SF-1 (Steroidogenic Factor-1) and
C/EBPb (CCAAT/Enhancer Binding
Protein-b) Cooperate to Regulate
the Murine StAR (Steroidogenic
Acute Regulatory) Promoter
Adam J. Reinhart, Simon C. Williams, Barbara J. Clark, and
Douglas M. Stocco
Department of Cell Biology and Biochemistry (A.J.R., S.C.W.,
D.M.S.) and
Southwest Cancer Center (S.C.W.)
Texas Tech University Health Science Center
Lubbock, Texas 79430
Department of Biochemistry
University of Louisville School of Medicine (B.J.C)
Louisville, Kentucky 40292
The steroidogenic acute regulatory (StAR) protein
mediates the rate-limiting step of steroidogenesis,
which is the transfer of cholesterol to the inner
mitochondrial membrane. In steroidogenic tissues,
StAR expression is acutely regulated by trophic
hormones through a cAMP second messenger
pathway, leading to increased StAR mRNA levels
within 30 min, reaching maximal levels after 4–6 h
of stimulation. The molecular mechanisms underlying such regulation remain unknown. We have
examined the StAR promoter for putative transcription factor-binding sites that may regulate
transcription in a developmental and/or hormoneinduced context. Through sequence analysis, deoxyribonuclease I (DNAse I) footprinting and electrophoretic mobility shift assays (EMSAs), we have
identified two putative CCAAT/enhancer binding
protein (C/EBP) DNA elements at 2113 (C1) and
287 (C2) in the mouse StAR promoter. Characterization of these sites by EMSA indicated that
C/EBPb bound with high affinity to C1 and C2 was
a low-affinity C/EBP site. Functional analysis of
these sites in the murine StAR promoter showed
that mutation of one or both of these binding sites
decreases both basal and (Bu)2cAMP-stimulated
StAR promoter activity in MA-10 Leydig tumor
cells, without affecting the fold activation
[(Bu)2cAMP-stimulated/basal] of the promoter.
Furthermore, we have demonstrated that these
two C/EBP binding sites are required for steroidogenic factor-1 (SF-1)-dependent transactivation of
the StAR promoter in a nonsteroidogenic cell line.
These data indicate that in addition to SF-1,
C/EBPb is involved in the transcriptional regulation
of the StAR gene and may play an important role in
developmental and hormone-responsive regulation of steroidogenesis. (Molecular Endocrinology
13: 729–741, 1999)
INTRODUCTION
The rate-limiting step of steroidogenesis is the delivery
of cholesterol from cellular stores to the inner mitochondrial membrane, where it is converted to
pregnenolone by the cytochrome P450 side-chain
cleavage enzyme (P450scc; Refs. 1 and 2). The steroidogenic acute regulatory (StAR) protein mediates this
transfer of cholesterol to the inner mitochondrial membrane and thus, is required for this regulatory step
(reviewed in Refs. 3–6). Expression of the StAR protein
is rapidly stimulated in steroidogenic tissues in response to trophic hormone through a cAMP second
messenger pathway (7, 8). At the level of StAR gene
transcription, it has been reported that an increase in
mRNA levels is detectable within 30 min after stimulation of MA-10 cells with (Bu)2cAMP (9). It has also
been reported that the initial cAMP-stimulated induction of StAR mRNA does not require de novo protein
synthesis (10). Therefore, the complement of transcription factors required to confer hormone-responsive activation of the StAR promoter must be present
before stimulation. In addition, posttranslational modification of one or more transcription factors in response to cAMP stimulation may play a critical role in
the activation of this promoter.
0888-8809/99/$3.00/0
Molecular Endocrinology
Copyright © 1999 by The Endocrine Society
729
MOL ENDO · 1999
730
Recently it has been suggested that steroidogenic
factor-1 (SF-1), an orphan nuclear receptor, may play
important roles in the regulation of StAR transcription
(10–14). SF-1 has been shown to play a role in the
transcriptional regulation of many genes involved in
steroidogenesis, including steroid hydroxylase genes
(15–17), as well as LHb (18), the ACTH receptor (19),
and the GnRH receptor (20). SF-1 null mice have also
revealed a role for SF-1 in the development of the
gonads and adrenal glands (11, 21). Combined, these
reports suggest an important role for SF-1 in the regulation of steroidogenesis at a number of levels. However, there are many lines of evidence suggesting that
SF-1, although important for StAR transcription, may
not be a key transcription factor in the acute regulation
of the StAR gene in response to cAMP stimulation. For
example, transfection studies in nonsteroidogenic cell
lines have shown that SF-1 is capable of transactivating a StAR reporter (13, 14). Yet, when multiple SF-1binding sites were mutated in the mouse StAR promoter and analyzed in MA-10 cells, the cAMP
responsiveness (fold activation) from the promoter
was not disrupted (10). These data indicate that SF-1
is required for proper activation of the StAR promoter
but may not confer cAMP responsiveness in steroidogenic cells. These findings have led us to examine
other transcription factors, whose activity is acutely
regulated in response to trophic hormone in steroidogenic tissues, for their involvement in the transcriptional regulation of the StAR gene.
Recent studies in our laboratory have suggested
that the CCAAT/enhancer binding protein (C/EBP)
family of basic leucine zipper transcription factors may
be involved in the regulation of steroidogenesis in
Leydig cells. Thus far, six members of the C/EBP
family have been identified: C/EBPa, C/EBPb,
C/EBPd, C/EBPe, C/EBPg (Ig/EBP), and C/EBPz
(CHOP; Ref. 22). C/EBPb is the only member of the
C/EBP family expressed in unstimulated primary Leydig cell cultures and MA-10 cells (A. J. Reinhart, D.
Nalbant, S. C. Williams, and D. M. Stocco, unpublished observation) and C/EBPb levels increase in
MA-10 cells by 4.5-fold upon 4 h treatment with 1 mM
(Bu)2cAMP (23). It has also been shown that C/EBPb
activity can be altered, presumably by protein kinase A
(PKA), upon treatment with cAMP analogs (24–27).
Therefore, C/EBPb was examined as a candidate transcription factor in the transcriptional regulation of the
StAR gene.
In the present study, we examined the StAR promoter for potential binding sites for transcription factors that may be involved in the regulation of StAR
transcription. Two putative C/EBP response elements
were identified; one of these sites was shown to bind
to C/EBPb, and we determined that the other site was
a low-affinity protein-binding site. Functional analysis
revealed that mutation of these sites decreased basal
and cAMP-stimulated activity from the StAR promoter
in MA-10 cells. Furthermore, we report that SF-1-dependent transactivation of the StAR promoter in
Vol 13 No. 5
COS-1 cells required these putative C/EBP response
elements, suggesting that C/EBPb and SF-1 may interact to regulate StAR gene transcription.
