Geminating Pollen Has Tubular Vacuoles, Displays
Highly Dynamic Vacuole Biogenesis, and Requires
VACUOLESS1 for Proper Function1[w]
Glenn R. Hicks, Enrique Rojo2, Seho Hong3, David G. Carter, and Natasha V. Raikhel*
Center for Plant Cell Biology and Department of Botany and Plant Sciences, University of California,
Riverside, Riverside, California 92521
Vacuoles perform multiple functions in plants, and VCL1 (VACUOLESS1) is essential for biogenesis with loss of expression
in the vcl1 mutant leading to lethality. Vacuole biogenesis plays a prominent role in gametophytes, yet is poorly understood.
Given the importance of VCL1, we asked if it contributes to vacuole biogenesis during pollen germination. To address this
question, it was essential to first understand the dynamics of vacuoles. A tonoplast marker, ␦-TIP::GFP, under a pollenspecific promoter permitted the examination of vacuole morphology in germinating pollen of Arabidopsis. Our results
demonstrate that germination involves a complex, yet definable, progression of vacuole biogenesis. Pollen vacuoles are
extremely dynamic with remarkable features such as elongated (tubular) vacuoles and highly mobile cytoplasmic invaginations. Surprisingly, vcl1 did not adversely impact vacuole morphology in pollen germinated in vitro. To focus further on
VCL1 in pollen, reciprocal backcrosses demonstrated reduced transmission of vcl1 through male gametophytes, indicating
that vcl1 was expressive after germination. Interestingly, vcl1 affected the fertility of female gametophytes that undergo
similarly complex vacuole biogenesis. Our results indicate that vcl1 is lethal in the sporophyte but is not fully expressive in
the gametophytes. They also point to the complexity of pollen vacuoles and suggest that the mechanism of vacuole
biogenesis in pollen may differ from that in other plant tissues.
Vacuoles perform numerous functions in plant
cells such as the storage and degradation of proteins
and other cellular components, osmoregulation, and
the modulation of turgor during growth (Bassham
and Raikhel, 2000; De, 2000).
These diverse roles are reflected in the fact that
there are several distinct types of vacuoles: lytic
vacuoles and protein storage vacuoles (Bassham and
Raikhel, 2000). One distinguishing feature of vacuoles is the presence of tonoplast intrinsic proteins
(TIPs) in their membranes (Juah et al., 1999). Thus,
the expression of gene fusions between TIPs and
reporter proteins such as green fluorescent protein
(GFP) provide a sensitive and specific means of detecting vacuole dynamics in vivo (Cutler et al., 2000;
Avila et al., 2003).
The large central vacuoles characteristic of many
plant cells are thought to arise via fusion of lytic and
storage vacuoles (Vitale and Raikhel, 1999). These
1
This work was supported by the Department of Energy (grant
no. DE–FG03– 02ER15295/A000 to N.V.R.).
2
Present address: Departamento de Genetica Molecular de
Plantas, Centro Nacional de Biotecnologia, Consejo Superior de
Investigaciones Cientifas, E–28049 Madrid, Spain.
3
Present address: Department of Biological Sciences, KAISTYusong Gu, Daejon, Republic of Korea.
[w]
The online version of this article contains Web-only data.
* Corresponding author; e-mail [email protected]; fax
909 –787– 4437.
Article, publication date, and citation information can be found
at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.037382.
and other membrane fusion events are mediated by
SNAREs and several other families of factors. The
availability of the Arabidopsis genome sequence has
facilitated the identification of many components of
the membrane fusion machinery in plants (Sanderfoot et al., 2000). However, only recently have components been described that are necessary for vacuole biogenesis.
The Arabidopsis gene VCL1 (VACUOLESS1) is essential for vacuole biogenesis (Rojo et al., 2001), and
the effects of homozygous VCL1 inactivation have
been examined in the T-DNA mutant known as vcl1.
This mutant is blocked in vacuole formation in the
embryo, displays altered development, and accumulates small vesicles and autophagosomes. The defects
lead to aberrant suspensor development, growth arrest, and lethality at the torpedo stage of embryogenesis, clearly indicating that proper vacuole biogenesis
is essential for plant viability. In Arabidopsis, VCL1
appears to be a single gene with no known homologs.
In addition to other evidence indicating that this
protein is involved in vacuole biogenesis (Rojo et al.,
2001), VCL1 shares significant protein identity (24%
overall) and structural similarity with yeast (Saccharomyces cerevisiae) Vps16p, which is part of the Class
C-Vsp (C-Vps) complex that facilitates both homotypic vacuole fusion and Golgi-derived vesicle fusion
with the tonoplast in yeast (Sato et al., 2000). An
analogous complex (AtC-VSP complex) has been localized to the Arabidopsis tonoplast and prevacuolar
compartments and has been shown to include
from on June
16, 2017 - Published
www.plantphysiol.org
Plant Physiology, March 2004, Vol.Downloaded
134, pp. 1227–1239,
www.plantphysiol.org
© by
2004
American Society of Plant Biologists
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1227
Hicks et al.
AtVPS11 and AtVPS33, which are homologs of their
respective yeast proteins (Rojo et al., 2003). Other
syntaxins (SYP21 and SYP22) are associated with the
complex and may play a role in membrane fusion.
The similarity between yeast and plants not withstanding, VCL1 is essential in plants, whereas Vps16
is not essential in yeast (Horazdovsky and Emr,
1993).
Vacuole biogenesis during gametogenesis is poorly
understood yet plays a prominent role in the development of male and female gametophytes. During
microspore development, small dispersed vacuoles
undergo fusion, leading to a highly vacuolated microspore. After the first pollen mitosis in Arabidopsis, the large vegetative cell vacuole of bicellular
pollen undergoes fission. The mature tricellular pollen that results after the second mitosis once more
contains many dispersed vacuoles (Van Aelst et al.,
1993; Kuang and Musgrave, 1996; Twell et al., 1998;
Yamamoto et al., 2003). Such morphological changes
in vacuoles are apparent throughout pollen germination and lead to the formation of a large central
vacuole in the pollen grain and numerous vacuoles in
the rapidly growing pollen tube (Derksen et al.,
2002). Organelles have been observed to move rapidly and bidirectionally in the pollen tube in a pattern
described as reverse fountain streaming (Pierson and
Cresti, 1992; for review, see Hepler et al., 2001). As
the pollen tube elongates, callose plugs are formed at
intervals starting at the base of the tube such that the
metabolically active cytoplasm is maintained at the
growing tip (for example, see Laitiainen et al., 2002).
It has been speculated that these highly dynamic
events in vacuole biogenesis are important or even
essential for pollen function by providing a motive
force for turgor-driven growth and, as a part of the
endomembrane system, by facilitating cell wall biosynthesis (Hepler et al., 2001; Lord and Russell, 2002).
Female gametophytes undergo similarly complex developmental events during megagametogenesis including vacuole biogenesis (Drews and Yadegari,
2002). Female gametophytic mutants of Arabidopsis
have been described that display decreased inheritance through female gametophytes or through male
and female gametophytes. Several of the mutants are
affected in vacuole morphology (Christensen et al.,
1998; Drews et al., 1998). Because male and female
gametophytes are haploid, expressed genes, even
those that may be recessive in the sporophyte, can
exert an influence on ovule or pollen development
and function.
Given the importance of vacuole biogenesis in
plant development, we asked if VCL1, which is essential for vacuole formation during embryogenesis,
plays a role in Arabidopsis gametophyte function.
