Journal
of General Virology (2002), 83, 979–990. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Cloning and sequencing of TT virus genotype 6 and expression
of antigenic open reading frame 2 proteins
Laura Kakkola, Klaus Hedman, Heidi Vanrobaeys, Lea Hedman and Maria So$ derlund-Venermo
Department of Virology, Haartman Institute and Helsinki University Central Hospital, POB 21, FIN-00014 University of Helsinki, Finland
The near-full-length genome of a TT virus (TTV) (HEL32), closely related to the previously
uncharacterized genotype 6, was cloned and sequenced. The genomic organization of HEL32 was
compared to 41 published near-full-length TTV sequences representing 17 genotypes. In the
majority of genomes, the open reading frame (ORF) 2 region was divided into two separate ORFs,
2a and 2b. The ORF2a sequence was conserved among all genotypes, while the ORF2b region
showed more variability. The two corresponding putative proteins of HEL32 were expressed in
prokaryotes and their antigenic potential was studied. IgM and IgG antibodies to the respective
ORF2-encoded proteins, fp2a and fp2b, and the presence of TTV DNA were studied in the sera of
89 constitutionally healthy adults. By immunoblot using the small TTV proteins as antigens, strong
IgM and IgG reactivities were found in 9 and 10 % of subjects, respectively. Follow-up studies for
12–15 years of three subjects showed either a persistent coexistence of IgM and TTV DNA or the
appearance of viral DNA regardless of pre-existing antibodies. The low prevalence of IgG could be
due to the weak immunogenicity of these probably non-structural proteins or to a genotypespecific antibody response. By nested PCR of the conserved ORF2a region, the prevalence of TTV
DNA was 85 %. TTV genotype 6 sequences were found by specific PCR in 3 of 35 (8n6 %) subjects.
The low prevalence of TTV IgG compared to the high TTV DNA prevalence, the coexistence of
antibodies and viral DNA and the appearance of TTV DNA regardless of pre-existing antibodies
suggest that the B-cell immunity against these minor TTV proteins would not be cross protective.
Introduction
TT virus (TTV) was discovered in 1997 from the serum of
a Japanese patient with post-transfusion hepatitis of unknown
aetiology (Nishizawa et al., 1997). TTV is a small, nonenveloped virus with a circular, single-stranded, negativesense DNA genome of " 3n8 kb (Okamoto et al., 1998 ; Miyata
et al., 1999 ; Mushahwar et al., 1999). TTV has similarities in
genome organization to chicken anaemia virus (CAV), which is
a member of the Circoviridae family, and thus TTV may
represent the first circovirus to be found in humans (Miyata et
al., 1999). Based on DNA sequence variation in the short N22
region, described by Nishizawa et al. (1997), TTV is classified
into at least 27 different genotypes (Muljono et al., 2001 ;
Author for correspondence : Laura Kakkola.
Fax j358 9 19126491. e-mail laura.kakkola!helsinki.fi
The GenBank accession number of the sequence reported in this paper
is AY034068.
0001-7863 # 2002 SGM
Okamoto et al., 2001). The evolutionary distance between the
classified genotypes, as measured by nucleotide substitutions
per site, is greater than 0n30 (Okamoto et al., 1999a). Besides
the multitude of different genotypes, recombinants are also
common (Worobey, 2000).
Full-length or near-full-length sequences from representatives of genotypes 1–3 and 10–23 have been deposited in
GenBank. DNA sequence analysis of the identified TTVs
indicate that most genotypes hitherto sequenced contain at
least 2–3 open reading frames (ORFs) (Erker et al., 1999 ;
reviewed by Bendinelli et al., 2001). The longest ORF, ORF1,
encodes the putative capsid protein, whereas the shorter
ORF2, often divided into ORFs 2a and 2b, possibly encode
non-structural proteins. It has also been shown that mRNA
splicing creates additional ORFs (Kamahora et al., 2000 ;
Okamoto et al., 2000b).
As measured in serum or plasma by PCR, TTV is ubiquitous,
with an age-dependent prevalence that approaches 94 %
among healthy adults (Hijikata et al., 1999a ; Saback et al.,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JHJ
L. Kakkola and others
1999). TTV DNA can persist for several months or years and
multiple infections with several genotypes are frequently
detected in the blood (Nishizawa et al., 1997 ; Ball et al.,
1999 ; Biagini et al., 1999 ; Gallian et al., 1999 ; Okamoto et al.,
1999a ; Takayama et al., 1999 ; Niel et al., 2000) and in a diverse
range of tissues (Okamoto et al., 2001). The prevalence of the
various genotypes does not seem to differ geographically
(Mushahwar et al., 1999 ; Gallian et al., 2000). Primate infection
studies have shown TTV to be a transmissible agent
(Mushahwar et al., 1999 ; Luo et al., 2000 ; Tawara et al., 2000)
but it has not been shown to be the cause of any particular
disease (reviewed by Bendinelli et al., 2001 ; Okamoto &
Mayumi, 2001).
Diagnoses of TTV infections have been based almost solely
on PCR. Due to high sequence variation, however, it is difficult
to find a universal PCR primer set for all TTV genotypes
(Okamoto et al., 1999a). Only a few TTV antibody studies
have been published. These studies have used either fragments
of the ORF1-encoded protein or crude TTV particles as
antigen. Robust immunoprecipitation experiments have suggested the existence of TTV-specific antibodies (Nishizawa et
al., 1999 ; Tsuda et al., 1999) and an IgM-capture method
combined with PCR has revealed IgM class antibodies (Tsuda
et al., 2001). TTV antibodies in serum have been detected by
immunoblot assays using bacterially expressed N- and Cterminal fragments of the ORF1-encoded protein as antigen
(Handa et al., 2000 ; Ott et al., 2000). In addition, electron
microscopy has revealed that TTV particles in faeces are in free
form as opposed to those found in serum, which are complexed
with IgG antibodies (Itoh et al., 2000).
The aims of this study were as follows : (1) to clone and
sequence a TTV genome, to map its genomic organization and
to compare it with other TTV genomes ; (2) to express viral
proteins ; and (3) to study the antigenicity of those proteins.
We have cloned and sequenced the near-full-length genome of
a TTV (HEL32), representing a previously uncharacterized
genotype 6, and compared the genomic organization of HEL32
with those of 41 TTV strains of 17 genotypes. Three ORFs
were cloned, two of which (ORFs 2a and 2b) were successfully
expressed and used as antigen in immunoblot assays. Specific
antibodies and TTV DNA were measured in the sera of 89
non-symptomatic individuals, three of whom were followed
retrospectively for 12–15 years.
Methods
Serum samples. Sera were obtained, with informed consent, from
89 non-symptomatic adults, 80 of whom were ethnically Finnish. DNA
was purified from 10 to 100 µl of serum by proteinase-K treatment,
phenol–chloroform extraction and ethanol precipitation, followed by
resuspending to the original volume in water.