RESULTS
Characterization of the C/EBP-Binding Sites
within the Mouse StAR Promoter
Previous studies have established that the elements
required to confer cAMP responsiveness to the mouse
StAR gene are contained within the first 254 bp of the
promoter (10). Therefore, we examined this promoter
region from mouse (10), rat (28), human (14), ovine
(J. L. Juengel and G. D. Niswender, personal communication) and porcine (29), to identify protein-binding
sites that might mediate this response. The 59-flanking
regions of the StAR gene from these five species were
aligned (Fig. 1A) and revealed that the greatest degree
of sequence similarity was found within 120 bases of
the transcription start site. Previously identified elements in this region included a TATA box at nucleotide
235 (all coordinates are relative to the transcriptional
start site in mouse at 11) and three SF-1-binding sites
corresponding to 242, 291, and 2135 in the mouse
sequence (10, 12, 14, 28). Several additional blocks of
homology were revealed by these analyses. Two of
these (named C1 and C2) displayed significant homology to the consensus binding site for members of the
CCAAT/enhancer binding site family of transcription
factors (ATTGCGCAAT; Ref. 22). Naturally occurring
C/EBP sites generally exhibit divergence from this
consensus sequence, but typically retain one well conserved half-site (22). The C1 site is centered at 2113
and contains one perfect half-site (GCAAT) and an
overall 7 of 10 match to the consensus sequence (Fig.
1B). The C1 site is almost completely conserved in all
species (9 of 10 matches). The second potential
C/EBP site (C2) also displays 7 of 10 matches to the
consensus sequence in mouse (Fig. 1B) and contains
an almost perfect half-site (ACAAT). However, this sequence is only partially conserved in the five species
shown here (Fig. 1A).
The sequence alignment in Fig. 1A revealed the
presence of two additional well conserved sequence
elements that have not yet been characterized (Fig.
1A, boxed regions A and B). The first is a 10-bp element centered at 263 of the mouse promoter, which
resembles a binding site for members of the GATA
family of transcription factors. Although GATA-4 and a
testis-specific version of GATA-1 are expressed in
testis and MA-10 Leydig cells, it is not clear whether
they are involved in regulating the StAR gene (30, 31).
The second putative element is a perfectly conserved
6-bp sequence (TGATGA) centered at 253 of the
mouse promoter, which does not match the binding
site of known transcription factors in the transfac matrix table (release 3.2) when searched using TFSEARCH (version 1.3) (© 1995 Yutaka Akiyama, Kyoto
Regulation of the StAR Promoter by C/EBPb
731
Fig. 1. Identification of Two Putative C/EBP-Binding Sites in the StAR Promoter
A, The sequences of the 59-flanking regions of the mouse (M), rat (R), ovine (O), porcine (P), and human (H) StAR genes were
aligned using the ClustalW (K. C. Worley, Human Genome Center, Baylor College of Medicine, Houston, TX) sequence alignment
program, and identical bases in all five sequences are indicated with asterisks. Binding sites for SF-1 are shaded and labeled. Two
putative C/EBP-binding sites were identified based on their similarity to the consensus C/EBP-binding site and are shaded and
labeled. Other highly conserved sequences discussed in the text are boxed and labeled A and B. B, The two putative
C/EBP-binding sites from the mouse promoter were compared with the consensus C/EBP-binding site determined by binding site
selection (26). Sequence identities are indicated with vertical bars between the sequences. Both C1 and C2 share seven bases
with the consensus site.
University, Kyoto, Japan). Further analyses are clearly
required to address the possible roles of these elements in regulating StAR gene expression.
DNAse I footprint analysis of the mouse StAR promoter from 266 to 2254 was performed to identify
possible transcription factor-binding sites in this region. A schematic diagram of the radioactive probe
used in the footprint analysis is presented in Fig. 2A.
Addition of 25 and 50 mg of nuclear extract prepared
from (Bu)2cAMP-stimulated MA-10 cells revealed a
broad region of protection interspersed with two
DNAse I-hypersensitive sites, indicated by arrows (Fig.
2B). The protected regions included the C1 site and
the SF-1 element at 2135 and are marked by vertical
bars adjacent to the sequence (Fig. 2B).
We next performed electrophoretic mobility shift assays (EMSAs) to identify proteins in Leydig cells that
bind the C1 and C2 sites. Radioactively labeled oligo-
MOL ENDO · 1999
732
Vol 13 No. 5
Fig. 2. DNAse I Footprint Analysis of the StAR Promoter Revealed a Protected Region Encompassing the Putative C/EBP Site
at 2113
A double-stranded probe corresponding to the coding strand of the StAR promoter spanning 2254 to 266 was radiolabeled
and used in DNAse I footprinting assays to detect regions of the StAR promoter that were protected from DNAse I digestion by
the presence of proteins bound to the promoter. A, Schematic representation of the StAR promoter from 2254 to 266 indicating
the SF-1, C1, and C2 elements. The line depicts the DNAse I-protected region that is flanked by the hypersensitive sites. B,
Radiolabeled probe was incubated for 30 min in the absence (2) or presence of 25 mg or 50 mg of nuclear extract purified from
(Bu)2cAMP-treated MA-10 cells and then DNAse I treatment was for 15 or 30 sec as indicated. The arrows indicate the
hypersensitive sites, and the vertical lines indicate the protected regions. The StAR promoter sequence is shown on the left with
the vertical lines again indicating the protected regions. The GCAAT sequence is within the protected regions, and the C1 site
used for EMSA spans 2124 to 2101. The SF-1 element at 2135, CCACCTTGG, is shown in the sequence within a protected
region. The C2 region begins at 295 and continues to the undigested probe. Four separate DNAse I footprint analyses have
qualitatively shown the same results: the presence of two hypersensitive sites and protection of the C1 region. The lowercase c
indicates a base change in the sequence due to the engineered BglII site.
Regulation of the StAR Promoter by C/EBPb
nucleotides containing the C1 or C2 binding sites were
incubated with nuclear extracts prepared from resting
and (Bu)2cAMP-stimulated MA-10 cells. Protein-DNA
complexes with similar mobilities were formed on both
the C1 and C2 oligonucleotides, although complex
formation occurred more efficiently on the C1 oligonucleotide (Fig. 3). Competition binding studies were
carried out to determine whether the protein-DNA
complexes represented specific interactions and
whether the proteins binding to both sites were related
(Fig. 3). Addition of 100-fold molar excess of unlabeled
C1 oligonucleotide abolished formation of the protein-C1 complex (Fig. 3, lane 2). However, addition of
a similar amount of a related oligonucleotide (C1m;
Fig. 3, lane 3), in which residues within the predicted
C/EBP recognition sequence had been mutated, failed
to prevent complex formation, indicating that proteins
were specifically binding to the potential C/EBP motif.
Cross-competition assays were also performed using
the C1 and C2 oligonucleotides. Unlabeled C1
733
blocked complex formation on the C2 oligonucleotide
(Fig. 3, lane 7), whereas C1m did not (Fig. 3, lane 8),
suggesting that proteins with similar DNA recognition
specificities bound these two sites. The unlabeled C2
oligonucleotide was incapable of competing for complex formation with the C1 or the C2 oligonucleotide
(Fig. 3, lanes 4 and 9), probably reflecting the apparent
greater protein-binding affinity of the C1 oligonucleotide as compared with C2. Collectively, these data
indicate that the C1 and C2 motifs appear to be binding sites for identical or related proteins in MA-10
nuclear extracts.
Having established that the C1 site binds with high
affinity to proteins present in nuclear extracts from
stimulated MA-10 cells, we next sought to determine
whether C/EBPb binds to C1, and whether this binding
was regulated by (Bu)2cAMP stimulation of the cells.