Pollen is a particularly attractive tissue because it can
be examined as an organism free of the sporophyte,
and germination can be examined in vitro. Beyond
our first steps toward defining the role of VCL1 in
1228
pollen, there is little or no basic knowledge about the
dynamics of vacuoles during pollen development
and germination in particular. Thus, it was also critical to focus on this foundation upon which we can
build our understanding of the mechanistic details of
endomembrane trafficking in gametophytes within
the context of trafficking in other plant tissues.
To understand the role of VCL1, it was necessary to
first understand the basic progression of vacuole biogenesis in germinating pollen. We describe the use of
a tonoplast-specific marker, ␦-TIP::GFP, under the
control of the pollen-specific LAT52 promoter that
permitted the examination of vacuole morphology in
germinating pollen of Arabidopsis. We observed that
␦-TIP::GFP-containing vacuoles were extremely dynamic in pollen tubes and displayed several remarkable structures. When pollen from plants harboring
vcl1 was examined, there was no obvious defect in
vacuole morphology or dynamics. Although not essential for vacuole formation, vcl1 nevertheless did
impair pollen function. This was supported by several genetic approaches that demonstrated that the
presence of vcl1 resulted in reduced inheritance
through both male and female gametophytes. Thus,
the mechanism of vacuole biogenesis in pollen appears to be complex and may differ from that in other
plant tissues.
RESULTS
VCL1 Is Expressed in Mature Pollen
To determine if VCL1 was expressed in pollen, total
RNA from mature pollen of Arabidopsis plants was
examined for the presence of VCL1 mRNA using
reverse transcriptase (RT)-PCR. Primers were designed to detect the VCL1 mRNA specifically. A major gel band was obtained that corresponded to the
expected length of the RT-PCR product from the
mature mRNA (Fig. 1, RNA lane, arrow). The product was confirmed by DNA sequencing to correspond to the predicted region of the VCL1 mRNA
(data not shown). For comparison, a PCR product
was obtained from Arabidopsis genomic DNA that
corresponded to the expected product length that
included several introns (Fig. 1, gDNA lane). These
results indicated that VCL1 mRNA, and probably
protein, was expressed from the gene in mature
pollen.
␦-TIP::GFP as a Reporter for Vacuole
Biogenesis in Pollen
Given that VCL1 was expressed in mature pollen, a
key question was whether or not the presence of the
vcl1 T-DNA gene knockout would affect vacuole
morphology in germinating pollen. To address this
question, the vcl1 mutant was transformed with a
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
reporter was expressed in pollen (Fig. 2, C–E). No
fluorescence was detected in control pollen not expressing ␦-TIP::GFP using the same instrument settings (data not shown). These results indicated that
germination in hanging drops was a useful approach
and that the ␦-TIP::GFP tonoplast reporter was functioning in pollen.
Vacuole Morphology in Germinating Pollen
Figure 1. The VCL1 gene is expressed in mature pollen. RNA lane,
Major 444-bp product of RT-PCR was from the VCL1 mRNA. Several
minor PCR products were also detected in pollen RNA. Note that the
bands appear more abundant upon duplication of the image. The
largest product was confirmed by sequencing to be derived from
genomic DNA contamination (data not shown). The shorter product
was presumed to be nonspecific. gDNA lane, 722-bp PCR product
from Arabidopsis genomic DNA using same primers as in RNA lane.
MW, Lambda HindII, EcoRI molecular mass marker. Masses as follows from top to bottom: 2.0 kb, 1.6 kb, 1.4 kb, 950 bp, 830 bp, and
560 bp (faint).
construct in which the tonoplast-specific marker
␦-TIP was fused to GFP. The reporter was under the
control of the pollen-specific promoter LAT52, which
displays enhanced expression in mature pollen and
throughout germination (Eady et al., 1995; Eyal et al.,
1995). Self-crosses led to the identification of T3 lines
that were: (a) homozygous for both ␦-TIP::GFP and
functional VCL1 as a control (VCL1/VCL1) or (b)
homozygous for ␦-TIP::GFP and heterozygous for
vcl1 (vcl1/VCL1). Because the homozygous defect
leads to embryo lethality, vcl1 was maintained as a
heterozygote. To study the effects of vcl1 on the
morphology and dynamics of vacuoles, the most
straightforward approach was to examine pollen collected from mutant and control lines germinated in
vitro.
We germinated our pollen in 30-␮L drops directly
on coated microscope slides that were then inverted.
The pollen sank to the liquid-air interface, providing
sufficient gas exchange to support germination (Fig.
2, A and B). The germination rates were highly variable between flowers. However, pollen in different
stages of germination could be prepared easily for
microscopy by placing a microscope coverslip over
the drop. The method was useful for other reasons as
well (see “Discussion”). When the VCL1/VCL1 control line was viewed by LSCM, numerous intracellular structures were highlighted in grains and elongating pollen tubes, indicating that the ␦-TIP::GFP
Plant Physiol. Vol. 134, 2004
Germinating pollen from the control line was examined to understand the basic morphology and dynamics of the tonoplast and vacuoles and to serve as
a baseline for comparison to pollen from the vcl1/
VCL1 line. Because the dynamics of vacuole biogenesis in living germinating pollen are poorly characterized, germination in vitro was divided for
convenience into several stages as follows (see Fig. 2,
D–F): (a) hydrated pollen grains (no visible tube), (b)
early germination (tube length ⬍ 20 ␮m), (c) tubes in
early growth (tube length 20–100 ␮m; occasional callose plug), and (d) tubes in more advanced growth
that had at least one callose plug (typically ⬎100 ␮m
in length).
Hydrated pollen (stage 1) was first examined for
␦-TIP::GFP by LSCM and found to have a granular
appearance suggestive of the presence of dispersed
vacuoles (Figs. 2, C and D, and 3, A and B). To define
these structures more carefully, higher resolution images were obtained. The images clearly described the
vesicular morphology within the hydrated pollen
grain (Fig. 3C), and this was consistent with electron
microscopy (EM) images of both mature and hydrated Arabidopsis pollen showing the presence of
small dispersed vacuoles (Van Aelst et al., 1993;
Kuang and Musgrave, 1996; see also Park et al., 1998).
Other aspects of pollen morphology were apparent.
For example, sperm cells could be seen in transmitted
images (Fig. 2D, arrow), and dark regions presumed
to be sperm cells were seen within hydrated pollen
grains (Fig. 3A). The presence of chromatin within
the sperm cell nuclei was confirmed by staining with
the DNA dye DAPI and viewed in Z sections along
with ␦-TIP::GFP. In Figure 3D, both dispersed vacuoles and two sperm cell nuclei are visible in overlays
of confocal (Fig. 3D) and transmitted (Fig. 3E)
images.
In pollen at early germination (stage 2), somewhat
larger vacuoles could be detected frequently in addition to the tonoplast, which had an extended or tubular morphology (Fig. 3, F and G). This morphology
was noted later in germination (see below) and,
along with vacuoles, developed presumably via the
coalescence of the smaller dispersed vacuoles. As
germination progressed into early growth of the pollen tube (stage 3), numerous small vacuoles could be
seen in both the pollen grain and in the elongating
tube, again resulting in a granular appearance (Fig. 3,
H and I). In general, as pollen tube growth pro-
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1229
Hicks et al.
