis, and breaching of
the basement membrane, with varying degrees of inflammation and scirrhous response.
PCR amplification and sequencing
DNA was extracted from all of the tissue samples using a
commercial kit.a Blank extractions were used as negative
controls. Nested PCR amplification of a partial sequence of
the herpesvirus DNA-dependent DNA polymerase gene was
performed using previously described methods.30 The PCR
products were resolved in 1% agarose gels, excised, and
purified.b To obtain additional sequence, a specific internal
reverse primer was designed from the initial sequence
(SunBearHV1rev: TCCCTGGAGCGTTACTGTCT). This
was used with the forward pan-herpesviral primer DIEC
(KNDSNTTYGAYATHGARTG).17 Samples from cases 1
and 2 were also tested using a consensus papillomavirus
PCR.23 Sanger sequencing was performedc and analyzed.d
Products were sequenced twice in each direction.
Phylogenetic analysis
The predicted amino acid sequence was compared to
those in GenBank, as well as the National Center for
Biotechnology Information Reference Sequence project,
using BLASTP.1 Predicted homologous 445-557 amino
acid sequences of herpesviral DNA-dependent DNA polymerase were aligned using MAAFT.14 Bayesian analyses of
amino acid alignments were performed using MrBayes
3.1.224 on the CIPRES (Cyberinfrastructure for Phylogenetic
Research) server (Miller MA, Pfeiffer W, Schwartz T:
2010, Creating the CIPRES Science Gateway for inference
of large phylogenetic trees. In: Proceedings of the Gateway
Computing Environments Workshop, pp. 1–8. November
14, 2010, New Orleans, LA), with gamma distributed rate
variation and a proportion of invariant sites, and mixed
amino acid substitution models. The first 10% of 2,000,000
iterations were discarded as a burn in. Maximum likelihood
(ML) analyses of each alignment were performed using
RAxML on the CIPRES server with gamma distributed rate
variation and a proportion of invariant sites.29 Psittacid
herpesvirus 1 (GenBank accession no. NP_944403) was
designated as the outgroup. The amino acid substitution
model with the highest posterior probability in the Bayesian
analysis was selected. Bootstrap analysis was used to test
the strength of the ML tree topology,9 with 1,000 bootstrap
replicates.
Results
Animal information
Cases 1 and 2 were a 19-year-old female and an 18-year-old
male sun bear, respectively, from the same institution. The
female first presented with a swollen lower left lip that had
mild spontaneous hemorrhage and multiple foci of erythema.
This progressed over 1 month to become a 2-cm mass at the
rostral aspect of the left lower lip, which was surgically
removed with wide margins and diagnosed as squamous cell
carcinoma (Fig. 1). Four months later, a new mass was noted
on the ventrum of the oral cavity extending to the frenulum.
Biopsies of this mass showed squamous cell carcinoma,
which was marginally removed via laser surgery. The
remaining tissue was infiltrated with 50 mg of carboplatin
suspended in 30% sustained-release poloxamer. The right
submandibular lymph node was removed at this time and
showed no evidence of metastasis. Additional small areas of
sublingual neoplasia were noted at the 1 month recheck and
were treated with additional laser ablation and carboplatin–
poloxamer sub-lesional injections.
The bear was started on piroxicam orally at 0.25 mg/kg/
day. Both masses were noted to be slowly regrowing over
the next month and were treated with additional intralesional
carboplatin and laser ablation. For the next 2 years, the original sublingual and lip lesions appeared grossly normal.
Hyperplastic gingiva was noted around the right maxillary
and mandibular canines, and biopsies showed no evidence of
neoplasia.
The following year, routine examination revealed inflammation and persistent gingival hyperplasia around the right
maxillary and mandibular canines. Biopsies revealed chronic
hyperplastic gingivitis and transformation to squamous cell
carcinoma in one of the maxillary specimens. One year later
(6 years after the original diagnosis), the former lip and sublingual lesions were grossly normal. Gingival biopsies revealed
severe gingivitis with mild architectural atypia in 2 of the specimens, but no transformation to squamous cell carcinoma.