To avoid contamination, the samples and PCR mixtures were prepared
in separate rooms and under laminar flow hoods, using disposable racks
and aerosol-resistant tips. Water was included as a negative control.
Cloning of the TTV genome. A 3381 bp region of a TTV DNA
JIA
isolate, termed HEL32, was amplified and cloned in two overlapping
pieces. A 3269 bp PCR product, corresponding to nt 113–3381 of the
HEL32 genome, was amplified by nested PCR from the serum of a nonsymptomatic Finnish female, using primers NG133, NG135, NG134 and
NG136 (Okamoto et al., 1999a). Both PCR reactions (50 µl) contained
200 µM of each dNTP (Roche), 320 nM of each primer, 1n5 mM MgCl
#
and 2n6 U of Expand High Fidelity enzyme mix (Boehringer Mannheim).
The sample volume was 25 µl for the outer PCR and 2 µl for the inner
PCR. The PCR protocol consisted of annealing at 54 mC for 30 s and
extension at 68 mC for 2n5 min for the first 10 cycles, with 5 s per cycle
added to the extension time for the remaining 20 cycles. The amplicons
were electrophoresed, stained with ethidium bromide (EtBr) and
visualized under UV. The band of the expected size was excised and
DNA was isolated with the QIAquick Gel Extraction kit (Qiagen). The
3269 bp PCR product was cloned into pSTBlue-1 (Novagen) and
transformed into Escherichia coli DH5α cells.
Of the TTV genome, nt 1–222 were amplified with the semi-nested
primers NG054, NG147 and NG132 (Okamoto et al., 1999a). The
reaction mixture and PCR program were as described for universal PCR
(see below), except that annealing occurred at 50 mC, the extension time
was 45 s and the cycles were repeated 30 times, with a final extension of
3 min. Amplicons were isolated and cloned as described above.
Sequence analysis. All new TTV sequences reported in this paper
were obtained using ABI PRISM (Perkin-Elmer) at the sequencing core
facility of the Haartman Institute, University of Helsinki, Finland. The
genomic organization in HEL32 was determined and compared to 41
other near-full-length TTV sequences (obtained from GenBank) using
 () and , version 1.0 (Marck C., Commissariat
a l’Energie Atomique, France). Multiple sequence alignment and evolutionary distance analyses were obtained using the ,  and
 programs, all of which are part of the Wisconsin package 10.1
(Genetics Computer Group) and are maintained by the Center for
Scientific Computing (Espoo, Finland). For genotyping, the sequence of
the N22 area of HEL32 was compared to those of 20 published TTV
genotypes (Muljono et al., 2001) and the ORF1 sequence was compared
to 17 genotypes reported by Okamoto et al. (2001). Phylogenetic trees
(see Fig. 2) were constructed with  using the maximumlikelihood approach (Strimmer & von Haesler, 1997) ; 10 000 puzzling
steps were applied using the HKY model of substitution (Hasegawa et al.,
1985). For confirmation, the trees were also constructed using the
neighbour-joining algorithm of the  program package with 500
bootstrap replicates (Felsenstein, 1989). The program  was used for
database searches (NCBI).
Cloning of ORFs into expression plasmids. In-frame PCR
primers specific for each of the three ORFs (Fig. 1) were designed. Primers
were as follows : for ORF1, forward 5h TCGGAATTCATGGCCTGGTACTGGT 3h (nt 581–598) and reverse 5h GCTTTGGGCAGCGGCCGC
TATGTGG 3h (nt 2917–2941) ; for ORF2a, forward 5h CGTGGGATCC
GCTGAGTTTTCCACGCCCGTC 3h (nt 109–129) and reverse 5h
TCTAATAAAGGCGGCCGCCCACTG 3h (nt 799–822) ; and for
ORF2b, forward 5h TCGGAATTCATGGGCAAGGCTCTTAG 3h (nt
239–255) and reverse 5h TCTAATAAAGGCGGCCGCCCACTG 3h (nt
799–822). In each primer, restriction enzyme sites (underlined) were
incorporated to allow cloning into the expression plasmid. ORFs 2a and
2b were amplified together as a single PCR amplicon (ORF2a\b). ORF2b
was also amplified separately. The reverse primers were designed
downstream of the stop codons in each ORF. However, to verify the
presence of the ORF2a stop codon at nt 255, the same reverse primer as
that used for ORF2b was employed.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
ORF2 of TTV genotype 6
detection was eliminated by the prior removal of IgG using Gullsorb
(Meridian Diagnostics).
Fig. 1. Schematic representation of TTV HEL32 in comparison to TA278
(GenBank accession number AB017610). Two overlapping, cloned PCR
products of HEL32, labelled a and b, are shown in grey. Three putative
ORFs, ORFs 2a (nt 106–255), 2b (nt 239–709) and 1 (nt 583–2793),
are shown in black. The N22 (nt 1843–2171) and universal (nt 90–232)
PCR regions are also indicated (thin bars).
ORFs were amplified from the HEL32 plasmid clone containing the
3269 bp PCR insert. For ORF2a, nt 109–112, which were not present in
the 3269 bp plasmid clone, were included in the ORF2a forward primer.
The purified ORF restriction fragments were cloned into pGEX-4T-1
expression plasmids (Amersham Pharmacia) and the resulting plasmids
were transformed into E. coli DH5α cells. The sequences of the entire
cloned ORF inserts were verified by sequencing.
Expression of TTV proteins. The ORF amplicons in pGEX-4T-1
were expressed as GST fusion proteins in E. coli strain BL21 (Amersham
Pharmacia). The GST protein alone was also expressed as a control. IPTG
was used (0n4 mM) for 2-, 4-, 6- and 8-h inductions, both at room
temperature and at 37 mC. Cells were lysed as described previously
(So$ derlund et al., 1992). Whole-cell lysates were studied by 10 %
SDS–PAGE and protein bands were visualized with Coomassie stain
(Serva).
Immunoblotting. Proteins from SDS–PAGE were transferred to a
Protran nitrocellulose membrane (Schleicher & Schuell) at 400 mA for 2 h
(So$ derlund et al., 1992). Membranes were blocked with 5 % fat-free milk
powder (Valio) and 0n2 % Triton X-100 in PBS. For immunodetection of
the GST fusion proteins, the primary antibody was goat anti-GST
(1 : 1000 ; Amersham Pharmacia) and the secondary antibody was
peroxidase-conjugated, affinity purified rabbit anti-goat IgG (1 : 100 ;
Jackson Immunoresearch).
Human sera were diluted (in PBS containing 5 % milk powder and
0n2 % Triton X-100) 1 : 50 for IgG detection and 1 : 30 for IgM detection.