Figure 2. Germination of ␦-TIP::GFP expressing
pollen in vitro. A, Pollen germinated in an inverted 30-␮L drop of germination medium on a
coated microscope slide. Bar ⫽ 320 ␮m. B,
Pollen tubes of different lengths are present in
germinating pollen. Bar ⫽ 193 ␮m. C, Control
pollen viewed by laser scanning confocal microscopy (LSCM). Vesicles and vacuoles are apparent. Bar ⫽ 20 ␮m. D, Corresponding transmitted image to C shown for comparison. 1,
Hydrated pollen grain; 2, early pollen germination; 3, pollen tube in mid growth. Arrow, Position of sperm cells. Bar ⫽ 20 ␮m. E, Control
pollen viewed by LSCM. Bar ⫽ 40 ␮m. F, Corresponding transmitted image to E. Pollen is at a
more mature stage (4). Bar ⫽ 40 ␮m. All pollen
viewed after 3 h of incubation in germination
medium.
Figure 3. Vacuole biogenesis in Arabidopsis pollen germinated in vitro. A, Optical sections showing the granular appearance of the ␦-TIP::GFP. The dark regions (arrow) correspond to the two sperm cell nuclei in the tricellular pollen grain. Bar ⫽
20 ␮m. B, Corresponding transmitted image for comparison with A. Bar ⫽ 20 ␮m. C, Higher resolution image of pollen grain
showing the presence of dispersed vacuoles. A maximum intensity series using four-line averaging and 60⫻ water immersion
objective is shown. Bar ⫽ 8.0 ␮m. D, Sequential scanning of ␦-TIP::GFP (green) and 4⬘,6-diamidino-2 phenylindole (DAPI;
red) in overlay showing the presence of two sperm cell nuclei. Note that the vegetative nucleus was detected with DAPI but
was at a different optical plane and not visible in this image. Bar ⫽ 8.0 ␮m. E, ␦-TIP::GFP and DAPI images from D layered
onto their corresponding transmitted image. Bar ⫽ 8.0 ␮m. F, Optical section through a pollen grain in early germination
highlighting the presence of larger vacuoles and extended or tube-like tonoplast. Bar ⫽ 8.0 ␮m. G, Transmitted image
corresponding to F for comparison. Bar ⫽ 8.0 ␮m. H, Optical section through several pollen grains during early pollen tube
growth showing the presence of small vacuoles. Dark region of tube on left was due to curvature of the tube out of the focal
plane. Bar ⫽ 20 ␮m. I, Transmitted image corresponding to H. Bar ⫽ 20 ␮m. J, Optical section of a pollen grain showing
increased vacuolation in the grain. Note the tubular appearance of tonoplast in the growing tube (arrow) and the lack of GFP
signal in the tip region. The background contains a more mature pollen tube that is highly vacuolated. Bar ⫽ 20 ␮m. K,
Transmitted image corresponding to J. Note the lack of material in the tip region (arrow). The background contains a more
mature pollen tube that is highly vacuolated. Bar ⫽ 20 ␮m. L, Higher resolution image of a pollen tube in early growth
showing the presence tubular vacuoles. The pollen tube tip (not visible) is toward the upper left of the image. Bar ⫽ 8.0 ␮m.
M, Optical section of pollen at a more advance stage of tube growth showing increased vacuolation of the grain and tube
and tubular vacuoles near the tip. Bar ⫽ 40 ␮m. Inset, Magnification of the grain and plug. Arrow, Bright ␦-TIP::GFP
structures (see text). Bar ⫽ 8.0 ␮m. N, Transmitted image corresponding to M. The sperm cell nuclei are visible within the
pollen tube (arrow). Bar ⫽ 40 ␮m. Inset, Magnified overlay image of the grain and plug. Bar ⫽ 8.0 ␮m. The plug is clearly
visible between areas of ␦-TIP::GFP fluorescence. O, Overlay image of ␦-TIP::GFP (green) and DAPI (red). Overlap of GFP
and DAPI signals results in the orange appearance of the nuclei (arrow). Bar ⫽ 40 ␮m. P, Transmitted image corresponding
to O. Bar ⫽ 40 ␮m. All images shown are of pollen incubated for 3 h in germination medium before viewing by LSCM.
1230
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
Figure 3. Legend continues
Plant Physiol. Vol. 134, 2004
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1231
Hicks et al.
ceeded, larger vacuoles were observed, particularly
in the pollen grain (Fig. 3, J and K). In addition, the
vacuoles in the tube at times appeared to be extended
in appearance. This is apparent in Figure 3J (arrowhead). To investigate the unusual vacuoles in more
detail, higher resolution maximum intensity images
of a Z series were obtained, and they indicated that
the vacuoles assumed a tubular morphology (Fig.
3L). It has been observed generally for pollen tubes
that the tip region is devoid of vacuoles (Lord and
Russell, 2002). This is apparent in transmitted images
that lack vesicular material in this area (Fig. 3K,
asterisk) and is further evidenced by a corresponding
lack of ␦-TIP::GFP fluorescence at the tip (Fig. 3J).
Pollen at a more advanced stage of germination
(stage 4) was characterized by the presence of a large
central vacuole in the grain and more extensive vacuolation in the tube, except in the region toward the
tip that frequently contained dispersed or tubular
vacuoles presumably necessary for growth (Fig. 3, M
and N). Another feature was callose plugs. The plugs
formed at the base of the pollen tube and were apparent in LSCM as a region devoid of ␦-TIP::GFP
fluorescence (Fig. 3M). The plug was also visible in
the corresponding transmitted image (Fig. 3N) and
an overlay image (Fig. 3N, inset). Additional callose
plugs were observed at more distal regions of the
pollen tube (data not shown). Sperm cells migrating
toward the growing tip could be seen in transmitted
images (Fig. 3N, arrow), indicating that pollen germinated in vitro retained this function. To confirm
the presence of chromatin within the sperm cell nuclei, germinating pollen at a similar stage was stained
with DAPI and viewed in Z sections along with
␦-TIP::GFP. In Figure 3O (arrow), sperm cell DNA
was visualized in the pollen tube.
These results indicated that vacuole morphology
was ordered throughout germination. Germination
rates were highly variable between grains; however,
there was a general progression from dispersed vacuoles in hydrated grains and tubes in early germination to more extensive vacuoles in more mature pollen tubes. During this transition, an unusual feature
was observed: the presence of tubular vacuoles in
early germination in regions of the pollen tube proximal to the tip. This region was presumed to be
important for rapid elongation. The range of morphologies observed suggested that vacuoles in germinating pollen were undergoing rapid biogenesis.
The Vacuoles in Germinating Pollen Are
Highly Dynamic
Having observed vacuole morphology in static images, we investigated the dynamics of vacuole biogenesis during germination. Pollen with tubes in
early growth (stage 3) before callose plug formation
was examined over time after 3 h of incubation in
germination medium. The morphology of the vacu1232
oles changed significantly even within 1 h; there
were altered arrangements of large vacuoles in the
grain and smaller vacuoles in the pollen tube. Tubular appearing vacuoles were also present. To capture
these dynamics, a timed series of images were produced over a period of 1.3 h. Several remarkable
aspects of germination were captured in the movie
(supplemental Fig. S1, available in the online version
of this article at http://www.plantphysiol.org).
These included: (a) the rapid movement of large
vacuoles in the pollen grain with the streaming of
tonoplast toward the growing tube, (b) the rapid
movement of tonoplast toward and away from the
region of the tube tip in a reverse fountain pattern, (c)
a lack of tonoplast flow into the extreme apex of the
tube, (d) the presence of sperm cell nuclei in the tube
and their movement, (e) the presence of mobile
strand-like (tubular) vacuoles, and (f) the presence of
unusual bright regions of ␦-TIP::GFP fluorescence in
the tonoplast of large vacuoles in the grain and similar bright structures within the pollen tube that were
highly mobile. Some of these features were apparent
in a static image from the timed series (Fig. 4A). Both
large vacuoles (arrow) and tubular vacuoles (arrowhead) were present in the grain and throughout the
tube, respectively. A dark region near the tip
(bracket) corresponded to the sperm cells. As described above, the tip region is mostly devoid of
tonoplast, and this is particularly apparent when
compared with the corresponding transmitted image
(Fig. 4B, asterisk). These data indicated that the germinating pollen possessed vacuoles that were extremely dynamic and formed structures that were
unusual in morphology and fluorescence.