Supershift experiments were performed using an antiserum raised against the amino terminus of C/EBPb
(32). Initially recombinant C/EBPb was produced in
Fig. 3. The Putative C/EBP-Binding Sites Form Complexes with Proteins Expressed in MA-10 Nuclear Extracts
Five micrograms of protein prepared from nuclear extracts of MA-10 cells stimulated for 6 h with (Bu)2cAMP were incubated
with 32P-labeled probes representing the putative C/EBP sites at 2113 (C1) or 287 (C2) in the presence or absence of 100-fold
molar excess of unlabeled competitor oligonucleotides. The competitor oligonucleotides were either the unlabeled wild-type
C/EBP binding sites (C1, C2) or mutant versions of these sites (C1m, C2m). DNA-protein complexes were subjected to
electrophoresis through a 4% nondenaturing polyacrylamide gel, and then dried gels were visualized by phosphoimagery and
autoradiography. The inset at the bottom of the gel is a phosphoimage of the region of the gel maked with an asterisk, which
shows binding to the C2 oligonucleotide.
MOL ENDO · 1999
734
rabbit reticulocyte lysates and incubated with radiolabeled C1 oligonucleotide in the absence and presence
of the C/EBPb antiserum. A specific DNA-protein
complex was formed when the C1 probe was mixed
with recombinant C/EBPb that was absent in unprogrammed lysates (compare Fig. 4, lanes 1 and 2). This
complex was completely supershifted by the C/EBPb
antiserum (lane 3). Nuclear extracts prepared from
both (Bu)2cAMP-stimulated and unstimulated MA-10
cells formed complexes with the C1 probe, and further
incubation with the C/EBPb antiserum resulted in a
supershifted complex in both extracts (Fig. 4, lanes 5
and 7). The intensity of this complex was relatively
unaffected by (Bu)2cAMP stimulation (Fig. 4, compare
lanes 4–5 with 6–7 and 8–9 with 10–11), suggesting
that there are proteins other than C/EBPb in these
complexes, whose levels are not altered by
(Bu)2cAMP-stimulation, that may be rate-limiting in the
formation of the complex. The major shifted complex
Vol 13 No. 5
in MA-10 nuclear extracts could be resolved into three
distinct bands (Fig. 4, right panel, labeled a, b, and c),
and the supershifted complex appeared to be derived
primarily from the middle band. Multiple C/EBP-like
binding activities have been observed in nuclear extracts from many cell types, which are unaffected by
addition of currently available antisera directed against
known C/EBP family members. These complexes may
represent unrelated proteins with DNA-binding specificities similar to C/EBP, or heterodimeric or posttranslationally modified complexes that are not recognized by C/EBP antisera. The C/EBPb-C1 complex
(band b), which contributes to the supershifted band
does not migrate with the complex formed with recombinant C/EBPb, indicating that C/EBPb may exist
in a heterodimeric form in MA-10 cells. At present, the
putative partner(s) for C/EBPb are unknown.
Since C/EBPa and C/EBPb share binding site preferences (22, 33), and have both been shown to be
Fig. 4. C/EBPb Binds to the C1 Site
In vitro transcribed and translated C/EBPb or 5 mg of protein isolated from nuclear extracts prepared from unstimulated or
(Bu)2cAMP-stimulated MA-10 cells were incubated with a 32P-labeled C1 oligonucleotide and then incubated in the presence or
absence of 1 ml of a C/EBPb-specific antiserum. DNA-protein complexes were subjected to electrophoresis through a 4%
nondenaturing polyacrylamide gel for approximently 2 h at 200 V, and then dried gels were visualized by autoradiography. SS
indicates the position of the supershifted band. The right panel is a example of a 4% nondenaturing polyacrylamide gel that was
run for 1.5 h at 200 V and was exposed to x-ray film for less time than the example in (a) to achieve a higher resolution of the bands,
which shows that three bands, labeled a, b and c, resolve in the major shifted complex.
Regulation of the StAR Promoter by C/EBPb
expressed in reproductive tissues (34, 35), we examined their expression in MA-10 cells. By Western analysis, we have determined that C/EBPb, but not
C/EBPa, could be detected in MA-10 cells, and that
MA-10 nuclear extracts did not contain C/EBPa-binding activity as evidenced by EMSA using the C1 oligo
(data not shown).
C/EBP DNA Elements Are Required for Activation
of the StAR Promoter
To assess the role of the C1 and C2 sites in StAR
promoter function, we compared the activity in MA-10
cells of the wild-type StAR promoter to mutants carrying changes in either or both of these sites. The
mutations were tested in the context of a 966-bp fragment of the StAR gene that had previously been
shown to support basal and cAMP-inducible expression in MA-10 cells (10). The same mutations in the C1
and C2 sites used in the EMSAs were introduced into
the StAR promoter either alone or in combination.
Each construct was transfected into MA-10 cells, and
luciferase activities were measured in untreated cells
and cells incubated in the presence of (Bu)2cAMP for
6 h. The wild-type promoter construct (2966 StAR
Luc) displayed low basal activity, which was stimulated 6.2-fold by (Bu)2cAMP (Fig. 5). Mutation of either
the C1 or C2 site alone (2966 StAR C1m and 2966
735
StAR C2m) resulted in significantly lower basal activities, 20% and 15% of the wild-type value, respectively. Mutation of both the C1 and C2 sites (2966
StAR C1m, C2m) resulted in a further decrease in
basal promoter activity to 10% of the wild-type activity; however, the cAMP responsiveness of the promoter was again relatively unchanged (Fig. 5). Although the absolute cAMP-induced activities of the
mutated reporters was lower than the wild-type promoter, the fold activation of all four reporters was
similar. These data indicate that the C1 and C2 sites
are important for high-level basal expression from the
StAR promoter.
SF-1 Requires C/EBP DNA Elements to Activate
the StAR Promoter
To better understand the role of C/EBPb in StAR gene
transcription, we conducted transactivation experiments in COS-1 cells, a nonsteroidogenic cell line that
does not express C/EBPb (S. C. Williams, unpublished
observation), or SF-1 (14). C/EBPb and SF-1 expression vectors were cotransfected, either alone or in
combination, with the wild-type and mutant promoter
constructs mentioned above. StAR promoter activity
was stimulated approximately 2-fold by C/EBPb, and
this effect was lost or diminished when either the C1 or
C2 sites were mutated (Fig. 6; p-966 StAR C1m and
Fig. 5. C/EBP DNA Elements Are Required for Activation of the StAR Promoter in MA-10 Cells
MA-10 cells were transfected with 2 mg of either StAR 2966, StAR 2966C1m, StAR 2966C2m, or StAR 2966C1m,2 m, and
then reporter activity was measured from (Bu)2cAMP-stimulated or unstimulated cells. In all cases, 75 ng of pRL-SV40 were also
transfected as a control for transfection efficiency. Data are represented as reporter activity divided by the activity of SV40-RNU.
Fold activation represents the (Bu)2cAMP-stimulated reporter activity divided by the unstimulated level. Data represent averages 6 SEM from three experiments including the StAR 2966C1m,2 m reporter, and two additional experiments not including the
StAR 2966C1m,2 m reporter, all of which were normalized to the activity of the StAR 2966 reporter from unstimulated cells in
each experiment. Statistical analysis between control (StAR 2966) and mutant reporters revealed some significant differences as
determined by Student’s unpaired two-tailed t tests (#, P , 0.05 between unstimulated reporters; *, P , .05 between
(Bu)2cAMP-stimulated reporters).
