© 2000 Oxford University Press
Nucleic Acids Research, 2000, Vol. 28, No. 9
e39
AFM characterization of single strand-specific
endonuclease activity on linear DNA
Kazuo Umemura1, Fuji Nagami1,2, Takao Okada1 and Reiko Kuroda1,2,*
1Joint
Research Center for Atom Technology (JRCAT), 1-1-4 Higashi, Tsukuba, Ibaraki 305-0046, Japan and
of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo, 3-8-1 Komaba,
Meguro-ku, Tokyo 153-8902, Japan
2Department
Received November 22, 1999; Revised February 24, 2000; Accepted March 3, 2000
ABSTRACT
The specificity of nucleases for nicked and un-nicked
double-stranded DNA has been characterized using
atomic force microscopy (AFM). We have found that
AFM has advantages over the usual macroscopic
analyses, such as sucrose gradient centrifugation or
electrophoresis, in characterizing nuclease digestion.
In particular, short DNA fragments resulting from
non-specific digestion were detected and, thus, the
true length distribution of digested DNA was revealed.
A simple numerical method is proposed to estimate
the number of nicked sites per DNA molecule based
on AFM images.
INTRODUCTION
Atomic force microscopy (AFM) imaging is typically carried
out not in a vacuum but in air and in aqueous solution without
staining, shadowing or labeling and, therefore, is particularly
attractive for studying biological samples (see for example 1–5).
One unique advantage of microscopical techniques such as
AFM is the ability to directly observe individual molecules (6).
In contrast to AFM, electrophoresis or chromatography
provides averaged information over a population of a sample.
For example, electrophoresis of a solution containing DNA of
varied length will give smeared bands losing information on
the DNA fragments of quite short length.
It is well known that S1 nuclease digests single-stranded but
not double-stranded DNA (7,8). However, when a high
concentration of S1 is employed, double-stranded DNA is also
cut by the nuclease at sites opposite nicks (9–12). In contrast,
mung bean nuclease does not have the ability to cleave doublestranded DNA at nicked sites (13,14). These properties were
established by sucrose gradient centrifugation and electrophoresis experiments.
We have examined double-stranded linear DNA treated with
either S1 or mung bean nuclease by AFM. In the case of circular
DNA, nicked and supercoiled DNA are easily distinguished by
both electrophoresis and microscopy, although nicked and
relaxed closed circular forms cannot be discriminated.
However, in the case of linear DNA, nicked and un-nicked
forms give similar results with both methods. By comparing
the intensity of DNA bands in gel electrophoresis before and
after S1 treatment, one can estimate the amount of un-nicked
DNA in the sample. However, detailed length information on
S1-treated nicked DNA cannot be obtained from the smeared
bands on the gel. We have shown that AFM provides this
information, as the technique is particularly powerful in
observing individual DNA molecules including minor components
resulting from non-specific reactions.
MATERIALS AND METHODS
S1 and mung bean nucleases and ScaI endonuclease were
purchased from Takara Shuzo Co. (Tokyo, Japan). Nicked and
un-nicked linear DNA were prepared as follows. Using nonfresh pBR322 DNA (4361 bp) containing a fair amount of
nicked closed circular form, supercoiled and nicked/relaxed
DNA were separated by low melting point agarose gel electrophoresis and isolated by excising the corresponding bands
from the gel. Supercoiled and nicked/relaxed DNA samples
were treated separately during the course of experiments and
compared. Linear DNA was obtained by low melting point gel
electrophoresis following ScaI digestion.
For digestion with S1 nuclease, 0.6, 1.8, 3.6, 18 or 36 U were
added to 0.15 µg of nicked or un-nicked DNA in a standard
buffer solution (30 mM sodium acetate, 15 mM NaCl, 1 mM
ZnSO4, pH 4.6), incubated at 37°C for 30 min and the enzyme
inactivated and removed by phenol extraction. Similarly for
mung bean nuclease, 2 or 20 U were added to 0.15 µg of DNA
and incubated in a standard buffer solution [30 mM
CH3COONa, 100 mM NaCl, 1 mM (CH3COO)2Zn, 5% glycerol,
pH 5.0] at 37°C for 30 min.