Downloaded from vdi.sagepub.com by guest on December 6, 2015
Novel gammaherpesvirus in sun bears
101
Figure 1. Sun bear (Helarctos malayanus); gross pathology of oral lesions. A, case 1: note circumferential swelling of the mucosa around
the tooth due to severe gingivitis, and foci of proliferative and ulcerated mucosa (arrows) adjacent to this region corresponding to dysplasia
and squamous cell carcinoma. Severe dental tartar covers the tooth. B, case 5: advanced stages of gingival squamous cell carcinoma
representing coalescing foci of the tumor.
Three months after the onset of signs in the female, the
male first presented with discharge from the right lower lip
which progressed over 1 month to a noticeably raised and
ulcerated mass. The mass was surgically removed at this
time, and the bear was treated with piroxicam at 0.2 mg/kg
orally once a day. Histologic examination revealed squamous cell carcinoma with neoplastic cells extending to all
margins. Two years later, the tumor had spread; multiple
biopsies of tissue adjacent to the upper right molars and
lower right molars revealed squamous cell carcinoma. The
bear also had gingivitis and periodontitis, as well as radiographic evidence of bilateral bone necrosis and lysis of the
mandibles and left zygomatic arch. Biopsies of the oral
lesions were repeated 6 months later and revealed hyperplasia and gingivitis, but no evidence of tumor in those samples.
A computed topography scan revealed extensive bone
changes in the mandibles and lytic lesions in the left zygomatic arch and along the right side of the palatine bone. Two
years after the initial diagnosis of squamous cell carcinoma,
the bear was euthanized due to head rubbing and a decrease
in appetite attributed to oral pain despite daily piroxicam and
tramadol therapy.
Case 3 was an 8-year-old male sun bear that first presented
for a mass noted on the left lower lip. Upon examination
under anesthesia, 2 friable, well-vascularized masses were
present at the mucocutaneous junction of the left lower lip;
the rostral mass was raised, red, 2.5 cm in diameter, and bled
easily with slight pressure. The distal mass was pale tan, 2 cm
in diameter, and contained a central depression corresponding to the location of occlusion with the left maxillary canine.
Biopsies of the masses revealed squamous cell carcinoma
(Fig. 2). A small, white, proliferative mass was also noted on
the lateral corneal limbus of the right eye at this time.
One month after biopsy, a full thickness wedge resection
of the portion of the lower left lip containing the 2 masses
was performed. The previously described mass on the right
corneal limbus was still present; a similar but smaller mass
was noted at the lateral limbus of the left eye. Vascularization
was also noted on the left cornea at the edge of the mass. A
biopsy of the right ocular mass revealed squamous cell carcinoma. Three months later, the ocular masses were debulked
surgically followed by cryosurgery. Six years following the
initial surgery, a rough, dark pink plaque was noted at midline of the lower lip in a new location relative to the
previously resected squamous cell carcinomas Histologic
examination revealed a squamous cell carcinoma, which was
subsequently surgically removed via wedge resection.
Histologic examination of the wedge revealed that one of the
lateral margins had dysplasia suspicious for a preneoplastic
change. The bear died 16 months later of fungal pneumonia,
with no recurrence of the oral lesions found on gross
necropsy.
Case 4 was a wild-caught, approximately 17-year-old
female sun bear that initially presented for an ill-defined area
of erythema on the left lower lip. The lesion was nonresponsive to antibiotics (a 10-day course of amoxicillin–clavulanic
acid, 14 mg/kg, orally, twice daily), and antihistamines
(hydroxyzine, 1 mg/kg, orally, twice daily). Over the course
of 5 weeks, the appearance of the lesion varied, developing
and resolving areas of ulceration and raised induration. At
the time of resection, 3 lesions were present on the left lower
lip: a patchy area of erythema close to midline; caudal to that
an erythematous, slightly raised, indurated, and ulcerated
round 1.5-cm lesion; and an erythematous, indurated, nonulcerated, 3-mm lesion close to the left commissure. The 3
lesions were surgically resected and submitted for histologic
exam, revealing squamous cell carcinoma. Tissue from the
lesions was also submitted for herpesviral PCR. One month
following resection, the area became erythematous again.