The respective peroxidase conjugates were horseradish peroxidaselabelled, rabbit anti-human IgG and IgM (Dako) ; bound antibodies were
detected with hydrogen peroxide and DAB (So$ derlund et al., 1992). Sera
showing antibody reactivity with the GST fusion proteins fp2a and fp2b
were re-examined with the expressed GST control protein and uninduced
lysates of E. coli. The possibility of rheumatoid factor interference in IgM
Universal PCR. A conserved sequence (nt 90–232) (Fig. 1),
immediately downstream of the untranslated region and partially
overlapping ORF2a, was amplified using primers NG133, NG147,
NG134 and NG132 (Okamoto et al., 1999a), resulting in a 110 bp
product. PCR mixtures contained 200 µM of each dNTP (Roche),
600 nM of each primer, 1n5 mM MgCl and 2n5 U of AmpliTaq Gold
#
polymerase (Applied Biosystems\Roche) in 25 µl. The sample volume in
the outer PCR was 8 µl and in the inner PCR was 2 µl. Amplification
conditions were as described by Okamoto et al. (1999a), except that both
PCRs comprised 35 cycles. Amplicons were detected by agarose gel
electrophoresis followed by EtBr staining.
Products of the universal PCR were confirmed by dot-blot hybridization. A digoxigenin-labelled 110 bp probe was prepared by incorporation
of digoxigenin-11 dUTP (Boehringer Mannheim) during a separate inner
universal PCR of cloned HEL32. Membranes were hybridized at 42 mC
overnight. Non-labelled amplicons of the probe PCR, the PCR product of
a TTV-negative control, pSTBlue-1 either with and without nt 1–222 of
HEL32 and water were included as the controls.
Three universal PCR products that were longer than expected, as well
as four randomly chosen amplicons, were cloned into pSTBlue-1 and the
plasmid inserts were sequenced.
N22 PCR. The N22 region of " 270 bp, illustrated in Fig. 1
(Nishizawa et al., 1997), was amplified by nested PCR using primers
TT6–9 (Ho$ hne et al., 1998). PCR conditions were as described for
universal PCR, except that annealing was at 42 mC and the elongation
time was 45 s, plus 3 min at the end.
Genotype 6 PCR and hybridization. Nested primers within the
N22 region were designed for genotype 6-specific detection of HEL32like DNA. The primers used were as follows : for outer PCR, forward 5h
CCCCTGGAGCATACCAAG 3h (nt 1805–1822) and reverse 5h CATGACCTCTAGCTGGTGGAAC 3h (nt 2181–2202) ; for inner PCR,
forward 5h CAGTATACTCAGAAAAGCAAAG 3h (nt 1898–1919) and
reverse 5h CATTTCCACCTCATTCTTATAGG 3h (nt 2146–2168).
Amplification conditions were as described for universal PCR, except that
the annealing temperature was 55 mC for the outer PCR and 52 mC for the
inner PCR.
The genotype 6 PCR products underwent dot-blot hybridization. A
digoxigenin-labelled 273 bp probe was prepared as described above, but
using the inner genotype 6 PCR primers and cloned HEL32 DNA as
template. The genotype 6 PCR products obtained were also sequenced.
Results
HEL32 cloning and sequence analysis
The overlapping 3269 bp and 222 bp PCR products (Fig. 1)
spanning nt 1–3381 were cloned and sequenced (GenBank
accession number AY034068). Comparison of the entire
sequences of HEL32 and the prototype TTV, TA278
(AB017610), revealed a divergence of 40 %. Phylogenetic
comparison of the ORF1 sequence of HEL32 with those of 29
other TTV DNA isolates (Okamoto et al., 2001) revealed by
high support values that HEL32 is unique (Fig. 2a). When
comparing only the N22 region between HEL32 and 42
sequences representing 20 TTV genotypes (Muljono et al.,
2001), HEL32 was most closely related to genotype 6 (Fig. 2b).
Sequence analysis of HEL32 DNA revealed three possible
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JIB
L. Kakkola and others
(a)
(b)
Fig. 2. A phylogenetic tree based on (a) ORF1 and (b) N22 sequences of TTV DNA isolates found in GenBank and HEL32.
Support values are given in numbers next to branches. Names of the TTV isolates are followed by the respective genotype
(/gX).
JIC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
ORF2 of TTV genotype 6
(a)
(b)
(c)
(d)
Fig. 3. Organization of TTV genomes. The ORFs in all three reading frames are illustrated. Representatives of four types of
genome organization among TTVs are shown : (a) HEL32/g6 (AY034068) ; (b) TUS01/g11 (AB017613) ; (c) TJN01/g12
(AB028668) ; and (d) TA278/g1 (AB017610). ORFs 1, 2a and 2b are shown with black arrows at the first respective
initiation codon. All initiation codons are indicated as short vertical bars, whereas long vertical bars represent stop codons.
ORFs (Figs 1 and 3a) : ORF1 in reading frame 1 (nt 583–2793),
ORF2a in reading frame 1 (nt 106–255) and ORF2b in reading
frame 2 (nt 239–709). Additional small ORFs were found in
reading frames 1 (nt 2857–2961), 2 (nt 2486–2812) and 3 (nt
2805–2984). A TATA box (TATAA) was recognized upstream
of ORF2a at nt 85 and a variant poly(A) sequence (ATTAAA)
was situated 186 nt downstream of the ORF1 gene.
The genomic organization of HEL32 was compared to
those of 41 TTV DNA isolates, representing 17 different
genotypes. Out of these 41 DNA isolates, 34 had an ORF2
organization that was similar to HEL32 (Fig. 3a–c), whereas
only seven (all of genotype 1) had an organization like that of
TA278 with a single ORF2 (Fig. 3d). Of the 34 HEL32-like
isolates with separate ORFs 2a and 2b, nine had an organization
identical to HEL32 (Fig. 3a), ten contained ORFs 2a and 2b in
the same reading frame, with a stop codon in between (Fig. 3b),
and 15 contained ORF2a in a reading frame distinct from that
of both ORFs 1 and 2b (Fig. 3c). ORF2b was defined as the
ORF comprising the conserved motif WX HX CX CX H
( $ " &
present in all TTVs and CAV (Hijikata et al., 1999b).