A 900 bp fragment of pBR322 (nt 121–1020) was prepared
by PCR with CACCGTCACCCTGGATGCTG and
GAAGCGAGAAGAATCATAAT as primers. The solution
was irradiated using a UV lamp (254 nm, 4 W) for 5 h after
removing the polymerase by phenol extraction. Irradiated and
non-irradiated DNA were electrophoresed in low melting point
agarose and the 900 bp band was excised and recovered.
DNA samples were characterized by 0.8% agarose gel electrophoresis as well as AFM imaging. Freshly cleaved mica
substrate was pretreated with 3-aminopropyltriethoxysilane
(APS, AP-mica) for 30 min and rinsed with water and ethanol.
DNA solution (10 µl) was dropped onto the AP-mica, which
after standing for several minutes was washed with water. The
*To whom correspondence should be addressed at: Joint Research Center for Atom Technology (JRCAT), 1-1-4 Higashi, Tsukuba, Ibaraki 305-0046, Japan.
Tel: +81 298 2712; Fax: +81 298 2784; Email: [email protected]
e39
Nucleic Acids Research, 2000, Vol. 28, No. 9
Figure 2. Agarose gel electrophoresis of linear DNA digested with S1 nuclease.
Lanes 1 and 8, molecular weight marker (λ DNA digested with EcoRI and HindIII);
lanes 2–7, linear DNA prepared from supercoiled pBR322; lanes 9–14, linear
DNA prepared from nicked pBR322. S1 nuclease was added at 0, 0.6, 1.8, 3.6,
18 and 36 U in lanes 2–7 and 9–14, respectively.
Figure 1. AFM images of pBR322 DNA purified by gel electrophoresis in low
melting point agarose. (a and b) Supercoiled and nicked/relaxed circular
forms, respectively. (c and d) Linear DNAs prepared by ScaI digestion from
DNA in (a) and (b), respectively. Magnified images of individual DNA molecules
are presented as insets in (a) and (b).
sample was dried under a stream of nitrogen. Observations
were performed on a NanoScope IIIa (Digital Instruments,
Santa Barbara, CA) in the tapping mode in air, using standard
TESP cantilevers. Fields of 1–3 µm were scanned at <2 Hz.
Images were flattened to account for Z offsets and sample tilt
and exported as TIF files. The lengths of the DNA molecules
were measured using Image SXM v.1.60 software.
RESULTS AND DISCUSSION
Digestion of supercoiled or relaxed closed circular pBR322
DNA at a single ScaI site is expected to produce linear DNA
containing no nicked sites. In contrast, linear DNA obtained
from nicked pBR322 DNA will contain one or more nicks.
Figure 1a and b shows AFM images of supercoiled and
nicked/relaxed circular pBR322 DNA, respectively, prior to
ScaI digestion. The supercoiled DNA contained a negligible
amount of nicked DNA (Fig. 1a). AFM images of linear DNA
prepared from the supercoiled (a) and nicked/relaxed (b)
pBR322 DNA by ScaI digestion are shown in Figure 1c and d,
respectively. They closely resemble each other. All the subsequent
experiments were carried out using the two linear DNAs.
The intact and nicked linear DNAs were treated separately
with S1 nuclease and characterized by gel electrophoresis for
macroscopic monitoring (Fig. 2). In the case of un-nicked
DNA, there was no clear decrease in intensity of the bands
from lane 2 to 6 with increasing amount of S1 nuclease. Only
in lane 7, where 36 U of S1 nuclease were added, did the intensity
of the linear band clearly decrease, as previously reported (15).
ii
However, using nicked DNA as substrate, the linear DNA
band was progressively degraded depending on the S1
nuclease concentration (from lane 9 to 14). The remarkable
difference in digestion between lanes 6 and 13 clearly demonstrates the activity of S1 nuclease specific to nicked DNA.