Germinating Pollen Contains Mobile
Cytoplasmic Invaginations
The unusual bright regions in the tonoplast of large
vacuoles were obvious in many pollen tubes, particularly in the pollen grain shown (Fig. 4A, arrow), as
were other bright structures that were widely distributed throughout the tube. There were several possible explanations for these regions (see “Discussion”).
To determine the nature of the structures, additional
pollen tubes were viewed in more detail in images
from a time series over a period of 30 min. Selected
images showing details of interest are presented (Fig.
5). In Figure 5A (circled area), a bright ring structure
and a bright semicircle were captured. In progressive
images, the ring appeared to fuse with another region of tonoplast, and the semicircle folds inward,
forming a nearly complete circle (Fig. 5B, circled
area). The nearly complete circle then reopened (Fig.
5C, circle). Similar structures formed in other regions
of the pollen tube (Fig. 5D, circled area), at times
forming what appeared to be complete circles. Similar structures also were seen in other regions of the
images. The highly fluorescent structures described
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
S2 and demonstrates the extreme activity of vacuoles
and cytoplasmic invaginations in the pollen tube. An
examination of pollen at different stages of germination revealed the presence of localized bright regions
that were probably cytoplasmic invaginations (see
Figs. 2C; 3, F, J, and M, inset, arrow). These results
provided the reasonable explanation that the highly
fluorescent structures were rapidly changing cytoplasmic invaginations. Overall, our examination of
vacuole morphology in control pollen provided details of vacuole dynamics and a solid basis for comparison to pollen containing the defective vcl1 gene.
Effect of vcl1 on Pollen Morphology
Figure 4. The vacuoles in germinating pollen are highly dynamic. A,
Image of pollen grain in early growth from a time series (Fig. 1S). The
arrow indicates a large vacuole and the position of an associated
region of bright ␦-TIP::GFP fluorescence. Note that bright structures
are found throughout the pollen tube. The arrowhead indicates the
position of some tubular vacuoles. The dark region near the tip
(bracket) indicates the position of the sperm cells. Bar ⫽ 16 ␮m. B,
Transmitted image corresponding to C. Arrow indicates the tip regions lacking ␦-TIP::GFP fluorescence. Bar ⫽ 16 ␮m.
including lines, arcs, and circles are very similar to
double tonoplast cytoplasmic invaginations into
vacuoles that have been described in leaves and cotyledons of Arabidopsis (Saito et al., 2002) and are
termed bulbs. The complete time series over a period
of 30 min is shown as a movie in supplemental Figure
Plant Physiol. Vol. 134, 2004
To ask if VCL1 was necessary for vacuole biogenesis or pollen germination, we investigated pollen
from a heterozygous vcl1/VCL1 line. Because vcl1 is
embryo lethal when homozygous, pollen containing
the vcl1 gene knockout could be collected only from
influorescences of vcl1/VCL1 plants. One-half of the
pollen from heterozygotes was predicted to contain
vcl1 in the haploid complement and would not express the gene. Given the essential nature of VCL1,
lack of expression in even a proportion of the pollen
would be expected to lead to a population that is
distinct and defective in vacuole morphology or
other aspect of germination. Pollen from vcl1/VCL1
plants was examined thoroughly at all stages of germination using the approaches described for the control pollen. In all, four independent experiments
were done, totaling a minimum of 1,600 pollen grains
examined from vcl1/VCL1 plants at all stages described for the control pollen. In addition, at least 650
freshly collected pollen grains from vcl1/VCL1 plants
was examined for altered vacuole morphology (data
not shown). Overall, our detailed analysis detected
no defects in vacuole biogenesis in pollen from vcl1/
VCL1 plants compared with pollen from control
plants (data not shown).
Because in principle 50% of pollen from vcl1/VCL1
plants harbored vcl1, it was possible that the mutant
pollen germinated at a lower frequency than VCL1
pollen. To address this possibility, pollen from vcl1/
VCL1 and control plants was germinated in vitro and
quantified. The frequencies for pollen germinated in
liquid were statistically the same for the mutant and
control. Pollen from vcl1/VCL1 yielded a frequency
of 21.0% ⫾ 1.3% (2,739 grains scored) compared with
the control frequency of 22.9% ⫾ 1.1% (2,618 grains
scored). We also compared the germination frequency of pollen on solid medium (Fan et al., 2001),
which resulted in a greater overall rate of germination. Pollen from vcl1/VCL1 yielded a frequency of
50.9% ⫾ 5.2% (3,846 grains scored) compared with
the control frequency of 43.5% ⫾ 5.2% (3,655 grains
scored). Again, this indicated no statistical difference
in germination frequencies. Within the limits of our
assays, which may not detect subtle differences in
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1233
Hicks et al.
Figure 5. Brightly fluorescent regions are cytoplasmic invaginations. Selected images are from a time series of a pollen tube at a more advanced
stage in germination. The complete series (Fig. 2S) was produced over a period of 30 min. The images were produced at the following times after
the beginning of the series: A, 90 s; B, 100 s; C, 420 s; and D, 1,640 s. Circled areas indicate the positions of several semicircles and rings of
tonoplast. Pollen tube tip (not visible) is toward the top of the image. All bars shown ⫽ 8.0 ␮m.
germination, our results indicated that vcl1 does not
significantly reduce germination and supports the
conclusion that vcl1 and VCL1 pollen share similar
vacuole morphologies.
The lack of obvious defects in vacuole biogenesis in
vcl1 pollen was surprising because VCL1 is essential
and there are no known homologs in the Arabidopsis
genome (Rojo et al., 2002). This raised the interesting
question of how vacuole biogenesis occurred at all in
pollen harboring the vcl1 defect (see “Discussion”).
The effect of vcl1 on pollen vacuoles was either too
subtle to detect using our methods, which was unlikely in the case of vcl1, or was at a different stage of
development or fertilization. Thus, rather than focus
further on morphology, we decided to ask if vcl1
pollen was affected functionally in vivo.
Male and female vcl1 Gametophytes Are Defective
As a functional assay, we used genetics to examine
the fertility of vcl1 gametophytes. This approach was
both sensitive and quantitative compared with the
morphological approach. First, progeny of selfcrosses of vcl1/VCL1 T3 plants were evaluated for
transmission of the vcl1 defect. Seedling DNA from
the progeny was examined for the presence of the
vcl1 defect via PCR to detect the characterized single
T-DNA insertion within the VCL1 gene (Rojo et al.,
2002). Because vcl1 homozygous embryos did not
survive, the expected ratio of vcl1/VCL1 to VCL1/
VCL1 progeny was 2 to 1. The observed ratio was 1.1
to 1. This was a highly significant result, having a ␹2
P value of 0.0031 (Table I) and indicated reduced
transmission of the vcl1 gene to the progeny through
the male or female gametophytes, or both. To determine which gametophytes were affected by vcl1, reciprocal backcrosses were done between vcl1/VCL1
and VCL1/VCL1 plants, and the progeny were
scored by PCR. In these crosses, the expected ratio of
vcl1/VCL1 to VCL1/VCL1 progeny was 1 to 1. When
the pollen donor was vcl1/VCL1, the observed ratio
was 0.45 to 1, which was highly significant by ␹2 test
1234
having a P value of 0.0093 (Table I). This strongly
indicated that vcl1 transmission was suppressed in
male gametophytes. When the pollen donor was
VCL1/VCL1, the observed ratio of vcl1/VCL1 to
VCL1/VCL1 progeny was only 0.53 to 1. Again, this
was a significant result having a P value of 0.0218
(Table I). Interestingly, this indicated that vcl1 also
affected transmission through the female, indicating
that VCL1 is important for the function of male and
female gametophytes. The results of the genetics also
indicate that homozygous vcl1 is lethal at the sporophyte stage; however, at the haploid gametophyte
stage, it is not fully expressive.