Fifteen months later, another ulcerated lesion developed near
the previous excision site. Excision and biopsy revealed dysplasia. One year later, an area of swelling and ulceration
Downloaded from vdi.sagepub.com by guest on December 6, 2015
102
Lam et al.
Figure 2. Sun bear (Helarctos malayanus); histology of oral lesions. A, case 1: note mucosal hyperplasia and edema, rete pegs, and
submucosal inflammation. Hematoxylin and eosin (HE). Bar = 200 µm. B, case 1: note gingival hyperplasia, rete pegs with dysplasia, and
chronic inflammation. HE. Bar = 200 µm. Inset: higher magnification of dysplastic epithelium in basal and deep granular layers. HE.
Bar = 80 µm. C, case 3: squamous cell carcinoma extending deep into submucosal muscular layers of lip. HE. Bar = 220 µm. D, case 3:
higher magnification of case 3 showing nest of neoplastic epithelium in the muscular tunic of the lip with associated scirrhous response.
HE. Bar = 180 µm.
developed on the right lower lip; surgical resection and
biopsy revealed hyperplasia.
Case 5 was an 18-year-old male initially presenting with
a 2-cm, erythematous, ulcerated, and slightly raised lesion
on the right lower lip. Two centimeters caudal to that lesion,
the mucosa was focally irregular. Biopsies of both lesions
revealed squamous cell carcinoma, which were treated with
laser ablation. One and a half years later, mild erosive lesions
were present in the same area; biopsies revealed hyperplasia
and dysplasia. The lesions showed a waxing and waning
course of severity over the next 4 years, during which time
no treatment was administered. Samples were submitted for
viral PCR testing. One year later, there was marked progression to nodular proliferations and more severe erosions
(Fig. 1). One hundred fifty milligrams of 5-fluorouracil was
administered intralesionally with initial improvement in both
the erythema and swelling. A 6-week course of piroxicam
(0.2 mg/kg, orally, once a day) and L-lysine (11 mg/kg,
orally, twice a day) was instituted, with no change to the
lesions. One hundred milligrams of 5-fluorouracil was
administered intralesionally at 2-week intervals for 3 treatments,
with no noticeable effect. Seven milligrams of cisplatin
was then injected intralesionally every 3–4 weeks for
3 treatments, with minimal to no noticeable effect.
PCR amplification and sequencing
Cases 1–4 were positive for herpesviral DNA. Case 5 was
negative. For cases 1–4, initial nested PCR amplification
resulted in a product of 166 base pairs after primers were
edited out. The sequence obtained from all 4 bears was identical. The modified second round produced a sequence length
of 1,339 bp after primers were edited out. The sequence was
submitted to GenBank under accession number JX220982.
Pan-papillomaviral PCR on cases 1 and 2 was negative.