AFM images of S1-treated DNA and histograms of length
distribution obtained from the images are shown in Figure 3. In
the case of nicked DNA samples, many digested DNA fragments
were observed even at the lowest S1 concentration of 0.6 U
(Fig. 3e) as compared with the control sample (see Fig. 1d).
DNA samples in Figures 1d and 3e are identical to those used
in lanes 9 and 10 in gel electrophoresis, respectively (Fig. 2).
While the difference between lanes 9 and 10 is marginal on the
electrophoresis gel, it is substantial in the AFM images. In
Figure 3g and h various lengths of DNAs were individually
observed while smeared patterns were observed in lanes 13
and 14 in electrophoresis.
In the case of un-nicked linear DNA only a few digested
DNA fragments were observed in Figure 3a, although it was
treated with the same amount of S1 nuclease as in Figure 3e.
The difference between Figure 3a and e is consistent with
selective S1 nuclease action at nicked sites on DNA. Digested
DNA was found in the AFM image (Fig. 3c, see arrows) but
not in Figure 3a. This is in sharp contrast to gel electrophoresis,
where no difference was observed between the corresponding
lanes 3 and 5, although they are the identical samples to
Figure 3a and c, respectively. While AFM observes individual
DNA molecules, the intensity of bands in gel electrophoresis
visualized by the fluorescence of ethidium bromide intercalated
between the DNA base pairs depends not only on the number
of molecules, but also on DNA length. The results illustrate the
advantage of the AFM method in obtaining information on
minor components in DNA samples.
The experiments described so far used AP-mica as substrate.
Similar experiments were carried out using bare mica. Deposition
of DNA solutions containing magnesium or other ions onto
bare mica is a popular method. However, because of the weak
adhesion of DNA to bare mica, we found the method to be
sensitive to the preparation method of AFM samples and that it
tended to lose shorter DNA fragments. Thus, AP-mica is a
Nucleic Acids Research, 2000, Vol. 28, No. 9
e39
Figure 3. AFM images and the corresponding length distributions of S1-treated un-nicked (Ia–Id) and nicked (IIe–IIh) DNA. S1 nuclease was added at 0.6, 1.8,
18 and 36 U in (a)–(d) and (e)–(h), respectively. The arrows in (c) indicate the digested DNA. The number of DNA molecules was plotted against the measured
DNA length (left, short; right, full-length, 1.4 µm) in a histogram presentation.
more suitable substrate for AFM measurements of DNA length
distribution in the sample. As adsorbed DNAs are likely to be
less stretched on AP-mica, care has to be taken when tracing
DNA lengths.
iii
e39
Nucleic Acids Research, 2000, Vol. 28, No. 9
Figure 4. Digestion of linear DNA by mung bean nuclease. The DNA sample
and amount of mung bean nuclease added were as follows: (a) un-nicked, 2 U;
(b) un-nicked, 20 U; (c) nicked, 2 U; (d) nicked, 20 U. The amount of DNA
was 0.15 µg in all cases. The number of DNA molecules was plotted against
the measured DNA length (left, short; right, full-length, 1.4 µm).
Using the numerical data obtained from the histogram analysis
under each experimental condition (Fig. 3), we have tried to
roughly estimate the number of digested sites per DNA molecule.
For simplicity, it was assumed that nicking of DNA during
sample preparation was negligible. The calculation procedure
was as follows: (i) the full length of pBR322 DNA was divided
by the calculated average length of digested DNA; (ii) 1 was
subtracted from this number to adjust for the difference in the
number of cleavage sites and that of fragments; (iii) the estimated
digestion number for the un-nicked sample was subtracted
from that of the nicked sample to obtain the number of S1
cleavages specific to nicked double-stranded DNA (Nn).
When 1.8 U of S1 nuclease was employed, Nn was calculated
to be 0.9 from the comparison of histogram analysis of Figure
3b and f. Nn value for the experiments with 18 U was 1.4. These
results suggest that the nicked circular DNA sample employed
in this work has on average one or two nicked sites per molecule.
If the normalized Nn value per 10 kb is defined as N0, N0 was
calculated to be 2.1 and 3.2 from Figure 3b/f and c/g, respectively.