When the ORF2a sequences of all the 42 TTV DNA
isolates were compared to each other, this region was found to
(a)
(b)
Fig. 4. Expression of the TTV–GST fusion proteins fp2a and fp2b. (a)
Coomassie-stained SDS–PAGE of whole-cell lysates (induced for 8 h) and
(b) immunoblot with anti-GST antibody. Both uninduced (u) and induced
(i) cell lysates are shown.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JID
L. Kakkola and others
Table 1. TTV DNA prevalence in 87 non-symptomatic subjects correlated with IgM
reactivities for small TTV proteins
Number of subjects (%)
IgM for fp2a
PCR-positive
PCR-negative
Total
IgM for fp2b
PCR-positive
PCR-negative
Total
IgM j
IgM p
IgM k
2 (2)
0
2 (2n3)
2 (2)
1 (1)
3 (3n4)
71 (82)
11 (13)
82 (94n3)
75 (86)
12 (14)
87 (100)
4 (5)
2 (2)
6 (7)
5 (6)
1 (1)
6 (7)
66 (76)
9 (10)
75 (86)
75 (86)
12 (14)
87 (100)
Total (%)
Table 2. TTV DNA prevalence in 87 non-symptomatic subjects correlated with IgG
reactivities for small TTV proteins
Number of subjects (%)
IgG j
IgG for fp2a
PCR-positive
PCR-negative
Total
IgG for fp2b
PCR-positive
PCR-negative
Total
IgG p
IgG k
Total (%)
0
0
0
2 (2)
0
2 (2)
73 (84)
12 (14)
85 (98)
75 (86)
12 (14)
87 (100)
9 (10)
0
9 (10)
1 (1)
0
1 (1)
65 (75)
12 (14)
77 (89)
75 (86)
12 (14)
87 (100)
be highly conserved both at the nucleotide level and at the
amino acid level. The ORF2a nucleotide and amino acid
divergences between TA278 and HEL32 were 8 and 12 %,
respectively. Also, the length (49 aa) of the predicted ORF2a
product was conserved in 26 of 34 ORF2a-containing isolates.
The ORF2b region varied both in sequence (divergence of
50 %) and in length. The lengths of the predicted ORF1
products were found to vary by 646–816 aa. Interesting
exceptions were isolates US32 (detected by Erker et al., 1999)
and SENV-B, which had stop codons within the ORF1 regions
that disrupted the potential proteins. The ORF1-encoded
protein of HEL32 was predicted to be 736 aa in length and to
contain the conserved arginine-rich region described by
Okamoto et al. (1998) and Mushahwar et al. (1999).
Expression of TTV proteins
The three putative ORFs (ORFs 1, 2a and 2b) were
amplified by PCR and cloned into a GST fusion expression
JIE
plasmid. Both fp2a and fp2b were successfully expressed at 4,
6 and 8 h post-induction, both at room temperature and at
37 mC (Fig. 4a), with increasing yields over time. However, no
protein product was obtained from the ORF1–GST construct.
The correct molecular masses of fp2a (32 kDa), fp2b (43 kDa)
and the GST moiety (26 kDa) were confirmed by immunoblotting with an anti-GST antibody (Fig. 4b). In all future
assays, an 8 h induction at room temperature was used.
Antibody detection
For the detection of specific IgM and IgG antibodies, the
recombinant fp2a and fp2b proteins were used as antigen in
immunoblot experiments with serum samples from 89 nonsymptomatic adults (the TTV DNA or antibody status of 2 of
89 subjects changed during follow up and are therefore not
included in Tables 1 and 2). We classified as positive both very
strong and moderately strong antibody reactivities and as
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
ORF2 of TTV genotype 6
(a)
(c)
(b)
(d)
borderline, lighter bands (example shown in Fig. 5b). We
classified the result as negative if no, or extremely faint,
antibody reactivity was detectable or if repeated tests showed
poorly reproducible borderline results.
Of 87 subjects, 2 (2 %) showed strong fp2a IgM reactivity
(Table 1). Both were fp2a and fp2b IgG-negative. Strong fp2b
IgM reactivity was observed in six (7 %) subjects (Table 1), one
of which was also strongly IgG-positive for the same TTV
protein. By inclusion of borderline results, these IgM prevalences would rise to 6 and 14 %, respectively. By universal
PCR, 6 of 8 strongly fp2 IgM-positive subjects were also TTV
DNA-positive. Among the 87 subjects, strong fp2a IgG
reactivity was not seen, whereas borderline reactivity was seen
in two (2 %) subjects (Table 2). Strong fp2b IgG reactivity was
found in 9 of 87 (10 %) subjects, in addition to one borderline
result (Table 2). All subjects with strong or borderline fp2a or
fp2b IgG results had circulating TTV DNA, i.e. all TTV DNAnegative subjects were also IgG-negative for both antigens.
On the other hand, among the 63 seronegative subjects, 55
(87 %) contained TTV DNA in their serum.
None of the TTV antibody-positive sera showed comparable reactivity with lysates of uninduced E. coli or with the
GST protein moiety (Fig. 5). The IgM result of the only sample
that was both IgM- and IgG-positive for the same antigen
(fp2b), was retained after Gullsorb treatment, i.e. it was not
abrogated by the removal of IgG.
Follow-up studies
Sequential serum samples covering 12–15 years were
available from three subjects and a fourth subject was followed
for 1n5 years (Fig. 6). The DNA and antibody status remained
unaltered in two subjects (F26 and F55), who maintained very
strong fp2b-specific IgM reactivity but no IgG reactivity in all
samples. Both subjects were TTV DNA-positive for at least 14
and 15 years, respectively. The DNA and antibody status of
two subjects changed with time. Subject F1 showed strong
Fig. 5. Immunoblot of whole-cell lysates
with expressed fp2a and fp2b, stained
with human sera : (a) a strong IgM
response to fp2b ; (b) a borderline IgM
response to fp2a and fp2b ; (c) a strong
IgG response to fp2a (subject F1 of Fig.
6 ; the only such response observed ; data
not included in Table 2) ; and (d) a strong
IgG response to fp2b. Arrows indicate the
respective fp2 bands. Both uninduced (u)
and induced (i) cell lysates are shown.
Induced GST protein was included as a
negative control.
fp2b IgM reactivity for three years, after which it gradually
declined below levels of detection. This subject was the only
one in the study presenting with strong fp2a IgG immunoreactivity, which, furthermore, persisted throughout the 12
year follow-up period. Only the last sample was TTV DNApositive. Subject F97 showed fluctuating borderline fp2b IgM
and IgG reactivity for 1n5 years and, in the last sample,
converted to TTV DNA-positivity. The TTV strains of
subjects F1 and F97, detected by universal PCR, were (as
described below) closely related to the TTV-like miniviruses
(TLMV ; Okamoto et al., 2000a ; Takahashi et al., 2000).
Prevalence of TTV DNA
Serum samples of all 89 subjects were studied for TTV
DNA by universal PCR. The sera of most (80) subjects were
also analysed by N22 PCR. Each PCR was repeated at least
once and the universal PCR results were confirmed by dotblotting and sequencing. Six samples showed poorly reproducible results in universal PCR, probably due to low DNA
concentrations, but were considered to be TTV DNA-positive.