Phylogenetic analysis
Bayesian phylogenetic analysis found that the Whelan and
Goldman (WAG) model of amino acid substitution was most
probable, with a posterior probability of 1.000, which was
used for ML analysis.32 The Bayesian phylogenetic tree
Downloaded from vdi.sagepub.com by guest on December 6, 2015
Novel gammaherpesvirus in sun bears
103
Figure 3. Bayesian phylogenetic tree of predicted 445-557 amino acid partial herpesviral DNA- dependent DNA polymerase sequences
based on MAFFT alignment. Bayesian posterior probabilities of branchings as percentages are in bold, and maximum likelihood bootstrap
values for branchings based on 1,000 re-samplings are given below. Ursid herpesvirus (HV) 1 is marked by a bold arrow. Psittacid HV2
(GenBank NP944403) was used as the outgroup. Sequences retrieved from GenBank include Alcelaphine HV1 (NP065512), Anatid HV1
(YP003084391), Ateline HV3 (NP047983), Aotine HV1 (YP004940081), Bovine HV1 (NP045328), Bovine HV4 (NP076501), Callitrichine
HV3 (NP733857), Caprine HV2 (AAG13396), Caviid HV2 (YP002321247), Cercopithecine HV5 (YP004936030), Cercopithecine HV9
(NP077443), Crocuta GHV1 (ABI21852), Diceros Bicornis GHV1 (AAP42118), Elephantid HV3 (ABU52899), Equid HV1 (YP053075),
Equid HV2 (NP042605), Equid HV5 (ACY71882), Equus zebra GHV1 (AAS75147), Felid HV1 (YP003331549), Gallid HV1 (YP182359),
Gallid HV2 (YP001033959), Gallid HV3 (NP066862), Hexaprotodon liberiensis GHV1 (AAP42117), Human HV1 (NP044632), Human HV4
(YP401712), Human HV6 (NP050219), Human HV7 (YP073778), Human HV8 (YP001129355), Macacine HV3 (YP068180), Macacine
HV4 (YP068007), Macacine HV5 (NP570750), Murid HV2 (NP064160), Murid HV4 (NP044849), Mustelid HV1 (AAM62282), Ovine
HV2 (YP438136), Papiine HV2 (YP_443877), Pan Troglodytes Rhadinovirus 2 (ABU52897), Panthera leo GHV1 (ABI21851), Procavia
capensis GHV2 (AEA39187), Rodent HV Peru (YP004207849), Rupicapra GHV1 (ABI21850), Saimiri sciureus GHV2 (AAN35123),
Saimiriine HV1 (YP003933809), Saimiriine HV2 (NP040211), Saimiriine HV3 (YP004940227), Sorex araneus GHV1 (ABU52901), Suid
HV1 (YP068333), Tapirus terrestris GHV1 (AAD30142), Tupaia belangeri GHV1 (AAP42119), and Tupaiid HV1 (NP116408).
shows that the sun bear herpesvirus clusters with other
members of the subfamily Gammaherpesvirinae (Fig. 3).
Bootstrap values as percentages from ML analysis are shown
on the Bayesian tree (Fig. 3). Based on naming conventions,
the suggested name of this herpesvirus is Ursid herpesvirus 1
(UrHV-1).
Discussion
Herpesviral infections have been associated with neoplasia
in several species, and the findings described herein are consistent with the clinical signs and lesions seen in other species. Varanid herpesvirus 1, an alphaherpesvirus, was found
in 2 green tree monitors whose lesions developed from an
Downloaded from vdi.sagepub.com by guest on December 6, 2015
104
Lam et al.
initial ulcerative or proliferative gingivitis to marked progressive or recurrent oral squamous cell carcinoma.31
Human herpesvirus 4 (HHV-4), a gammaherpesvirus in
the genus Lymphocryptovirus, causes a variety of malignancies, including epithelial, mesenchymal, and lymphoid
tumors that may be in the oral cavity.28 Such tumors develop
commonly in immunocompromised patients.5 However, the
role of HHV-4 in oral squamous cell carcinomas is controversial, with studies reporting its presence in 0–70% of these
tumors.13 The presence of HHV-4 DNA in oral squamous
cell carcinomas was not associated with positive expression
of transcripts or proteins.6 A possible explanation lies in the
hit-and-run theory,2 which proposes that a virus may trigger
malignant transformation of host cells and no longer be
actively expressed in a tumor. Macacine herpesvirus 4,
another member of Lymphocryptovirus, is associated with
oral squamous proliferative lesions in macaques.4
Human herpesvirus 8 (HHV-8), a gammaherpesvirus in
the genus Rhadinovirus, has been established as a tumor
virus by its presence in human malignancies, the transforming properties of several viral genes in vitro, and its ability to
transform some primary cells in culture, although the full
mechanism of its oncogenesis has not been worked out.10
Among other disease syndromes, HHV-8 causes Kaposi sarcoma, a cancer of lymphatic endothelium. Otariid herpesvirus 1, an unclassified gammaherpesvirus, is strongly
associated with metastatic carcinomas of urogenital origin in
California sea lions.16 Human herpesvirus 5, a betaherpesvirus in the genus Cytomegalovirus, has also been associated
with proliferative gingivitis.15
In people, a notable subset of squamous cell carcinomas
affecting the oropharynx are caused by Human papillomavirus (HPV).11,18 This appears to be a distinct disease entity
from HPV-negative squamous cell carcinoma, which is traditionally associated with the risk factors of alcohol and
tobacco use. Human papillomavirus and HHV-4 co-infections
have been implicated in oral squamous cell carcinomas.28
Samples from the first 2 cases were tested using a consensus
papillomavirus PCR,23 which was negative.