When excess S1 nuclease (36 U) was employed (Fig. 3d and h),
Nn was 0.4. The small number may be due to substantial nonspecific cleavage which cannot be regarded as background.
This numerical analysis should not be taken rigorously, as it
is based on various assumptions, such as introduction of nonicking during the experiments apart from S1 treatment and no
loss of shorter DNA fragments during removal of proteins.
Even so, this kind of simple calculation can give a rough estimate
of the degree of nicking of DNA samples.
Characterization of digestion with mung bean nuclease was
carried out using AFM as shown in Figure 4. There was no
significant difference between the nicked and un-nicked
samples even when a considerable amount of mung bean
nuclease (20 U) was added to 0.15 µg of DNA (Fig. 4b and d).
Thus, AFM could visualize the different specificities of S1 and
mung bean nuclease with respect to double-stranded DNA
cleavage.
Having established the numerical method based on AFM
images, we have further applied the method to nicked DNAs
prepared by UV irradiation. Figure 5a and b shows the results
iv
Figure 5. AFM images and the corresponding histograms of S1 digestion of
(a) unirradiated control DNA and (b) UV-irradiated DNA. Twenty units of S1
nuclease were reacted with 0.15 µg of DNA. The number of DNA molecules
was plotted against the measured DNA length (left, short; right, full-length,
0.3 µm) in the histograms.
of S1 nuclease action of unirradiated and UV-treated 900 bp
linear DNA, respectively. The Nn value of UV-treated DNA
was estimated to be 1.21 per 900 bp, i.e. N0 was calculated to
be 13.4. The value is much higher than that obtained in Figure 3
(N0 = 2–3). These values appear reasonable and the method can
be applied to characterize highly nicked DNA samples.
In this paper, we have shown that AFM imaging clearly
identifies shorter DNA fragments produced by S1 nuclease
treatment of a nicked DNA sample. Thus, AFM imaging
together with nuclease digestion is a useful method to offer
information on the degree of nicking of a DNA sample.
ACKNOWLEDGEMENTS
This work was performed under the auspices of the Angstrom
Technology Partnership in the Joint Research Center for Atom
Nucleic Acids Research, 2000, Vol. 28, No. 9
Technology, partly supported by the New Energy and Industrial
Technology Development Organization.
REFERENCES
1. Arscott,P.G. and Bloomfield,V.A. (1992) Methods Enzymol., 211, 491–502.
2. Bustamante,C., Keller,D. and Yang,G. (1993) Curr. Opin. Struct. Biol., 3,
363–372.
3. Bustamante,C., Erie,D.A. and Keller,D. (1994) Curr. Opin. Struct. Biol.,
4, 750–760.
4. Engel,A., (1991) Annu. Rev. Biophys. Chem., 20, 79–108.
5. Hansma,H.G. and Hoh,J. (1994) Annu. Rev. Biophys. Biochem. Struct.,
23, 115–139.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
e39
Binnig,G., Quate,C.F. and Gerber,C.H. (1986) Phys. Rev. Lett., 56, 930–933.
Ando,T. (1966) Biochim. Biophys. Acta, 114, 158–168.
Vogt,V.M. (1973) Eur. J. Biochem. 33, 192–200.
St John,T., Jhonson,J.D. and Bonner,J. (1974) Biochem. Biophys. Res.
Commun., 57, 240–247.
Germond,J.-E., Vogt,V.M. and Hirt,B. (1974) Eur. J. Biochem., 43, 591–600.
Wiegand,R.C., Godson,G.N. and Radding,C.M. (1975) J. Biol. Chem.,
250, 8848–8855.
Englund,P.T., DiMaio,D.C. and Price,S.S. (1977) J. Biol. Chem., 252,
6208–6216.
Kedzierski,W., Lasowski,M.,Sr and Mandel,M. (1973) J. Biol. Chem.,
248, 1277–1280.
Kroeker,D.W. and Kowalski,D. (1978) Biochemistry, 17, 3236–3242.
Godson,G.N. (1973) Biochim. Biophys. Acta, 308, 59–67.
v