DISCUSSION
Overall, our results demonstrate that pollen germination involves a complex, yet definable, progression
of vacuole biogenesis. Vacuole biogenesis in germinating pollen is extremely dynamic, and several unusual features such as tubular vacuoles and cytoplasmic invaginations were identified. Surprisingly, the
vcl1 defect did not adversely impact vacuole biogenesis in pollen germinated in vitro. Nevertheless, it
was firmly established that vcl1 does in fact lead to a
functional defect in fertility. Furthermore, this defect
affects both male and female gametophytes that undergo complex vacuole biogenesis.
To begin to examine the mechanisms of vacuole
biogenesis and trafficking in pollen, it was essential
to first understand the dynamics of vacuole biogenesis during germination. Although descriptive, it is
critical information on a poorly studied topic and
permits us to move forward in dissecting molecular
details. We were able to successfully apply
␦-TIP::GFP as a reporter to observe the morphology
and dynamics of Arabidopsis pollen. A method has
been reported for the germination of Arabidopsis
pollen on solid medium that resulted in rates of
germination up to 80% with pollen tubes having a
maximum length of about 350 ␮m after 12 h of incubation (Fan et al., 2001). We were able to achieve
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
Table I. Genetic analysis of vcl1 gametophytes
Individuals inheriting the vcl1 mutation were scored by PCR and then subjected to a ␹ 2 test. All ␹ 2 parameters are indicated, as are the
expected and observed results. P was calculated using GraphPad Quickcalcs (free online at http://www.GraphPad.com). n, Sample size; DF,
degrees of freedom; P, statistical significance.
K (Classes)
Observed (o)
Self crosses of vcl1/VCL1 T3 individuals
1 (vcl1)
2 (VCL1)
n ⫽ 87
DF ⫽ 1
P ⫽ 0.0031
Backcross of VCL1/VCL1 (female) ⫻
vcl1/VCL1 (male) individuals
1 (vcl1)
2 (VCL1)
n ⫽ 48
DF ⫽ 1
P ⫽ 0.0093
Backcross of vcl1/VCL1 (female) ⫻
VCL1/VCL1 (male) individuals
1 (vcl1)
2 (VCL1)
Expected (e)
Deviation (d; (o ⫺ e)
␹2 (d2/e)
45
42
87
58
29
⫺13
13
169
169
2.91
5.83
Total ␹2 ⫽ 8.74
15
33
48
24
24
⫺9
9
81
81
3.38
3.38
Total ␹2 ⫽ 6.76
19
36
55
27.5
27.5
⫺8.5
8.5
72.3
72.3
2.63
2.63
Total ␹2 ⫽ 5.26
n ⫽ 55
DF ⫽ 1
P ⫽ 0.0218
similar germination rates (up to 74%) on solid medium; however, germination in liquid medium in
inverted drops was useful for several reasons. Compared with microscope slides, agar surfaces can be
uneven, which complicates LSCM viewing, and removing pollen from agar is difficult because of adhesion of the pollen tubes. In contrast, pollen germinated on slides can be viewed by placing a coverslip
on the drop. This is potentially useful for immunolocalization because pollen germinated on coated microscope slides can be centrifuged directly onto the
slide and fixed (G.R. Hicks and N.V. Raikhel, unpublished data).
The rate of pollen tube growth in liquid or on solid
medium was highly variable even among pollen
grains collected from the same flower. However, pollen tubes of 400 ␮m were not uncommon in liquid by
3 h indicating, a growth rate of up to 2.2 ␮m min⫺1
(G.R. Hicks and N.V. Raikhel, unpublished data).
Pollen as a free living organism is subject to natural
selection, and it has been suggested that variation in
pollen growth rates could have a selective advantage
(Mulcahy et al., 1996). The successful germination of
Arabidopsis pollen in liquid has been reported recently by Steinebrunner et al. (2003). Given the active
growth at shorter incubation times and the desire to
minimize the possibility of artifacts in morphology at
longer times, we focused our analysis on pollen incubated in germination medium for 3 h. In terms of
methods for pollen germination, as we approach an
age of automated LSCM screening (Avila et al., 2003),
Plant Physiol. Vol. 134, 2004
d2
methods for rapid and easy pollen germination may
be useful for conventional or chemical genetic
screens for altered intracellular morphologies.
In our experiments, ␦-TIP::GFP was used as a reporter for the tonoplast. This marker (for examples of
labeled vacuoles from cotyledons, hypocotyls, and
roots, see Avila et al., 2003) and ␥-TIP::GFP (Saito et
al., 2002) are reported to be specific for vacuoles.
Other lines of evidence also point to the specificity of
our reporter. Reports of dispersed vacuoles in hydrated pollen (Van Aelst et al., 1993; Kuang and
Musgrave, 1996), central vacuoles and extensive vacuolation in the tubes later in germination, and elongated vacuoles in tubes (Derksen at al., 2002) are all
consistent with the morphology of vacuoles highlighted by ␦-TIP::GFP fluorescence. Also, consistent
with the labeling of vacuoles was the lack of fluorescence in the growing tip, a region rich in secretory
and endocytotic vesicles. The specificity of
␦-TIP::GFP was examined directly as well by adding
the vacuole-specific dye FM 4-64 (Kuriyama, 1999) to
germinating pollen tubes. The dye penetrated the
pollen tube wall slowly but showed colabeling of
␦-TIP::GFP labeled membranes by LSCM (G.R. Hicks
and N.V. Raikhel, unpublished data). Therefore, the
morphology and dynamics reported are behaviors of
authentic tonoplast.
There are surprisingly few studies describing the
germination of Arabidopsis pollen at the intracellular
level. In hydrated pollen grains, the presence of numerous and dispersed vacuoles and other organelles
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1235
Hicks et al.
such a dispersed lipid bodes has been observed by
EM in Arabidopsis (Van Aelst et al., 1993; Kuang and
Musgrave, 1996; Yamamoto et al., 2003). This is consistent with the dispersed vacuoles that we have
observed by LSCM and suggests the relevance of our
results using ␦-TIP::GFP. Although the tubular vacuole morphology is discernable by LSCM, Derksen et
al. (2002) used EM to examine Arabidopsis pollen
germinated for 8 h and reported “extended vacuoles”
in the pollen tubes that are similar in cross section to
tubular vacuoles. This indicates that the tubular
vacuoles are biologically relevant and not the result
of ␦-TIP::GFP expression by the pollen-specific promoter. Consistent with their results, we find a lack of
these or other vacuoles in the tip of the pollen tube.