More work needs to be done to demonstrate the etiology
and risk factors for the development of oral squamous cell
carcinomas in sun bears. The role, if any, of UrHV-1 is
unclear. In case 5, tissue from the squamous cell carcinoma
tested negative for UrHV-1. Squamous cell carcinomas can
develop on a background of chronic inflammation caused by
other factors, including excessive solar exposure, and alcohol and/or tobacco use in human beings. The location of
these tumors inside the oral cavity makes a link to solar
exposure unlikely. One bear also had bilateral squamous cell
carcinomas at the lateral corneal limbus, a location with
more solar exposure. The lesions demonstrated chronic but
nonspecific inflammation, which could have been induced
by solar exposure or viral infection.
In situ hybridization would be required to demonstrate
the presence of the virus within the nuclei of cancer cells.
Real-time PCR might be used to investigate a difference in
viral load between cancer cells and unaffected tissue from
the same animal.
All 5 bears in the case series had a history of periodontal
disease. The most common clinical signs, present in all 5
bears, were moderate to severe dental calculus accumulation
with associated gingivitis. Three bears had signs consistent
with periodontitis, including gingival recession and formation
of periodontal pockets. Two bears required dental extractions
due to the severity of periodontitis, and one of these additionally had severe and extensive osteolysis of the mandible.
In humans, a causal link between herpesvirus infection
and destructive periodontal disease has been proposed, on
the basis that active infection causes immunosuppression
and subsequent proliferation of periodontopathic bacteria.27
The causal relationship between herpesvirus infection, periodontal disease, and squamous cell carcinoma development
has yet to be elucidated.
One sun bear in the current study had a previous history
of apparent stereotypic behavior of rubbing his lip with his
claws; it is unclear if this behavior may have predated the
development of the lesions or been in response to it. It is possible that the chronic trauma may have predisposed to squamous cell carcinoma.
The tumors described in the present study all had similar
behavior and appear to represent a single clinical entity. The
tumors are locally invasive though slow growing; complete
excision appears difficult due to the long range of transition
between normal tissue and cancerous cells. Recurrence at
the same site is common, as well as local extension. Distant
metastases have not been reported, though 1 bear presented
with ocular as well as oral squamous cell carcinoma. Based
on the findings, wide surgical margins are recommended;
adjunctive local therapies such as radiation are recommended in dogs where surgical margins were incomplete,12
and have been used in sun bears20 including bears of the
current study, one of which is in remission at the time of this
report. In addition to the previously reported case and the 5
cases reported herein, between May 1995 and November
2008 there were 6 cases of sun bears with oral or nasal squamous cell carcinoma examined by one of the coauthors
(MM Garner) suggesting that this is not an uncommon disease entity among captive sun bears. The herpesviral status
of those sun bears is unknown.
Phylogenetic analysis demonstrated that UrHV1 has a
relatively basal divergence within the subfamily Gammaher­
pesvirinae, without clear support for clustering within any of
the known genera. Prior to 2009, Gammaherpesvirinae was
divided into 2 genera, Lymphocryptovirus and Rhadinovirus.