All water controls were always negative.
TTV DNA in serum was detected by universal PCR in 85 %
(74 of 87) of the subjects (Tables 1 and 2). Two additional
subjects became positive during follow-up (see above and
Fig. 6). The less sensitive, or more specific (detecting fewer
genotypes), N22 PCR was positive in 18 % (14 of 80) of
subjects, one of whom was negative by universal PCR. Thus,
the overall prevalence of TTV DNA among these 87 nonsymptomatic subjects was 86 % (75 of 87).
By universal PCR, three samples (subjects F1, 52 and 97)
gave PCR products that were longer than expected (130–160
bp versus 110 bp) and did not hybridize with the TTV probe.
To avoid potential interference of multiple genotypes in
sequencing, these three amplicons were cloned into plasmids
and sequenced. Sequence comparison, using the  and
 programs, showed that all three sequences grouped
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JIF
L. Kakkola and others
Fig. 6. Prevalence of TTV DNA and antibodies in three patients followed up over a 12–15 year period and one patient followed
up over a 1n5 year period. ND, Not done.
with those of TLMVs (Okamoto et al., 2000a ; Takahashi et al.,
2000) (data not shown).
Genotype 6 DNA detection
For detection of TTVs of the HEL32 genotype, samples of
all 17 IgM- and\or IgG-positive subjects (15 of whom were, or
became, TTV DNA-positive) and 18 antibody negative
subjects (16 of whom were TTV DNA-positive), including all
samples of three subjects followed up (F1, F26 and F55), were
studied by genotype 6 PCR. Serum of the HEL32 donor and
the plasmid clone were included as positive controls. PCR
results were confirmed both by sequencing and by hybridization with a genotype 6-specific probe.
By genotype 6 PCR, only 2 (F23 and F86) of 35 subjects,
in addition to the HEL32 donor, had TTV of genotype 6,
revealing a genotype 6 DNA prevalence of 8n6 % in total and
9n7 % (3 of 31) in the TTV DNA-positive group. Comparison
of the amplified DNA sequences of subjects F23 and F86 to
that of HEL32 revealed 2 and 8 of 213 nucleotide differences,
respectively. Subject F23 was also universal, but not N22
JIG
PCR-positive, whereas subject F86 was both universal and
N22 PCR-positive. Both subjects had IgG antibodies for fp2b.
The donor of our HEL32 clone, on the other hand, lacked
antibodies for fp2a and fp2b, but was both universal and N22
PCR-positive and, based on the sequenced PCR products,
carried at least two other TTV genotypes (data not shown).
Discussion
We have cloned the near-full-length genome of a TTV
(HEL32), which, based on sequence comparison, is closely
related to genotype 6. This is, to our knowledge, the first
description of a genotype 6 TTV genome. By phylogenetic
analysis of the ORF1 gene, our HEL32 DNA isolate was
distant from all other TTV DNA isolates. A conserved TATA
box was, however, found to begin at nt 85, as in other TTV
genotypes (Miyata et al., 1999 ; Okamoto et al., 1999b ;
Kamahora et al., 2000 ; Tanaka et al., 2000), whereas a conserved poly(A) signal, located 177 nt downstream of ORF1
(Erker et al., 1999), was not found in HEL32. Instead, a variant
poly(A) signal (ATTAAA) was identified 186 nt downstream
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
ORF2 of TTV genotype 6
of ORF1. Okamoto et al. (1998) reported that strain TA278
contained such a variant motif but at a different location.
In CAV, the longest ORF encodes the capsid protein,
whereas the other ORFs encode non-structural proteins (Todd
et al., 1990 ; Noteborn et al., 1992 ; Douglas et al., 1995 ; Kato
et al., 1995). In light of the similarity of genome organization,
TTV ORF1 could encode the capsid protein and ORFs 2a and
2b the non-structural proteins. We compared the ORF2
sequences of 18 genotypes (altogether 41 sequences obtained
from GenBank, plus our HEL32 strain) and found ORF2a to be
highly conserved in all TTV strains. In contrast, the ORF2b
sequences varied extensively. This has been reported previously, albeit with fewer genotypes (Erker et al., 1999 ; Tanaka
et al., 2000).
In HEL32, ORFs 1 and 2a are in the same reading frame and
ORF2b is in a separate one, partly overlapping ORF2a. Similar
genomic organizations were found in several genotypes.
Starting at A"!'TG in frame 1, the ORF2a of HEL32 encodes
a putative protein of 49 aa. ORF2b, in frame 2, contains three
possible transcription initiation sites at nt 239, 272 and 356,
and the longest transcript encodes a putative protein of 156 aa.
In recent TTV mRNA studies, due to late transcription start
sites and splicing (removing the first two initiation sites), only
the third ATG at nt 353 or 338 was suggested to be used for
translation of the ORF2 gene (Kamahora et al., 2000 ; Okamoto
et al., 2000b). Consequently, if this would apply for HEL32, the
ORF2a-encoded protein would not be produced at all and the
ORF2b-encoded protein would be shortened considerably.
However, by Kozak’s criteria (Kozak, 1996), this third A$&'TG
of ORF2b in HEL32 is in a weak context for initiation and is
therefore not likely to be a start site, whereas the context of the
first A#$*TG is considered to be strong. Alternative transcription initiation (Ellis et al., 1987 ; Suzuki et al., 2001) and
splicing may thereby occur in HEL32-like TTV genotypes,
allowing the use of these first initiator codons. Interestingly,
we found in every single TTV sequence, at nt " 107, an ATG
initiation site that adequately satisfied Kozak’s criteria (Kozak,
1996). The short 5h leader upstream of this ATG would not
necessarily hinder translation, as shown for even shorter
leaders (Ellis et al., 1987 ; Maicas et al., 1990). Furthermore,
based on sequence comparison, the ORF2a region is highly
conserved among all genotypes (also at the protein level).
Obviously, this highly conserved area has some important
function, either at the protein level or at the nucleotide level.
Finally, by in vitro transcription and translation, the full-length
202 aa protein of genotype 1 ORF2 has been produced,
beginning from A"!(TG (Tanaka et al., 2000). However, in a
genotype 3-related isolate with a divided ORF2, ORF2a,
starting at A"!(TG was, for some reason, not translated. The
translation of ORF2b began at the first A#'$TG initiation site.
The more important in vivo effects of transcription and
translation initiation sites and alternative splicing of ORFs 2a
and 2b of HEL32 genotype 6 (and other similar genotypes)
remain to be studied.
We have in E. coli productively expressed both of the
HEL32 ORF2 putative protein-coding regions, ORFs 2a (nt
106–255) and 2b (nt 239–709). Interestingly, ORF1 resisted
expression, possibly due to the cytotoxicity of the product.