In evaluating pollen during germination, several
overall trends were observed and can be integrated
into the stages of germination in vitro discussed previously. Hydrated pollen grains (stage 1) and pollen
in early germination (stage 2) are characterized by
the presence of widely dispersed small vacuoles. As
pollen tubes progress into early growth (stage 3),
fusion events lead to the biogenesis of larger vacuoles in the pollen grain. The pollen tube is highly
dynamic with the rapid streaming of tonoplast toward and away from the pollen tube tip. During
rapid growth, tubular vacuoles form in the tube cytoplasm. It is reasonable to speculate that the tubular
vacuoles are present in regions of the pollen tube
involved in high rates of vesicular trafficking. Also,
during periods of rapid endomembrane trafficking,
mobile cytoplasmic invaginations into the vacuoles
are present. Interestingly, invaginations are seen by
EM on one side of large vacuoles of developing microspores. The vacuoles have been hypothesized to
disperse via the progression of the invaginations
from one side of the vacuole toward the opposite side
(Yamamoto et al., 2003). Thus, mobile invaginations
may be present in developing microspores and germinating pollen. Saito et al. (2002) reported mobile
invaginations in cotyledon and hypocotyl tissues.
Our findings indicate mobile invaginations are probably a widespread feature of actively growing
tissues.
Pollen in more advanced growth (stage 4) possess
at least one callose plug and are characterized by the
presence of a large central vacuole in the grain and
more extensive vacuoles in the tube. However, near
the tip, the vacuoles are often more dispersed or
tubular, suggestive of vesicle trafficking. The mechanism of rapid tonoplast movement is yet to be determined but may be the result of associations with
the cytoskeleton (Derksen et al., 2002; Laitiainen et
al., 2002). Treatment with disruptive drugs and colocalization studies would be useful steps in examining
this connection.
Another unusual feature in germinating pollen was
the presence of brightly fluorescent regions of
␦-TIP::GFP that were associated with large vacuoles
1236
and were highly mobile. It is likely that these regions
are tonoplast in origin for several reasons: (a) They
are characterized by ␦-TIP::GFP, a tonoplast-specific
marker; (b) high-resolution time series indicate the
similarity of these structures to the bright mobile
double membrane tonoplast invaginations reported
by Saito et al. (2002), who used a different tonoplast
marker (␥-TIP); and (c) in the time series presented
(supplemental Figure S1), careful examination of the
bright regions in the vicinity of the vacuoles in the
pollen grain reveals movement from this region into
the pollen tube. Other structures that are characterized by enhanced GFP fluorescence known as endoplasmic reticulum (ER) bodies have been described
recently (Matsushima et al., 2003). These distinct
spindle-shaped bodies (approximately 10 ⫻ 1 ␮m)
are associated with ribosomes and have been detected using GFP fused to an ER retention signal.
However, given that they are associated with a different compartment and our evidence in favor of
mobile invaginations, it seems unlikely that the regions we describe are ER bodies. Although they do
not appear to have increased fluorescence, transvacuolar strands of cytoplasm have been visualized with
␦-TIP::GFP in vacuole-defective mutants (Avila et al.,
2003) and could account for some of the strand-like
regions observed in germinating pollen.
Having characterized the morphology of vacuoles
during germination, we could then focus on the main
question of the role of VCL1 in gametophyte function. The apparently normal biogenesis of vacuoles in
pollen harboring the vcl1 defect is very intriguing. It
is possible that there is a defect that cannot be detected using ␦-TIP::GFP. This argues that the defect in
pollen is subtle in contrast to the fact that VCL1 is
required for vacuole biogenesis in embryos. Furthermore, vcl1 pollen is capable of germination because
45% of backcross progeny transmitted the defect indicating only partial expressivity. How do we rationalize the observation of vacuole biogenesis in the
presence of vcl1 in haploid pollen? One possibility is
a redundant gene that performs the function of VCL1
in pollen specifically. However, a search has been
done, and no close homologs have been identified in
Arabidopsis (Rojo et al., 2001). Interestingly, homologs of yeast Vps41 (At1g08190) and Vps39
(At4g36630) are expressed in Arabidopsis pollen
(Honys and Twell, 2003). The yeast homolog of
VCL1, Vps16, interacts with several factors, including
Vps41, Vps39, Vps11, and Vsp33 as part of the C-Vps
complex that functions during vacuole and vesicle
fusion (Peterson and Emr, 2001). Arabidopsis
AtVPS11, AtVSP33, and VCL1 are found in diverse
plant tissues and interact as part of a similar complex
in plants (Rojo et al., 2002), which probably includes
AtVPS41 and AtVPS39. This suggests that C-Vps-like
complexes operate throughout the plant and VCL1
functions in vacuole biogenesis in pollen. Alternatively, it is conceivable that several distantly related
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
proteins could share at least partial redundancy in
their functions.
Another speculation is that there is sufficient preexisting VCL1 protein or mRNA present in the mature pollen grain to support germination. During
pollen development, the sporophyte contributes to
the microspore, resulting in a vegetative cell (and
pollen tube) cytoplasm of sporophyte origin. Immunolocalization in pollen harboring the vcl1 defect is
the most direct way of addressing the presence of
VCL1. However, attempts at localization have not
been successful thus far (G.R. Hicks and N.V.
Raikhel, unpublished data).
Given that pollen germination appeared normal in
the presence of vcl1, it was possible that the defect
might affect pollen at a later stage of development.
Thus, a genetic approach was taken using fertility as
a functional criterion. This approach had the advantage of being quantitative and sensitive for effects
that might not be fully expressive in the gametophytes. Reciprocal backcrosses clearly demonstrated
that, normal vacuole morphology in the presence of
vcl1 not withstanding, there was a defect in pollen
fertility due to the presence of vcl1. The results also
indicate that the defect in pollen function occurs at a
stage after pollen germination. This will be examined
in future experiments to track pollen tube growth in
vivo. The results of the genetics also indicated that
female gametophytes were affected by vcl1. Thus,
vcl1 is a general gametophytic mutant.
Given the complex development of vacuoles that
also exists in ovules (Drews and Yadegari, 2002), this
result is perhaps not surprising. Numerous mutants
have been identified in female gametophyte development (Drews and Yadegari, 2002). Several female
gametophyte mutants (gfa3 and gfa7) have been
mapped to a position near that of VCL1 on chromosome 2 (Feldmann et al., 1998). Their identities have
yet to be reported and, thus, could be VCL1. However, given that there are well over 100 such mutants
with many T-DNA mutants still to be characterized
(Drews and Yadegari, 2002), it is likely that other
candidate female gametophytic mutants will be identified in the proximity of the VCL1 locus.
It is interesting to note that Vsp16 in yeast is critical
for proper vacuole sorting, yet it is not an essential
gene (Horazdovsky and Emr, 1993). In plants, VCL1
is clearly essential for embryo development, yet our
results indicate that this is not the case in pollen.
Thus, homozygous vcl1 is lethal at the sporophytic
stage but is not fully expressive in the gametophytes.
By analogy, pollen may permit the dissection of vacuole biogenesis in a system without the lethality
associated with vacuole defects in the sporophyte.