Macavirus and Percavirus were subsequently recognized as
monophyletic clades within Rhadinovirus and split out into
new genera.7 Rhadinovirus contains the remaining viruses
from the old genus and appears to be paraphyletic.
In this analysis, the Bayesian phylogenetic tree for
subfamily Alphaherpesvirinae was not consistent with
Downloaded from vdi.sagepub.com by guest on December 6, 2015
Novel gammaherpesvirus in sun bears
established trees generated from other data sets,19 nor with
the maximum likelihood alignment, wherein Gallid herpes­
virus 1 and Psittacid herpesvirus 1 (used as the outgroup)
represent a basal divergence among the alphaherpesviruses.
Because the focus of the current study was a gammaherpesvirus, attempts were not made to resolve this discrepancy.
The lack of support for the clustering is demonstrated by ML
bootstrap values of less than 50%.
In conclusion, squamous cell carcinoma should be an
important consideration in a clinical setting when a sun bear
presents for oral lesions including erythematous macules,
ulcers, or plaques, particularly if nonresponsive to treatment
or if recurrent. A novel gammaherpesvirus, Ursid herpesvirus 1, was identified in 4 sun bears with oral squamous cell
carcinoma. The prevalence of this virus in the captive and/or
wild sun bear populations, as well as its pathogenicity and
relationship to squamous cell carcinoma, is unknown and
warrants further investigation.
Sources and manufacturers
a. DNeasy kit, Qiagen Inc., Valencia, CA.
b. QIAquick gel extraction kit, Qiagen Inc., Valencia, CA.
c. BigDye terminator kit, Applied Biosystems, Foster City, CA.
d. ABI 3130 automated DNA sequencer, Applied Biosystems,
Foster City, CA.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with
respect to the research, authorship, and/or publication of this
article.
Funding
The author(s) received no financial support for the research,
authorship, and/or publication of this article.
References
1. Altschul SF, Madden TL, Schäffer AA, et al.: 1997, Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402.
2. Atula S, Auvinen E, Grenman R, Syrjänen S: 1997, Human
papillomavirus and Epstein–Barr virus in epithelial carcinomas
of the head and neck region. Anticancer Res 17:4427–4433.
3. Banks M, Torraca LS, Greenwood AG, Taylor DC: 1999,
Aujeszky’s disease in captive bears. Vet Rec 145:362–365.
4. Baskin GB, Roberts ED, Kuebler D, et al.: 1995, Squamous
epithelial proliferative lesions associated with rhesus EpsteinBarr virus in simian immunodeficiency virus-infected rhesus
monkeys. J Infect Dis 172:535–539.
5. Cesarman E: 2011, Gammaherpesvirus and lymphoproliferative disorders in immunocompromised patients. Cancer Lett
305:163–174.
6. Cruz I, Van Den Brule AJ, Brink AA, et al.: 2000, No direct
role for Epstein-Barr virus in oral carcinogenesis: a study at
the DNA, RNA and protein levels. Int J Cancer 86:356–361.
105
7. Davison AJ, Eberle R, Ehlers B, et al.: 2009, The order Herpesvirales. Arch Virol 154:171–177.
8. Donovan T, Schrenzel M, Tucker T, et al.: 2009, Meningoencephalitis in a polar bear caused by equine herpesvirus 9
(EHV-9). Vet Pathol 46:1138–1143.
9. Felsenstein J: 1985, Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39:783–791.
10. Fukumoto H, Kanno T, Hasegawa H, Katano H: 2011, Pathology of Kaposi’s sarcoma-associated herpesvirus infection.
Front Microbiol 2:175.
11. Gillison ML, Koch WM, Capone RB, et al.: 2000, Evidence for
a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst 92:709–720.
12. Grier CK, Mayer MN: 2007, Radiation therapy of canine nontonsillar squamous cell carcinoma. Can Vet J 48:1189–1191.
13. Hermann RM, Füzesi L, Pradier O, et al.: 2004, Presence of
human papillomavirus-18 and Epstein–Barr virus in a squamous cell carcinoma of the tongue in a 20-year-old patient.