The suitability of the corresponding recombinant proteins fp2a
and fp2b as antigens for the detection of specific IgM and IgG
antibodies was investigated in constitutionally healthy adults.
Fp2a- and fp2b-specific IgM antibodies were found in an
unexpectedly high (" 9 %) prevalence. By using TTV particles
of faecal origin, short-lived IgM responses have been previously detected in three liver patients but not in healthy
controls (Tsuda et al., 2001). Another study found no IgM
reactivity against the C terminus of the ORF1 protein among
patients with hepatitis of unknown aetiology or among blood
donors or healthy children (Ott et al., 2000). In most virus
infections, the typical IgM responses are early and short-lived.
However, we observed strong fp2b IgM responses that
persisted for years. Most of our fp2 IgM-positive individuals
were fp2 IgG-negative but carried circulating TTV DNA, a
pattern that could possibly infer an acute stage preceding virus
clearance. However, such a conclusion lends no support to
our follow-up study, where persistent IgM and DNA coexisted. The reason for the absence of an immunoglobulin class
shift (IgM IgG) in our long-term follow-up subjects is at
present unknown. One possible reason could be impaired
helper T-cell activity, which in turn might be due to T-cell
cross-tolerance against multiple TTV genotypes.
In the present study, fp2a- and fp2b-specific IgG antibodies
were also detected but, relative to IgM, in a surprisingly low
(10 %) prevalence. Interestingly, all the IgG-positive subjects
had TTV DNA in their sera. Two other immunoblot studies,
using prokaryotically expressed proteins of TTV genotype 1
as antigen, have reported considerably higher TTV IgG
prevalence values of 38 % for the N-terminal ORF1 product
(Handa et al., 2000) and 98n6 % for the C-terminal part (Ott et
al., 2000). In both studies, the ORF1-specific antibodies and
TTV DNA coexisted. In light of their high prevalence (Ott et
al., 2000), the ORF1-specific antibodies could be highly crossreactive and non-protective.
Using two nested PCRs, we found the prevalence of TTV
DNA to be 86 %. This result is in line with a previous study
that reported a TTV DNA prevalence of 73 % in Finnish blood
donors (Simmonds et al., 1999). Other studies worldwide have
yielded comparable values of TTV DNA prevalence ; e.g. for
Italian blood donors, the prevalence of TTV DNA was 87n5 %
(Zehender et al., 2001) and for healthy Japanese subjects, the
prevalence of TTV DNA was 94 % (Hijikata et al., 1999a ; reviewed Bendinelli et al., 2001).
By genotype 6-specific PCR, 3 of 35 (8n6 %) subjects had
TTV of genotype 6. However, because HEL32 is the only
available (long) sequence of TTV genotype 6, the extent of
intra-genotype sequence variation in the amplified regions that
could affect the PCR result is not known. Of the three subjects
with genotype 6 DNA, two had coexistent fp2b IgG but none
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JIH
L. Kakkola and others
had IgM. The donor of our HEL32 clone carried at least two
other TTV genotypes. Superinfections with several TTV
genotypes are well documented, inferring lack of intergenotype protection (Okamoto et al., 1999a ; Takayama et al.,
1999 ; Niel et al., 2000 ; Romeo et al., 2000).
Altogether, our results suggest that the ORF2 proteinspecific antibodies are not cross-protective, because TTV DNA
was found to coexist with the fp2 antibodies. The fp2b-specific
antibodies could, theoretically, also be genotype-specific,
because (1) the ORF2b sequence varies considerably among
different TTV genotypes and (2) the fp2b antibodies were
detected only in a minority of our subjects. On the other hand,
the ORF2a sequences are very similar in all genotypes, also at
the putative protein level. Consequently, antibodies for this
protein are not likely to be genotype-specific. The very low
prevalence of fp2a-specific antibodies could result from
inefficient protein production (Kamahora et al., 2000 ; Okamoto
et al., 2000b ; Ellis et al., 1987), as discussed above. The low
prevalence of fp2 antibody and the apparent lack of crossprotectiveness of these antibodies could also be easily
understandable assuming that these proteins are non-structural
and intracellular. Furthermore, it should be kept in mind that
immunoblotting tends to favour antibodies against linear
epitopes, the relative proportion of which may change during
the course of virus infection (So$ derlund et al., 1995 ; Kaikkonen
et al., 1999). Furthermore, prokaryotic expression does not
create the post-translational modifications that may be required
for optimal antigenicity. Finally, an interesting possibility is
that the ORF2 antibodies are produced at very low levels in
healthy individuals but more abundantly in some diseases yet
to be associated with this virus, as has been suggested (von
Poblotzki et al., 1995 ; Hemauer et al., 2000) for the nonstructural protein of parvovirus B19, another human singlestranded DNA virus.
The authors would like to thank Tarja Sironen for help in the
construction of the phylogenetic trees and Anna Harju and Sanna Ilvonen
for excellent technical assistance. This research was financially supported
by the Helsinki Biomedical Graduate School, The Sohlberg Foundation,
the ERASMUS (Socrates) student exchange program, the Finnish
Foundation for Research on Viral Diseases, The Finnish Technology
Advancement Fund, the Helsinki University Central Hospital Research
and Education Fund and the Finnish Academy (project F76132).
Douglas, A. J., Phenix, K., Mawhinney, K. A., Todd, D., Mackie, D. P. &
Curran, W. L. (1995). Identification of a 24 kDa protein expressed by
chicken anaemia virus. Journal of General Virology 76, 1557–1562.
Ellis, S. R., Hopper, A. K. & Martin, N. C. (1987). Amino-terminal
extension generated from an upstream AUG codon is not required for
mitochondrial import of yeast N#,N#-dimethylguanosine-specific tRNA
methyltransferase. Proceedings of the National Academy of Science, USA 84,
5172–5176.
Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar,
I. K. (1999). Analyses of TT virus full-length genomic sequences. Journal
of General Virology 80, 1743–1750.
Felsenstein, J. C. (1989). PHYLIP : Phylogeny Interference Package,
version 3.2. Cladistics 5, 164–166.
Gallian, P., Berland, Y., Olmer, M., Raccah, D., de Micco, P., Biagini, P.,
Simon, S., Bouchouareb, D., Mourey, C., Roubicek, C., Touinssi, M.,
Cantaloube, J.-F., Dussol, B. & de Lamballerie, X. (1999). TT virus
infection in French hemodialysis patients : study of prevalence and risk
factors. Journal of Clinical Microbiology 37, 2538–2542.
Gallian, P., Biagini, P., Zhong, S., Touinssi, M., Yeo, W., Cantaloube,
F. J., Attoui, H., de Micco, P., Johnson, P. J. & de Lamballerie, X. (2000).
TT virus : a study of molecular epidemiology and transmission of
genotypes 1, 2 and 3. Journal of Clinical Virology 17, 43–49.