MOL ENDO · 1999
736
Vol 13 No. 5
Fig. 6. C/EBP Sites Are Required for SF-1 to Transcativate the StAR Promoter
COS-1 cells were transfected with 2 mg of either StAR 2966, StAR 2966C1m, StAR 2966C2m, or StAR 2966C1m,2 m, and
cotransfected with 2 mg of either or both C/EBPb or SF-1 expression plasmids, and reporter activity was measured. Data
represent averages 6 SEM from three experiments that were normalized to the activity of StAR 2966 reporter alone. All values
were compared with the p-966 StAR Luc reporter cotransfected with the control vector by Student’s one-tailed unpaired t test
(*, P , 0.05).
C2m). A StAR promoter construct carrying mutations
in both sites (p-966 StAR C1m,C2m) was completely
unresponsive to C/EBPb. SF-1 stimulated StAR promoter activity approximately 5-fold; however, mutating the C1 site, and especially the C2 site, diminished
this activity (Fig. 6). In fact, the promoter construct
bearing mutations in the C2 site was totally unresponsive to SF-1, despite the fact that the predicted SF-1
sites in this promoter remain intact. Coexpression of
C/EBPb and SF-1 did not result in additive or synergistic activation of the StAR promoter (Fig. 6). This
observation may be due to the high levels of both
C/EBPb and SF-1 protein in the transiently transfected
cells, resulting in squelching or titration of required
cofactors, leading to a decrease in reporter activity.
These data indicate that C/EBPb can stimulate the
activity of the StAR promoter and that efficient SF-1dependent activation of this promoter requires intact
C1 and C2 sites.
Fig. 7. SF-1 and C/EBPb Physically Interact in Vitro
Bacterially expressed GST-SF-1 or GST was incubated
with radiolabeled recombinant C/EBPb in the presence of a
fragment of the StAR promoter spanning 25 to 2158. Proteins were reversibly cross-linked and purified using glutathione-agarose beads and then subjected to SDS-PAGE.
C/EBPb and SF-1 Physically Interact in Vitro
The data presented above indicate a functional interaction between SF-1 and proteins binding to the C1
and C2 sites. Due to the close proximity of SF-1 and
putative C/EBPb binding sites, we next examined
whether these proteins might physically associate.
Bacterially expressed glutathione S-transferase (GST)
or a chimeric GST-SF-1 protein was mixed with radiolabeled recombinant C/EBPb in the presence of a
portion of the StAR promoter (25 to 2158) and a
reversible protein cross-linking agent. After purification on glutathione-agarose beads, the remaining pro-
teins were resolved by SDS-PAGE (Fig. 7). Recombinant C/EBPb was specifically retained by GST-SF-1,
indicating that SF-1 and C/EBPb are likely to physically associate, and that this association may be necessary for efficient activation of the StAR promoter.
DISCUSSION
The promoter regions of eukaryotic genes are generally composed of multiple binding sites for transcrip-
Regulation of the StAR Promoter by C/EBPb
tional activators and repressors that act in combination to regulate expression of a linked gene (36–38).
Comparison of the 59-flanking sequence of the StAR
gene revealed the existence of several blocks of conserved sequences within 120 bp of the transcription
start site. Previous analyses had revealed the existence of binding sites for the orphan receptor, SF-1,
and a variant TATA-like element located 25–30 bp
from the start site. We report here the identification of
two novel elements required for high-level expression
from the StAR promoter in Leydig cells.
The upstream element, C1, is strongly bound by
recombinant C/EBPb and by C/EBPb in MA-10 nuclear extracts and appears to be the primary site
through which C/EBPb activates the StAR promoter.
We have considered two putative, nonexclusive functions for C/EBPb in StAR gene regulation, namely, the
activation of StAR gene expression during development and the rapid activation of StAR transcription in
response to trophic hormone. The observation that
mutation of the C1 site did not abolish cAMP induction
(fold activation) of the StAR promoter suggests that
either C/EBPb does not mediate the cAMP-dependent
regulation of StAR gene expression, at least during the
acute phase of stimulation, or (Bu)2cAMP stimulation
of Leydig cells does not completely mimic all of the
effects of hormone stimulation. However, mutating the
C1 site decreased basal level activity from the StAR
promoter to 20% of the wild-type level. This finding,
combined with our previous observation that both
C/EBPb and StAR protein levels increase during Leydig cell development (23), indicates a role for C/EBPb
in developmental regulation of StAR gene expression.
In support of a broad role of C/EBPb in the developmental regulation of steroidogenesis, analysis of the
promoter regions of genes encoding steroidogenic enzymes in Leydig cells, such as 3b-hydroxysteroid dehydrogenase (3bHSD), cytochrome P450 side-chain
cleavage (P450scc), and 17,a-hydroxylase (CYP17),
has revealed the presence of putative C/EBP sites (our
unpublished observation), although functional studies
of these sites are lacking at present. Therefore,
C/EBPb may participate in the regulation of multiple
Leydig cell genes during development.
Our mutational analysis also identified a second element (C2) that is required for high-basal level expression of the StAR promoter. Although the C2 site is not
as highly conserved as the C1 site, it appears to be at
least equally important for StAR gene transcription as
its mutation decreased promoter activity to 15% of
wild-type levels. We initially considered the C2 site to
be a binding site for C/EBPb based on the presence of
an almost perfect half-site in the mouse, porcine, and
human genes, and a 7 of 10 match to the consensus
C/EBP binding site in the mouse gene. However, the
C2 site complexed weakly with nuclear extract from
MA-10 cells and was unable to compete for C/EBP
binding to the C1 element. In addition, mutation of the
C2 site in the StAR promoter had only a slight negative
effect on transactivation by C/EBPb in COS-1 cells.
737
These data could be interpreted in two ways. First, the
C2 site may not be a bona fide C/EBPb binding site in
vivo, instead serving as the binding site for another, as
yet unidentified, protein. Some candidate proteins
might be members of the CCAAT box-binding protein
families, such as the constitutively expressed nuclear
factor-Y [NF-Y; a heterotrimer of NF-YA, NF-YB, and
NF-YC (39, 40)]. Second, the C2 site may be a weak
binding site for C/EBPb, and efficient usage of this site
by C/EBPb may require the presence of cooperating
factors such as SF-1. In support of this hypothesis, a
cryptic C/EBP-binding site is present in the promoter
of the liver-specific cytochrome P450 2D5 (2D5) gene
as part of a bi-partite binding site for C/EBPb and Sp1
(41). C/EBPb is unable to bind to, or to activate transcription through, this element in the absence of Sp1,
and the selective interactions with Sp1 explain the
difference in the ability of C/EBPb and C/EBPa to
activate the 2D5 promoter (41). Additional studies are
required to identify the proteins that bind the C2 site in
vivo and whether C/EBPb must interact with other
proteins to bind to C2.
We (in this report) and others (14) have demonstrated that exogenously expressed SF-1 is capable
of transactivating the StAR promoter in COS-1 cells.