Case report and review of the current literature. Cancer Radiother 8:262–265.
14. Katoh K, Toh H: 2008, Recent developments in the MAFFT
multiple sequence alignment program. Brief Bioinform 9:
286–298.
15. Kaur J, Singh P, Levine D: 2003, Cytomegalovirus-induced
gingival hyperplasia. Clin Infect Dis 37:e44–46.
16. Lipscomb TP, Scott DP, Garber RL, et al.: 2000, Common
metastatic carcinoma of California sea lions (Zalophus cali­
fornianus): evidence of genital origin and association with
novel gammaherpesvirus. Vet Pathol 37:609–617.
17. Maness HT, Nollens HH, Jensen ED, et al.: 2011, Phylogenetic analysis of marine mammal herpesviruses. Vet Microbiol 149:23–29.
18. McDougall JK: 1994, Immortalization and transformation of
human cells by human papillomavirus. Curr Top Microbiol
Immunol 186:101–119.
19. McGeoch DJ, Rixon FJ, Davison AJ: 2006, Topics in herpesvirus genomics and evolution. Virus Res 117:90–104.
20. Mylniczenko ND, Manharth AL, Clayton LA, et al.: 2005,
Successful treatment of mandibular squamous cell carcinoma
in a Malayan sun bear (Helarctos malayanus). J Zoo Wildl
Med 36:346–348.
21. Pellet P, Roizman B: 2007, The family Herpesviridae: a
brief introduction. In: Fields’ virology, ed. Knipe D, Howley P,
5th ed., pp. 2479–2499. Lippincott Williams & Wilkins,
Philadelphia, PA.
22. Ramsay E: 2003, Ursidae and Hyaenidae. In: Zoo and wild animal medicine, ed. Fowler ME, Miller RE, 5th ed., pp. 523–534.
Saunders, St. Louis, MO.
23. Rector A, Van Doorslaer K, Bertelsen M, et al.: 2005, Isolation and cloning of the raccoon (Procyon lotor) papillomavirus
type 1 by using degenerate papillomavirus-specific primers.
J Gen Virol 86:2029–2033.
24. Ronquist F, Huelsenbeck JP: 2003, MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics
19:1572–1574.
Downloaded from vdi.sagepub.com by guest on December 6, 2015
106
Lam et al.
25. Schultze AE, Maes RK, Taylor DC: 1986, Pseudorabies
and volvulus in a black bear. J Am Vet Med Assoc 189:
1165–1166.
26. Shepherd CR, Shepherd LA: 2010, The poaching and trade
of Malayan sun bears in Peninsular Malaysia. Traffic Bulletin
23:49–52.
27. Slots J: 2005, Herpesviruses in periodontal diseases. Periodontol 2000 38:33–62.
28. Slots J, Saygun I, Sabeti M, Kubar A: 2006, Epstein-Barr virus
in oral diseases. J Periodontal Res 41:235–244.
29. Stamatakis A, Hoover P, Rougemont J: 2008, A rapid bootstrap algorithm for the RAxML Web servers. Syst Biol 57:
758–771.
30. VanDevanter D, Warrener P, Bennett L, et al.: 1996, Detection and analysis of diverse herpesviral species by consensus
primer PCR. J Clin Microbiol 34:1666–1671.
31. Wellehan JF, Johnson AJ, Latimer KS, et al.: 2005, Varanid
herpesvirus 1: a novel herpesvirus associated with proliferative stomatitis in green tree monitors (Varanus prasinus). Vet
Microbiol 105:83–92.
32. Whelan S, Goldman N: 2001, A general empirical model of
protein evolution derived from multiple protein families using
a maximum-likelihood approach. Mol Biol Evol 18:691–699.
33. Zanin E, Capua I, Casaccia C, et al.: 1997, Isolation and characterization of Aujeszky’s disease virus in captive brown
bears from Italy. J Wildl Dis 33:632–634.
Downloaded from vdi.sagepub.com by guest on December 6, 2015