MATERIALS AND METHODS
Nucleic Acid Preparation and RT-PCR
The RNA from mature pollen was a generous gift from Drs. Mark
Johnson and Daphne Preuss (University of Chicago). Pollen was collected
Plant Physiol. Vol. 134, 2004
(Mayfield et al., 2001) from the Arabidopsis qrt (quartet) mutant, which has
no detectable impact on pollen function (Preuss et al., 1994). Messagespecific primers were designed to complement sequences within exons 11
and 14 (Rojo et al., 2001). The intervening gene sequences included exons 12
and 13 and introns 12 through 14. A gel band of 444 bp was obtained that
corresponded to the expected length of the RT-PCR product from the
mature mRNA minus introns 12 through 14. For comparison, a PCR product
of 722 bp was obtained from Arabidopsis genomic DNA that corresponded
to the expected product length, which included the introns. RT-PCR was
performed using the Superscript II Reverse Transcriptase System (Invitrogen, Carlsbad, CA) according to the manufacturer. Genomic DNA was
extracted from Arabidopsis Columbia-0 using the cetyl-trimethylammonium bromide method (Rogers and Bendich, 1985). The following
gene-specific primers were used to amplify a region of the VCL1 gene
diagnostic for either the mRNA or the gene containing introns 5⬘ CATGGGATATGGGGAAAAA 3⬘ and CAGATGAGAAAGCGGAAGCT 3⬘. The
conditions for PCR were as follows: 94°C for 5 min followed by 30 cycles of
amplification (94°C for 1 min, 61°C for 1 min, and 72°C for 1 min). Products
were fractionated by 1% (w/v) agarose gel electrophoresis.
Construction and Transformation of
␦-TIP::GFP Reporter
For construction of the LAT52 promoter-␦-TIP::GFP, the 35S promoter
was removed from pEGAD (Cutler et al., 2000) as an SstI/Age I fragment.
This was replaced by blunt-end ligation with an XbaI/HindIII fragment from
pUC19-LAT52::GFP (a generous gift from Zhenbiao Yang, University of
California, Riverside) containing the LAT52 promoter. The LAT52 promoter
was originally from the laboratory of Sheila McCormick (Plant Gene Expression Center, University of California, Berkeley). The resulting construct
pLAT52-␦-TIP::GFP was transformed into Argobacterium tumefaciens and
introduced into plants heterozygous for vcl1 by floral dipping (Clough and
Bent, 1998). The vcl1 mutant (Rojo et al., 2001) has a single T-DNA insertion
in the VCL1 gene in Arabidopsis Columbia-0. Plants harboring
pLAT52-␦-TIP::GFP were selected on BASTA, and heterozygous (vcl1/
VCL1) plants were identified by PCR using NPTII gene-specific primers (see
below) to identify the T-DNA insertion. Several resistant vcl1/VCL1 T2
plants were self-crossed, and progeny were analyzed for the vcl1 defect.
Among the genotyped T3 progeny were plants homozygous for ␦-TIP::GFP
and heterozygous for the vcl1 defect. One such line, LGT4-28, was used in
this study. This line will be available from the Arabidopsis Biological
Resource Center (Ohio State University, Columbus).
Genotyping and Pollen Germination in Vitro
Seeds from self crosses of LGT4-28 were sterilized in 70% (v/v) ethanol
and 0.05% (v/v) Triton X-100 and germinated on Murashige and Skoog
Minimal Organics medium (Life Technologies/Gibco-BRL, Cleveland), then
transferred to soil after the appearance of four true leaves. After about 2
weeks, one or several rosette leaves were removed for the preparation of
DNA using Plant DNAzol Reagent (Invitrogen) according to the manufacturer’s instructions. The final DNA product was dissolved in 15 to 30 ␮L of
water for PCR. Because homozygous vcl1 is embryo lethal, it was maintained as a heterozygote in LGT 4-28. For all genotyping, vcl1/VCL1 plants
were identified from those that were VCL1/VCL1 by using NPTII-specific
primers to identify the T-DNA insertion in vcl1 (forward, 5⬘ CCGGTACCTGCCCATTC 3⬘; and reverse, 5⬘ GCGATAGAAGGCGATGCG 3⬘). The conditions for PCR were as follows: 94°C for 3 min, 28 to 30 cycles of amplification (94°C for 45 s, 45°C for 30 s, and 72°C for 2 min). The NPTII product
of approximately 400 bp was fractionated by 1.2% (w/v) agarose gel electrophoresis. As a positive control, all PCR reactions included primers to the
gene for the large subunit ADP Glc pyrophosphorylase (APL), which resulted in a product of approximately 700 bp. For germination in drops in
vitro, pollen from vcl1/VCL1 or VCL1/VCL1 control plants was collected
from flowers that were fully or nearly fully open with anthers that were
freshly dehiscent. Flowers were air-dried for 2 to 4 h, then gently dabbed
onto the surface of a 30-␮L drop of Germination Medium 1C [10% (w/v)
Suc, 0.01% (w/v) boric acid, 1 mm CaCl2, 1 mm Ca(NO3)2, and 1 mm MgSO4,
pH adjusted to 6.5 with KOH) on a coated microscope slide (Cytoslide,
Thermo Shandon, Pittsburgh, PA). Pollen from one flower was typically
examined per drop; however, pollen from multiple flowers could be pooled
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1237
Hicks et al.
and germinated. The slide was then inverted and incubated for 3 to 15 h at
23 C and 100% humidity. For germination on agar, 2 mL of Germination
Medium (Fan et al., 2001) was applied to the surface of a microscope slide
and allowed to solidify. Pollen from individual flowers was then dabbed
onto the agar, which was then incubated for 12 to 15 h at 100% humidity. To
quantify germination in drops or on agar medium, pollen from individual
flowers was germinated for 12 to 15 h and 50 to 150 (drops) or 100 to 200
(agar) grains were scored per flower. A minimum of 27 vcl1/VCL1 or
VCL1/VCL1 flowers each were scored in liquid or on solid medium. In all
cases, the frequencies reported plus or minus se were derived from three
independent experiments. For examination by LSCM, a 24- ⫻ 60-mm coverslip was gently lowered onto the drop containing the germinating pollen.
The DNA dye DAPI was added directly to the drop before coverslip
addition at a final concentration of 2 ␮g/mL.
Microscopy
Germinating pollen was viewed using a Leica TCS SP2/UV Confocal
Microscope (Leica Microsystems, Wetzlar, Germany) and either 20⫻ or 63⫻
water immersion objectives. For GFP and DAPI viewing, manufacturer
settings were used. The sequential scanning function was used to eliminate
the detection of ␦-TIP::GFP in the DAPI channel and vice versa when
producing merged images. For all static images, 2⫻ line averaging was
used. For detailed images as indicated, maximum intensity images were
produced from a Z series with 4⫻ line averaging using Leica Lite software
(Leica Microsystems). For movies, images were taken at the rates indicated
with no line averaging. To further reduce bleaching of ␦-TIP::GFP fluorescence due to repeated scanning, the pinhole was widened to 150 ␮m from
the usual setting of 100 ␮m used for static images.
Genetics
For segregation analysis of heterozygotes, LGT 4-28 plants were used that
were allowed to self-pollinate. The seed was collected, sterilized, germinated on plates, and then transferred to soil. After about 2 weeks, DNA was
prepared from rosette leaves, and plants were genotyped as described
above. For analysis of reciprocal back crosses of vcl1/VCL1 plants by VCL1/
VCL1 plants, approximately 30 independent reciprocal crosses were done.
Seeds were collected and pooled for VCL1/VCL1 (female) by vcl1/VCL1
(male) crosses and for vcl1/VCL1 (female) by VCL1/VC1 (male) crosses.
After sterilization and germination on plates, DNA was extracted as above
at the appearance of the fourth true leaf. Progeny were genotyped for the
presence of the vcl1 by PCR. ␹2 P and other values are indicated. P values
were calculated using GraphPad Quickcalcs (free on-line at GraphPad.com).