However, SF-1-dependent activation was diminished or lost when either one or both the C1 or C2
sites were mutated, despite the fact that these mutations would not be expected to significantly affect
SF-1 binding to its cognate sites. Furthermore, we
have shown that SF-1 and C/EBPb associate in
vitro. We interpret these results to indicate that SF-1
physically interacts with C/EBPb and possibly other
proteins bound to these sites and that these interactions are a prerequisite for SF-1 action. These
interactions could be direct protein-protein interactions or may involve the recruitment of accessory
factors such as coactivators to the promoter. In
regard to the former possibility, C/EBPb has been
shown to functionally and/or physically interact with
numerous members of the steroid hormone superfamily, including the estrogen receptor (42), glucocorticoid receptor (43), and hepatocyte nuclear
factor-4 [HNF4 (44)]. SF-1 has also been shown to
interact with a number of proteins that may be involved in the transcriptional regulation of the StAR
gene, including the steroid receptor coactivator-1
[SRC-1/NCoA-1 (45, 46)] and DAX-1 [for dosagesensitive sex reversal-adrenal hypoplasia congenita
critical region on the X chromosome, gene 1 (47)].
The requirement of intact C1 and C2 sites for efficient SF-1-mediated transactivation of the StAR
promoter and the physical interaction observed between SF-1 and C/EBPb distinguishes the StAR promoter as an important model with which to investigate how transcription factors may cooperate to
regulate transcription.
A central unanswered question surrounding the
StAR gene is the mechanism by which the promoter
responds acutely to trophic hormone stimulation and,
MOL ENDO · 1999
738
more specifically, how the interactions between transcription factors bound to the StAR promoter affect
cAMP-dependent regulation of the StAR gene. We
have shown in this report that the complex of proteins
bound to the C1 site is relatively unaffected by
(Bu)2cAMP stimulation. We have also reported that
disruption of the C1 and C2 sites interfered with basal
(unstimulated) transcription of the StAR gene, and that
these sites were required for SF-1-dependent transcription from the StAR promoter. Additionally, it has
been shown that StAR transcriptional activation does
not require de novo protein synthesis (10). Collectively,
these findings indicate that C/EBPb (and/or other proteins) bound to the C1 and C2 sites interacts with SF-1
regardless of cAMP stimulation, and that cAMP stimulation regulates a step distal to the formation of this
complex, which, in turn, may activate transcription
from the StAR promoter. There are several nonexclusive mechanisms by which this may transpire. For
example, upon stimulation with trophic hormone, increased cAMP levels cause the release of the catalytic
subunit of PKA, which can enter the nucleus (48).
Posttranslational modifications have been shown to
activate C/EBPb independently from its ability to bind
DNA (25), and a specific target residue for PKA has
been identified in the C/EBPb basic region (27). This
posttranslational modification of C/EBPb may activate
transcription either directly through C/EBPb or
through recruitment of coactivators to the promoter.
An alternative model involves the orphan nuclear receptor DAX-1. DAX-1 has been shown to be a powerful repressor of StAR promoter activity, through
binding to a hairpin loop structure located proximal to
the C2 site (49). Our data demonstrate that similar
complexes, which include C/EBPb, are formed on the
C1 site regardless of cAMP stimulation. SF-1 and
other factors may also bind to the promoter in the
absence of cAMP stimulation, which should result in a
high level of basal transcription from the promoter.
Since DAX-1 has been shown to repress StAR, its
presence on this promoter could effectively inhibit
transcription, even in the presence of positive factors
such as SF-1, Sp1, and C/EBPb. Upon cAMP stimulation, DAX-1 may be displaced from the promoter, or
disassociated from corepressors, allowing high levels
of transcription from the StAR promoter. DAX-1 null
mice have recently been described, and steroidogenesis appears to be relatively normal (50). The observed
phenocopy appears to be less severe than expected,
given that mutations in the DAX-1 gene in humans
results in X-linked, adrenal hypoplasia congenita
(AHC). The precise role of DAX-1 in the regulation of
the StAR gene remains a most interesting question,
which clearly requires additional study and a more
detailed analysis of the DAX-1 null mice. Work is currently underway to study in more detail the direct
interaction between C/EBPb and SF-1 and to study
whether transcriptional coactivators and repressors
are involved in SF-1- or C/EBPb-mediated regulation
of the StAR gene.
Vol 13 No. 5
MATERIALS AND METHODS
Cell Culture
The MA-10 mouse Leydig tumor cell line was a generous gift
from Dr. M. Ascoli (Department of Pharmacology, University
of Iowa College of Medicine, Iowa City, Iowa). The cells were
grown in Waymouth’s MB/752 medium containing 15%
horse serum and 40 mg gentamycin sulfate/ml (referred to as
WAY1). COS-1 African green monkey kidney cells were obtained from the American Type Culture Collection (Manassas,
VA) and were maintained in DMEM supplemented with 10%
FBS and 100 U of penicillin/ml and 10 U of streptomycin
sulfate/ml. All cells were grown at 37 C in a humid atmosphere of 5% CO2. Media, additives, and serum were purchased from Gibco BRL (Gaithersburg, MD).
Plasmids and Construction of StAR Promoter Mutants
pMEX C/EBPb has been described previously (51), and the
SF-1 expression plasmid was a generous gift of Dr. Keith
Parker (University of Texas, Southwestern Medical School,
Dallas, TX).
Site-directed mutagenesis was performed to mutate both
of the C/EBP-binding sites in the StAR promoter. The Gene
Editor kit (Promega Corp., Madison, WI) was used to introduce mutations into p-966 Luc (described in Ref. 10); referred
to in this study as Star 2966) to eliminate the C/EBP elements such that the mutated sequences would contain a
novel SalI restriction site. The oligonucleotides used to introduce the mutations were as follows (mutations are
underlined):
C1m: CACTGCAGGATGGTCGACTCATTCCATCCT
C2m: CTTGACCCTCTGGTCGACGACTGATGACTT
C1,2m: GCACTGCAGGATGGTCGACTCATTCCATCCTT GACCCTCTGGTCGACGACGATGAC.
Resulting plasmids were partially sequenced to confirm
that the C/EBP-binding sites had been mutated as expected.
Transfections
MA-10 and COS-1 cells were transfected by electroporation.
Briefly, 350 ml of a suspension of cells (12.5 3 106 cells/ml)
were mixed with various amounts of effector and reporter
plasmids along with sheared salmon sperm DNA (Sigma
Chemical Co., St. Louis, MO.) as carrier DNA to equalize the
total amount of DNA electroporated to 70 mg in each electroporation. For the transfection studies in MA-10 cells, 75 ng
of pRL-SV40 vector (a plasmid that constitutively expresses
Renilla luciferase under the control of the SV40 promoter;
Promega Corp.) was also transfected in all cases as a transfection control. Cells were electroporated in cuvettes (Invitrogen, Carlsbad, CA) with a gap width of 4 mm, using the
electro cell manipulator 600 (BTX Inc., San Diego, CA) using
the following parameters: capacitance 5 960 mFarads; voltage 5 250 V; resistance 5 129 V, yielding an electroporation
time of 20–30 msec. After electroporation, 1 ml normal
growth medium was added to the cuvette, and the cells were
incubated for 15 min at room temperature (RT). The cells
were then brought to 12 ml in normal growth medium, and 2
ml were placed in each well of a six-well (35-mm) dish.
Twenty-four hours after electroporation, the medium was
replaced with fresh medium. Twenty-four hours later, three
wells of each six-well plate were treated for 6 h with 1 mM
(Bu)2cAMP (Sigma Chemical Co., St. Louis MO), in 1 ml of
WAY1, while the control wells received only 1 ml of WAY1.