Handa, A., Dickstein, B., Young, N. S. & Brown, K. E. (2000).
Prevalence of the newly described human circovirus, TTV, in United
States blood donors. Transfusion 40, 245–251.
Hasegawa, M., Kishino, H. & Yano, T. (1985). Dating of the human–ape
splitting by a molecular clock of mitochondrial DNA. Journal of Molecular
Evolution 22, 160–174.
Hemauer, A., Gigler, A., Searle, K., Beckenlehner, K., Raab, U.,
Broliden, K., Wolf, H., Enders, G. & Modrow, S. (2000). Seroprevalence
of parvovirus B19 NS1-specific IgG in B19-infected and uninfected
individuals and in infected pregnant women. Journal of Medical Virology
60, 48–55.
Hijikata, M., Iwata, K., Ohta, Y., Nakao, K., Matsumoto, M., Matsumoto,
H., Kanai, K., Baba, K., Samokhvalov, E. I. & Mishiro, S. (1999a).
Genotypes of TT virus (TTV) compared between liver disease patients
and healthy individuals using a new PCR system capable of differentiating
1a and 1b types from others. Archives of Virology 144, 2345–2354.
Hijikata, M., Takahashi, K. & Mishiro, S. (1999b). Complete circular
DNA genome of a TT virus variant (isolate name SANBAN) and 44
partial ORF2 sequences implicating a great degree of diversity beyond
genotypes. Virology 260, 17–22.
Ho$ hne, M., Berg, T., Mu$ ller, A. R. & Schreier, E. (1998). Detection of
sequences of TT virus, a novel DNA virus, in German patients. Journal of
General Virology 79, 2761–2764.
Itoh, Y., Takahashi, M., Fukuda, M., Shibayama, T., Ishikawa, T., Tsuda,
F., Tanaka, T., Nishizawa, T. & Okamoto, H. (2000). Visualization of TT
References
Ball, J. K., Curran, R., Berridge, S., Grabowska, A. M., Jameson, C. L.,
Thomson, B. J., Irving, W. L. & Sharp, P. M. (1999). TT virus sequence
heterogeneity in vivo : evidence for co-infection with multiple genetic
types. Journal of General Virology 80, 1759–1768.
Bendinelli, M., Pistello, M., Maggi, F., Fornai, C., Freer, G. & Vatteroni,
M. L. (2001). Molecular properties, biology, and clinical implications of
TT virus, a recently identified widespread infectious agent of humans.
Clinical Microbiology Reviews 14, 98–113.
Biagini, P., Gallian, P., Attoui, H., Cantaloube, J.-F., de Micco, P. & de
Lamballerie, X. (1999). Determination and phylogenetic analysis of
JII
partial sequences from TT virus isolates. Journal of General Virology 80,
419–424.
virus particles recovered from the sera and feces of infected humans.
Biochemical and Biophysical Research Communications 279, 718–724.
Kaikkonen, L., Lankinen, H., Harjunpa$ a$ , I., Hokynar, K., So$ derlundVenermo, M., Oker-Blom, C., Hedman, L. & Hedman, K. (1999). Acute-
phase-specific heptapeptide epitope for diagnosis of parvovirus B19
infection. Journal of Clinical Microbiology 37, 3952–3956.
Kamahora, T., Hino, S. & Miyata, H. (2000). Three spliced mRNAs of
TT virus transcribed from a plasmid containing the entire genome in
COS1 cells. Journal of Virology 74, 9980–9986.
Kato, A., Fujino, M., Nakamura, T., Ishihama, A. & Otaki, Y. (1995).
Gene organization of chicken anemia virus. Virology 209, 480–488.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
ORF2 of TTV genotype 6
Kozak, M. (1996). Interpreting cDNA sequences : some insights from
studies on translation. Mammalian Genome 7, 563–574.
Luo, K., Liang, W., He, H., Yang, S., Wang, Y., Xiao, H., Liu, D. & Zhang,
L. (2000). Experimental infection of nonenveloped DNA virus (TTV) in
rhesus monkey. Journal of Medical Virology 61, 159–164.
Maicas, E., Shago, M. & Friesen, J. D. (1990). Translation of the
Saccharomyces cerevisiae tcm1 gene in the absence of a 5h-untranslated
leader. Nucleic Acids Research 18, 5823–5828.
Miyata, H., Tsunoda, H., Kazi, A., Yamada, A., Khan, M. A., Murakami,
J., Kamahora, T., Shiraki, K. & Hino, S. (1999). Identification of a novel
GC-rich 113-nucleotide region to complete the circular, single-stranded
DNA genome of TT virus, the first human circovirus. Journal of Virology
73, 3582–3586.
Muljono, D. H., Nishizawa, T., Tsuda, F., Takahashi, M. & Okamoto, H.
(2001). Molecular epidemiology of TT virus (TTV) and characterization
of two novel TTV genotypes in Indonesia. Archives of Virology 146,
1249–1266.
Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons,
J. N., Birkenmeyer, L. G., Chalmers, M. L., Pilot-Matias, T. J. & Desai,
S. M. (1999). Molecular and biophysical characterization of TT virus :
evidence for a new virus family infecting humans. Proceedings of the
National Academy of Sciences, USA 96, 3177–3182.
Niel, C., Saback, F. L. & Lampe, E. (2000). Coinfection with multiple TT
virus strains belonging to different genotypes is a common event in
healthy Brazilian adults. Journal of Clinical Microbiology 38, 1926–1930.
Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y.
& Mayumi, M. (1997). A novel DNA virus (TTV) associated with
elevated transaminase levels in posttransfusion hepatitis of unknown
etiology. Biochemical and Biophysical Research Communications 241, 92–97.
Nishizawa, T., Okamoto, H., Tsuda, F., Aikawa, T., Sugai, Y., Konishi,
K., Akahane, Y., Ukita, M., Tanaka, T., Miyakawa, Y. & Mayumi, M.
(1999). Quasispecies of TT virus (TTV) with sequence divergence in
hypervariable regions of the capsid protein in chronic TTV infection.
Journal of Virology 73, 9604–9608.
Noteborn, M. H. M., Kranenburg, O., Zantema, A., Koch, G., de Boer,
G. F. & van der Eb, A. J. (1992). Transcription of the chicken anemia
Sai, T. & Sugai, Y. (2000b). TT virus mRNAs detected in the bone
marrow cells from an infected individual. Biochemical and Biophysical
Research Communications 279, 700–707.
Okamoto, H., Nishizawa, T., Takahashi, M., Asabe, S., Tsuda, F. &
Yoshikawa, A. (2001). Heterogeneous distribution of TT virus of
distinct genotypes in multiple tissues from infected humans. Virology
288, 358–368.