After (Bu)2cAMP stimulation the cells were harvested for luciferase assays as described below.
Regulation of the StAR Promoter by C/EBPb
Luciferase Assays
Extracts for luciferase assays were prepared using luciferase
assay system reporter lysis buffer (Promega Corp.). At the
time of harvesting, medium was removed, and the cells were
rinsed three times with ice-cold PBS. Reporter lysis buffer
(250 ml) was added to the cells, and the cells were scraped
into 1.5-ml centrifuge tubes. The cellular debris was then
pelleted by centrifugation at 13,800 3 g at 4 C, and the
supernatant fluid was placed in a 1.5-ml centrifuge tube and
was either used immediately or stored at 280 C.
Luciferase assays were performed using luciferase or dual
luciferase assay kits (Promega Corp.) exactly as described in
the protocol provided with the kit. Relative light units were
measured using a Monolight 2010 luminometer (Analytical
Luminescence Laboratory, San Diego, CA). Student’s unpaired one-tailed or two-tailed t tests were performed using
Statview SE1 graphics software (Abacus Concepts,
Berkeley, CA).
EMSA
Nuclear extracts were prepared from confluent cell cultures
as described (52). Briefly, cell monolayers were rinsed three
times with ice-cold PBS and scraped in 1 ml of PBS into
1.5-ml centrifuge tubes. The cells were pelleted by centrifugation at 1500 3 g for 3 min. The pellets were resuspended
in 400 ml of buffer A (10 mM HEPES, pH 7.9; 10 mM KCl; 0.1
mM EDTA; 0.1 mM EGTA; 1 mM dithiothreitol; 1 mM phenylmethylsulfonyl fluoride). The cells were swelled for 15 min at
4 C, and then 25 ml of 10% NP-40 were added and the tubes
were vortexed. The homogenates were centrifuged 30 sec at
13,800 3 g in a microfuge to pellet the nuclei; then 50 ml of
buffer C (20 mM HEPES, pH 7.9; 0.4 M NaCl; 1 mM EDTA; 1
mM EGTA; 1 mM dithiothreitol; 1 mM phenylmethylsulfonyl
fluoride) was added, and the samples were vigorously rocked
for 15 min at 4 C. The nuclear lysate was then centrifuged for
5 min at 13,800 3 g in a microfuge at 4 C, and the supernatant fluid was placed into a fresh microfuge tube and stored
at 280 C or used immediately. The pSVSportC/EBPb plasmid (provided by Dr. Elmus Beale, Texas Tech University,
Health Sciences Center, Lubbock, TX) was transcribed using
SP6 polymerase and was translated using the TNT kit (Promega Corp.). The double-stranded DNA probes used were
C1 (C/EBP binding site at 2113) and C2 (C/EBP binding site
at 287), and mutants of C1 and C2 in which underlined bases
have been mutated to disrupt the specific binding of C/EBP
proteins:
C1: GGCTGCAGGATGAGGCAATCATTCCA
C1m: GGCTGCAGGATGGTCGACTCATTCCA
C2: GGGACCCTCTGCACAATGACTGATG
C2m: GGGACCCTCTGGTCGACGACTGATG
To generate radioactive probes, the sense and antisense
oligonucleotides were heated to 75 C for 5 min and then
slowly cooled over 2 h to room temperature in annealing
buffer [10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA].
59-GGG overhangs present in the double-stranded oligonucleotides were filled in using a [32P] dCTP 3000 Ci/mmol
(DuPont NEN, Boston, MA) and Klenow (Promega Corp.) at
37 C for 30 min. The 32P-labeled probes were purified using
Probe Quant spin columns (Pharmacia Biotech, Piscataway,
NJ). Binding reactions were performed by mixing 5 mg of
nuclear extract with a binding cocktail containing 4% Ficoll,
10 mM HEPES (pH 7.9), 1 mM EDTA (pH 8.0), and 1 mg poly
(dI:dC) and the labeled probe at a final concentration of 5 nM
in 15 ml. Where noted, the protein was first incubated 20 min
at room temperature, in binding cocktail with 100-fold molar
excess of the unlabeled competitor DNA before addition of
the labeled DNA. For the supershift experiments, the binding
reaction was performed as described above for 20 min, after
which 1 ml of the C/EBPb antiserum was added and the
reaction was incubated an additional 20 min at room tem-
739
perature. After the binding reaction, the entire reaction was
subjected to electrophoresis through a 4% nondenaturing
polyacrylamide gel. The gel was then dried and autoradiography and phosphorimagery (Molecular Dynamics, Inc.,
Sunnyvale, CA) were performed.
DNAse I Footprint
To generate a radiolabeled DNA probe, the region spanning
2254 to 235 of the StAR promoter was amplified using the
following oligonucleotide primers; 59-primer is a 20 mer that
spans bases 2254 to 2235 and has additional bases at the
59-end to generate an MluI restriction endonuclease site, and
the 39-primer is a 44 mer that spans 2101 to 235 and;
contains point mutations to generate a BglII resriction endonuclease site centered at base 263 and a XhoI resriction
endonuclease site centered at 295. The amplification product was cloned into the MluI-SmaI sites of the pSport vector
(Life Technologies, Gaithersburg, MD), and the sequence
was verified by the dideoxynucleotide sequencing method of
Sanger using the T7 Sequenase Kit Version 2 (Amersham
Pharmacia Biotech, Arlington Heights, IL). The StAR promoter fragment was excised from pSport by MluI and KpnI
digestion and gel purified using QIAquick gel extraction kit
(Qiagen, Chatsworth, CA) and treated with calf intestinal
phosphatase (CIP, Promega Corp.). CIP was inactivated by
phenol-cholorform extraction, and the DNA was precipitated
with ethanol. Two picomoles of probe were radiolabed using
g-[32P]ATP (DuPont NEN, Boston MA) and T4 polynucleotide
kinase (Promega Corp.) followed by inactivation of the kinase
and digestion with BglII. The resultant probe is labeled on the
coding strand and spans 2254 to 266 of the StAR promoter.
The probe was purified by phenol-chloroform extraction and
ethanol precipitation, after which DNAse I footprint analysis
was performed using the Core Footprinting System (Promega
Corp.) with minor modifications. In brief, 20–40 fmol of probe
(50K-100K cpm) were added to the DNA protein-binding
reaction (10 mM Tris/Cl, pH 8.0, 150 mM KCl, 2.5 mg poly
dI:dC, 4 mg/ml calf thymus DNA, 10% glycerol, and 25–50 mg
MA-10 nuclear extract. The reaction was incubated on ice for
30 min and then transferred to 25 C, and CaCl2 and MgCl2
were added to a final concentration of 2.5 mM and 5 mM,
respectively. One unit of DNAse I (Promega Corp.) was added
to the reaction and was incubated for 15 sec in the presence
of nuclear extract or 30 sec in the presence or absence of
nuclear extract. The reactions were stopped by the addition
of an equal volume of stop buffer containing 200 mM NaCl, 30
mM EDTA, 1% SDS, and 100 mg/ml yeast RNA, and the DNA
was recovered by phenol-chloroform extraction and ethanol
precipitation. The reactions were resuspended in formamide
loading buffer, and the DNA was resolved on a 6% polyacrylamide sequencing gel. The gel was dried and exposed to
x-ray film. Maxam and Gilbert (53) chemical sequencing reactions were performed using 40 fmol of probe following
standard protocols (54).
GST Pull Down Assay
A GST-SF-1 fusion protein was prepared and isolated according to standard protocols (52). The plasmid containing
the SF-1 coding sequence in the pGEX-1lT vector (Pharmacia Biotech, Piscataway, NJ), was described previously (55),
and the control GST plasmid was pGEX4T-3 (Pharmacia
Biotech). Both GST and GST-SF-1 were subjected to PAGE
and stained with Coomassie blue. The appearance of a band
at the correct molecular weight confirmed that intact proteins
were produced. In vitro transcribed and translated C/EBPb
was prepared as described above, except that the STP3 kit
(Novagen, Madison, WI) was used in the presence of 35[S]methionine according to protocols supplied by the manufacturer. A binding reaction was prepared containing 10 ml of in
vitro transcribed and translated 35S-labeled C/EBPb, 20 mg of
MOL ENDO · 1999
740
the GST-SF-1 or GST protein bound to 70 ml of glutathione
linked to beaded agarose (Sigma Chemical Co.), 1 mg poly
(dI:dC) in the binding cocktail described in the EMSA methods above, with 50 ng of a PCR product spanning 25 to
2158 of the mouse StAR promoter (primer sequences avaliable upon request). The binding reaction was incubated 20
min at 4 C, DTSSP (Pierce Chemical Co., Rockford, IL), a
reversible cross-linking reagent, was added to a final concentration of 5 mM and incubation continued for an additional
20 min at 4 C. The binding reactions were then centrifuged at
13,000 3 g, the supernatant was removed, and the pellets
were washed four times in the binding cocktail. Pellets were
resuspended in denaturing sample buffer and incubated at
100 C for 10 min and subjected to SDS-PAGE. Autoradiography and phosphorimagery were performed on dried gels.
Acknowledgments
The authors would like to thank Dr. Steven King for many
helpful discussions and Dr. Joseph Orly for sharing data
before publication and for helpful discussions. We acknowledge the technical assistance of Deborah Alberts, Matthew
Dyson, Rebecca Combs, Darrell Eubank, and Demet Nalbant.
We also thank Drs. Mark McLean, Holly LaVoie, and Jennifer
Juengel for providing us with StAR promoter sequences before publication and Dr. Keith Parker for providing us with
plasmids.
Received October 2, 1998. Re-revision received February
5, 1999. Accepted February 17, 1999.
Address requests for reprints to: Dr. Douglas M. Stocco,
Department of Cell Biology and Biochemistry, Texas Tech
University Health Sciences Center, Lubbock, Texas 79430.
This research was supported by NIH Grants HD-17481
(D.M.S.) and DK-51656 (B.J.C.) and a Scientist Development
Grant from the American Heart Association (S.C.W.).
REFERENCES
1. Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara
BC 1987 ACTH regulation of cholesterol movement in
isolated adrenal cells. J Steroid Biochem 27:721–729
2. Crivello JF, Jefcoate CR 1980 Intracellular movement of
cholesterol in rat adrenal cells. Kinetics and effects of
inhibitors. J Biol Chem 255:8144–8151
3. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev
17:221–244
4. Stocco DM 1997 A StAR search: implications in controlling steroidgenesis. Biol Reprod 56:328–336
5. Stocco DM, Clark BJ 1997 The role of the steroidogenic
acute regulatory protein in steroidogenesis. Steroids
62:29–36
6. Clark BJ, Stocco DM 1997 Steroidogenic acute regulatory protein: the StAR still shines brightly. Mol Cell Endocrinol 134:1–8
7. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning, and expression of a novel luteinizing
hormone-induced mitochondrial protein in MA-10 mouse
Leydig tumor cells. Characterization of the steroidogenic
acute regulatory protein (StAR). J Biol Chem
269:28314–28322
8. Clark BJ, Stocco DM 1995 Expression of the steroidogenic acute regulatory (StAR) protein: a novel LH-induced mitochondrial protein required for the acute regulation of steroidogenesis in mouse Leydig tumor cells.
Endocr Res 21:243–257
Vol 13 No. 5
9. Clark BJ, Combs R, Hales KH, Hales DB, Stocco DM
1997 Inhibition of transcription affects synthesis of steroidogenic acute regulatory protein and steroidogenesis
in MA-10 mouse Leydig tumor cells. Endocrinology
138:4893–4901
10. Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL,
Clark BJ 1997 Characterization of the promoter region of
the mouse gene encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138–147
11. Caron KM, Clark BJ, Ikeda Y, Parker KL 1997 Steroidogenic factor 1 acts at all levels of the reproductive axis.
Steroids 62:53–56
12. Sugawara T, Kiriakidou M, McAllister JM, Kallen CB,
Strauss JF, 3rd 1997 Multiple steroidogenic factor 1
binding elements in the human steroidogenic acute regulatory protein gene 59-flanking region are required for
maximal promoter activity and cyclic AMP responsiveness. Biochemistry 36:7249–7255
13. Sugawara T, Kiriakidou M, McAllister JM, Holt JA, Arakane F, Strauss JF, 3rd 1997 Regulation of expression of
the steroidogenic acute regulatory protein (StAR) gene: a
central role for steroidogenic factor 1. Steroids 62:5–9
14. Sugawara T, Holt JA, Kiriakidou M, Strauss JF, 3rd 1996
Steroidogenic factor 1-dependent promoter activity of
the human steroidogenic acute regulatory protein (StAR)
gene. Biochemistry 35:9052–9059
15. Chau YM, Crawford PA, Woodson KG, Polish JA, Olson
LM, Sadovsky Y 1997 Role of steroidogenic-factor 1 in
basal and 39,59-cyclic adenosine monophosphate-mediated regulation of cytochrome P450 side-chain cleavage
enzyme in the mouse. Biol Reprod 57:765–771
16. Zhang P, Mellon SH 1997 Multiple orphan nuclear receptors converge to regulate rat P450c17 gene transcription:
novel mechanisms for orphan nuclear receptor action.
Mol Endocrinol 11:891–904
17. Zhang P, Mellon SH 1996 The orphan nuclear receptor
steroidogenic factor-1 regulates the cyclic adenosine
39,59-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17 alpha-hydroxylase/
c17–20 lyase). Mol Endocrinol 10:147–158
18. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding
site is required for activity of the luteinizing hormone beta
subunit promoter in gonadotropes of transgenic mice.
J Biol Chem 271:10782–10785
19. Cammas FM, Pullinger GD, Barker S, Clark AJ 1997 The
mouse adrenocorticotropin receptor gene: cloning and
characterization of its promoter and evidence for a role
for the orphan nuclear receptor steroidogenic factor 1.
Mol Endocrinol 11:867–876
20. Duval DL, Nelson SE, Clay CM 1997 A binding site for
steroidogenic factor-1 is part of a complex enhancer that
mediates expression of the murine gonadotropin-releasing hormone receptor gene. Biol Reprod 56:160–168
21. Sadovsky Y, Crawford PA, Woodson KG, Polish JA,
Clements MA, Tourtellotte LM, Simburger K, Milbrandt J
1995 Mice deficient in the orphan receptor steroidogenic
factor 1 lack adrenal glands and gonads but express
P450 side-chain-cleavage enzyme in the placenta and
have normal embryonic serum levels of corticosteroids.