Ott, C., Duret, L., Chemin, I., Tre! po, C., Mandrand, B. & KomurianPradel, F. (2000). Use of a TT virus ORF1 recombinant protein to
detect anti-TT virus antibodies in human sera. Journal of General Virology
81, 2949–2958.
Romeo, R., Hegerich, P., Emerson, S. U., Colombo, M., Purcell, R. H. &
Bukh, J. (2000). High prevalence of TT virus (TTV) in naive chimpanzees
and in hepatitis C virus-infected humans : frequent mixed infections and
identification of new TTV genotypes in chimpanzees. Journal of General
Virology 81, 1001–1007.
Saback, F. L., Gomes, S. A., de Paula, V. S., da Silva, R. R. S., LewisXimenez, L. L. & Niel, C. (1999). Age-specific prevalence and
transmission of TT virus. Journal of Medical Virology 59, 318–322.
Simmonds, P., Prescott, L. E., Logue, C., Davidson, F., Thomas, A. E.
& Ludlam, C. A. (1999). TT-virus : part of the normal human flora?
Journal of Infectious Diseases 180, 1748–1750.
So$ derlund, M., Brown, K. E., Meurman, O. & Hedman, K. (1992).
Prokaryotic expression of a VP1 polypeptide antigen for diagnosis by a
human parvovirus B19 antibody enzyme immunoassay. Journal of Clinical
Microbiology 30, 305–311.
So$ derlund, M., Brown, C. S., Spaan, W. J. M., Hedman, L. & Hedman,
K. (1995). Epitope type-specific IgG responses to capsid proteins VP1
and VP2 of human parvovirus B19. Journal of Infectious Diseases 172,
1431–1436.
Strimmer, K. & von Haesler, A. (1997). Quartet puzzling : a quartet
maximum likelihood method for reconstructing tree topologies. Molecular Biology and Evolution 13, 964–969.
Suzuki, Y., Taira, H., Tsunoda, T., Mizushima-Sugano, J., Sese, J., Hata,
H. and others (2001). Diverse transcriptional initiation revealed by fine,
terization of a novel DNA virus (TTV) associated with posttransfusion
hepatitis of unknown etiology. Hepatology Research 10, 1–16.
large-scale mapping of mRNA start sites. EMBO Reports 2, 388–393.
Takahashi, K., Iwasa, Y., Hijikata, M. & Mishiro, S. (2000). Identification
of a new human DNA virus (TTV-like mini virus, TLMV) intermediately
related to TT virus and chicken anemia virus. Archives of Virology 145,
979–993.
Takayama, S., Yamazaki, S., Matsuo, S. & Sugii, S. (1999). Multiple
infection of TT virus (TTV) with different genotypes in Japanese
hemophiliacs. Biochemical and Biophysical Research Communications 256,
208–211.
Okamoto, H., Takahashi, M., Nishizawa, T., Ukita, M., Fukuda, M.,
Tsuda, F., Miyakawa, Y. & Mayumi, M. (1999a). Marked genomic
Tanaka, Y., Orito, E., Ohno, T., Nakano, T., Hayashi, K., Kato, T.,
Mukaide, M., Iida, S. & Mizokami, M. (2000). Identification of a novel
virus (CAV) genome and synthesis of its 52-kDa protein. Gene 118,
267–271.
Okamoto, H. & Mayumi, M. (2001). TT virus : virological and genomic
characteristics and disease associations. Journal of Gastroenterology 36,
519–529.
Okamoto, H., Nishizawa, T., Kato, N., Ukita, M., Ikeda, H., Iizuka, H.,
Miyakawa, Y. & Mayumi, M. (1998). Molecular cloning and charac-
heterogeneity and frequent mixed infection of TT virus demonstrated by
PCR with primers from coding and noncoding regions. Virology 259,
428–436.
23 kDa protein encoded by putative open reading frame 2 of TT virus
(TTV) genotype 1 different from the other genotypes. Archives of
Virology 145, 1385–1398.
Okamoto, H., Nishizawa, T., Ukita, M., Takahashi, M., Fukuda, M.,
Iizuka, H., Miyakawa, Y. & Mayumi, M. (1999b). The entire nucleotide
Tawara, A., Akahane, Y., Takahashi, M., Nishizawa, T., Ishikawa, T. &
Okamoto, H. (2000). Transmission of human TT virus of genotype 1a
sequence of a TT virus isolate from the United States (TUS01) :
comparison with reported isolates and phylogenetic analysis. Virology
259, 437–448.
to chimpanzees with fecal supernatant or serum from patients with acute
TTV infection. Biochemical and Biophysical Research Communications 278,
470–476.
Okamoto, H., Nishizawa, T., Tawara, A., Peng, Y., Takahashi, M.,
Kishimoto, J., Tanaka, T., Miyakawa, Y. & Mayumi, M. (2000a). Species-
Todd, D., Creelan, J. L., Mackie, D. P., Rixon, F. & McNulty, M. S.
(1990). Purification and biochemical characterization of chicken anaemia
specific TT viruses in humans and nonhuman primates and their
phylogenetic relatedness. Virology 277, 368–378.
agent. Journal of General Virology 71, 819–823.
Okamoto, H., Nishizawa, T., Tawara, A., Takahashi, M., Kishimoto, J.,
Tsuda, F., Okamoto, H., Ukita, M., Tanaka, T., Akahane, Y., Konishi, K.,
Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1999). Determination of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44
JIJ
L. Kakkola and others
antibodies to TT virus (TTV) and application to blood donors and
patients with post-transfusion non-A to G hepatitis in Japan. Journal of
Virological Methods 77, 199–206.
Tsuda, F., Takahashi, M., Nishizawa, T., Akahane, Y., Konishi, K.,
Yoshizawa, H. & Okamoto, H. (2001). IgM-class antibodies to TT virus
(TTV) in patients with acute TTV infection. Hepatology Research 19, 1–11.
von Poblotzki, A., Gigler, A., Lang, B., Wolf, H. & Modrow, S. (1995).
Antibodies to parvovirus B19 NS-1 protein in infected individuals.
Journal of General Virology 76, 519–527.
JJA
Worobey, M. (2000). Extensive homologous recombination among
widely divergent TT viruses. Journal of Virology 74, 7666–7670.
Zehender, G., Manzin, A., De Maddalena, C., Colasante, C., Solforosi,
L., Corsi, F., Bianchi-Bosisio, A., Girotto, M., Schirru, I., Russo, U., Galli,
M. & Clementi, M. (2001). Molecular epidemiology of TT virus in Italy
and phylogenesis of viral isolates from subjects at different risk for
parenteral exposure. Journal of Medical Virology 63, 76–84.
Received 16 May 2001 ; Accepted 7 January 2002
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 16 Jun 2017 14:09:44