Proc Natl Acad Sci USA 92:10939–10943
22. Johnson PF, Williams SCC 1994 CAAT/Enhancer Binding (C/ EBP) Proteins. In: Tronch F, Yaniv M (eds) Liver
Gene Expression. Landes Co, Austin, TX, pp 231–258
23. Nalbant D, Williams SC, Stocco DM, Khan SA 1998 Luteinizing hormone-dependent gene regulation in Leydig
cells may be mediated by CCAAT/enhancer-binding protein-b. Endocrinology 139:272–279
24. Niehof M, Manns MP, Trautwein C 1997 CREB controls
LAP/C/EBP beta transcription. Mol Cell Biol
17:3600–3613
25. Tae HJ, Zhang S, Kim KH 1995 cAMP activation of CAAT
enhancer-binding protein-beta gene expression and promoter I of acetyl-CoA carboxylase. J Biol Chem
Regulation of the StAR Promoter by C/EBPb
270:21487–21494
26. Metz R, Ziff E 1991 cAMP stimulates the C/EBP-related
transcription factor rNFIL-6 to trans-locate to the nucleus
and induce c-fos transcription. Genes Dev 5:1754–1766
27. Chinery R, Brockman JA, Dransfield DT, Coffey RJ 1997
Antioxidant-induced nuclear translocation of CCAAT/enhancer-binding protein beta. A critical role for protein
kinase A-mediated phosphorylation of Ser299. J Biol
Chem 272:30356–30361
28. Sandhoff TW, Hales DB, Hales KH, McLean MP 1998
Transcriptional regulation of the rat steroidogenic acute
regulatory protein gene by steroidogenic factor 1. Endocrinology 139:4820–4831
29. LaVoie HA, Garmey JC, Veldhuis JD 1999 Mechanisms
of IGF-I augmentation of FSH-stimulated porcine StAR
gene promoter activity in granulosa cells. Endocrinology
140:146–153
30. Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M,
Engel JD, Yamamoto M 1993 Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis.
Nature 362:466–468
31. Feng ZM, Wu AZ, Chen CL 1998 Testicular GATA-1
factor up-regulates the promoter activity of rat inhibin
a-subunit gene in MA-10 Leydig tumor cells. Mol Endocrinol 12:378–390
32. Williams SC, Cantwell CA, Johnson PF 1991 A family of
C/EBP-related proteins capable of forming covalently
linked leucine zipper dimers in vitro. Genes Dev
5:1553–1567
33. Johnson PF 1993 Identification of C/EBP basic region
residues involved in DNA sequence recognition and halfsite spacing preference. Mol Cell Biol 13:6919–6930
34. Piontkewitz Y, Enerback S, Hedin L 1996 Expression of
CCAAT enhancer binding protein-alpha (C/EBP alpha) in
the rat ovary: implications for follicular development and
ovulation. Dev Biol 179:288–296
35. Sirois J, Richards JS 1993 Transcriptional regulation of
the rat prostaglandin endoperoxide synthase 2 gene in
granulosa cells. Evidence for the role of a cis-acting
C/EBP beta promoter element. J Biol Chem
268:21931–21938
36. Roesler WJ, Park EA 1998 Hormone response units: one
plus one equals more than two. Mol Cell Biochem
178:1–8
37. Ogbourne S, Antalis TM 1998 Transcriptional control and
the role of silencers in transcriptional regulation in eukaryotes. Biochem J 331:1–14
38. Nelson SB, Eraly SA, Mellon PL 1998 The GnRH promoter: target of transcription factors, hormones, and signaling pathways. Mol Cell Endocrinol 140:151–155
39. Dorn A, Bollekens J, Staub A, Benoist C, Mathis D 1987
A multiplicity of CCAAT box-binding proteins. Cell
50:863–872
40. Sinha S, Maity SN, Lu J, de Crombrugghe B 1995 Recombinant rat CBF-C, the third subunit of CBF/NFY,
allows formation of a protein-DNA complex with CBF-A
and CBF-B and with yeast HAP2 and HAP3. Proc Natl
Acad Sci USA 92:1624–1628
741
41. Lee YH, Williams SC, Baer M, Sterneck E, Gonzalez FJ,
Johnson PF 1997 The ability of C/EBP beta but not
C/EBP alpha to synergize with an Sp1 protein is specified
by the leucine zipper and activation domain. Mol Cell Biol
17:2038–2047
42. Stein B, Yang MX 1995 Repression of the interleukin-6
promoter by estrogen receptor is mediated by NF-kappa
B and C/EBP beta. Mol Cell Biol 15:4971–4979
43. Nishio Y, Isshiki H, Kishimoto T, Akira S 1993 A nuclear
factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription
of the rat alpha 1-acid glycoprotein gene via direct protein-protein interaction. Mol Cell Biol 13:1854–1862
44. Stauffer DR, Chukwumezie BN, Wilberding JA, Rosen
ED, Castellino FJ 1998 Characterization of transcriptional
regulatory elements in the promoter region of the murine
blood coagulation factor VII gene. J Biol Chem
273:2277–2287
45. Crawford PA, Polish JA, Ganpule G, Sadovsky Y 1997
The activation function-2 hexamer of steroidogenic factor-1 is required, but not sufficient for potentiation by
SRC-1. Mol Endocrinol 11:1626–1635
46. Ito M, Yu RN, Jameson JL 1998 Steroidogenic factor-1
contains a carboxy-terminal transcriptional activation
domain that interacts with steroid receptor coactivator-1.
Mol Endocrinol 12:290–301
47. Ito M, Yu R, Jameson JL 1997 DAX-1 inhibits SF-1mediated transactivation via a carboxy-terminal domain
that is deleted in adrenal hypoplasia congenita. Mol Cell
Biol 17:1476–1483
48. Nigg EA, Hilz H, Eppenberger HM, Dutly F 1985 Rapid
and reversible translocation of the catalytic subunit of
cAMP-dependent protein kinase type II from the Golgi
complex to the nucleus. EMBO J 4:2801–2806
49. Zazopoulos E, Lalli E, Stocco DM, Sassone-Corsi P 1997
DNA binding and transcriptional repression by DAX-1
blocks steroidogenesis. Nature 390:311–315
50. Yu RN, Ito M, Saunders TL, Camper SA, Jameson JL
1998 Role of Ahch in gonadal development and gametogenesis. Nat Genet 20:353–357
51. Williams SC, Baer M, Dillner AJ, Johnson PF 1995 CRP2
(C/EBP beta) contains a bipartite regulatory domain that
controls transcriptional activation, DNA binding and cell
specificity. EMBO J 14:3170–3183
52. Schreiber E, Matthias P, Muller MM, Schaffner W 1989
Rapid detection of octamer binding proteins with ’miniextracts’, prepared from a small number of cells. Nucleic
Acids Res 17:641955
53. Maxam AM, Gilbert W 1980 Sequencing end-labeled
DNA with base-specific chemical cleavages. Methods
Enzymol 65:499–599
54. Ausubel FM, Brent R, Kingston RE, Moore ME, Smith JA,
Seidman JG, Struhl K (eds) 1998 Current Protocols in
Molecular Biology. John Wiley & Sons, Inc., New York
55. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I,
a key regulator of steroidogenic enzyme expression, is
the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 6:1249–1258