ACKNOWLEDGMENTS
The authors would like to thank Abigail Cano (University of California,
Riverside) for assistance with DNA preparation and Theresa Vu for assistance with crosses. We also thank Drs. Ueli Grossniklaus (University of
Zurich), Sebastian Bednarek (University of Wisconsin, Madison), and Gary
Drews (University of Utah, Salt Lake City) for helpful comments and
Jocelyn Brimo (University of California, Riverside) for graphic arts. We
would particularly like to thank Drs. Elizabeth Lord (University of California, Riverside) and Zhenbiao Yang (University of California, Riverside) for
critical discussions and advice and members of Dr. Yang’s laboratory for
advice on pollen germination methods.
Received December 9, 2003; returned for revision January 2, 2004; accepted
January 28, 2004.
LITERATURE CITED
Avila E, Zouhar J, Agee A, Carter D, Raikhel NV (2003) Tools to study
plant organelle biogenesis: point mutation lines with disrupted vacuoles,
and high-speed confocal screening of GFP tagged organelles. Plant
Physiol (in press)
Bassham DC, Raikhel NV (2000) Unique features of the plant vacuolar
sorting machinery. Curr Opin Cell Biol 12: 491–495
1238
Clough SJ, Bent AF (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:
735–743
Cutler SR, Ehrhardt DW, Griffitts JS, Somerville CR (2000) Random
GFP::cDNA fusions enable visualization of subcellular structures in cells
of Arabidopsis at a high frequency. Proc Natl Acad Sci USA 97: 3718–3723
Christensen CA, Subramanian S, Drews GN (1998) Identification of gametophytic mutations affecting female gametophyte development in
Arabidopsis. Dev Biol 202: 136–151
De DN (2000) Plant Cell Vacuoles: An Introduction. Csiro Publishing,
Collingwood, Victoria, Australia
Derksen J, Knuiman B, Hoedemaekers K, Guyan A, Bonhomme S, Pierson
E (2002) Growth and cellular organization of Arabidopsis pollen tubes in
vitro. Sex Plant Reprod 15: 133–139
Drews GN, Lee D, Christensen CA (1998) Genetic analysis of female
gametophyte development and function. Plant Cell 10: 5–17
Drews GN, Yadegari R (2002) Development and function of the angiosperm
female gametophyte. Annu Rev Genet 36: 99–124
Eady C, Lindsey k, Twell D (1995) Differential activation and conserved
vegetative cell-specific activity of a late pollen promoter in species with
bicellular and tricellular pollen. Plant J 5: 543–550
Eyal Y, Curie C, McCormick S (1995) Pollen specificity elements reside in 30
bp of the proximal promoters of two pollen-expressed genes. Plant Cell
7: 373–384
Fan L-M, Wang Y-F, Wang H, Wu W-H (2001) In vitro pollen germination
and characterization of the inward potassium currents in Arabidopsis
pollen grain protoplasts. J Exp Bot 52: 1603–1614
Feldmann KA, Coury DA, Christianson ML (1997) Exeptional segregation
of a selectable marker (KanR) in Arabidopsis indentifies genes important
for gametophytic growth and development. Genetics 147: 1411–1422
Hepler PK, Vidali L, Cheung AY (2001) Polarized cell growth in higher
plants. Annu Rev Cell Dev Biol 17: 159–187
Honys D, Twell D (2003) Comparative analysis of the Arabidopsis pollen
transcriptome. Plant Physiol 132: 640–652
Horazdovsky B, Emr S (1993) The VPS16 gene product associates with a
sedimentable protein complex and is essential for vacuolar protein sorting in yeast. J Biol Chem 268: 4953–4962
Juah GY, Phillips TE, Rogers RL (1999) Tonoplast intrinsic protein isoforms
as markers for vacuolar functions. Plant Cell 11: 1867–1882
Kuang A, Musgrave ME (1996) Dynamics of vegetative cytoplasm during
generative cell formation and pollen maturation in Arabidopsis thaliana.
Protoplasma 194: 81–90
Kuriyama H (1999) Loss of tonoplast integrity programmed in tracheary
element differentiation. Plant Physiol 121: 763–774
Laitiainen E, Nieminen KM, Vihinen H, Raudaskoski M (2002) Movement
of generative cell and vegetative nucleus in tobacco pollen tubes is
dependent on microtubule cytoskeleton but independent of the synthesis
of callose plugs. Sex Plant Reprod 15: 195–204
Lord EM, Russell SD (2002) The mechanisms of pollination and fertilization
in plants. Annu Rev Cell Dev Biol 18: 81–105
Matsushima R, Hayashi Y, Yamada K, Shimada T, Nishimura M, HaraNishimura I (2003) The ER body, a novel endoplasmic reticulum-derived
structure in Arabidopsis. Plant Cell Physiol 447: 661–666
Mayfield JA, Fiebig A, Johnston SE, Preuss D (2001) Gene families from
the Arabidopsis thaliana pollen coat proteome. Science 292: 2482–2485
Mulcahy DI, Sari-Goria M, Mulcahy GB (1996) Pollen selection: past,
present and future. Sex Plant Reprod 9: 353–356
Park SK, Howden R, Twell D (1998) The Arabidopsis thaliana gametophytic
mutation gemini pollen 1 disrupts microspore polarity, division asymmetry and pollen cell fate. Dev 125: 3789–3799
Peterson MR, Emr SD (2001) The class C Vps complex functions at multiple
stages of the vacuolar transport pathway. Traffic 2: 476–486
Pierson ES, Cresti M (1992) Cytoskeleton and cytoplasmic organization of
pollen and pollen tubes. Int Rev Cytol 140: 73–125
Preuss D, Rhee SY, Davis RW (1994) Tetrad analysis possible in Arabidopsis with mutation of the QUARTET (QRT) genes. Science 264: 1458–1460
Rogers SO, Bendich AJ (1985) Extraction of DNA from milligram amounts
of fresh, herbarium and mummified plant tissues. Plant Mol Biol 5: 69–76
Rojo E, Guillmor CS, Kovaleva V, Somerville CR, Raikhel NV (2001)
VACUOLESS1 is an essential gene required for vacuole formation and
morphogenesis in Arabidopsis. Dev Cell 1: 303–310
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
VCL1 Required for Proper Gametophyte Function
Rojo E, Zouhar J, Kovaleva V, Hong S, Raikhel NV (2003) The AtC-VPS
protein complex is localized to the tonoplast and the prevacuolar compartment in Arabidopsis. Mol Biol Cell 14: 361–363
Saito C, Ueda T, Abe H, Wada Y, Kuroiwa T, Hisada A, Furuya M, Nakano
A (2002) A complex and mobile structure forms a distinct subregionwithin the continuous vacuolar membrane in young cotyledons of Arabidopsis. Plant J 29: 245–255
Sanderfoot AA, Assaad FF, Raikhel NV (2000) The Arabidopsis Genome:
an abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein receptors. Plant Physiol 124: 1558–1569
Sato TK, Rehling P, Peterson MR, Emr SD (2000) Class C Vps protein
complex regulates vacuolar SNARE pairing and is required for vesicle
docking/fusion. Mol Cell 6: 661–671
Plant Physiol. Vol. 134, 2004
Steinebrunner I, Wu J, Corbett A, Roux SJ (2003) Disruption of apyrases
inhibits pollen germination in Arabidopsis. Plant Physiol 131:
1638–1647
Twell D, Park SK, Lalanne E (1998) Asymmetric division and cell fate
determination in developing pollen. Trends Plant Sci 3: 305–310
Van Aelst AC, Pierson ES, Van Went JL, Cresti M (1993) Ultrastructural
changes of Arabidopsis thaliana pollen during final maturation and rehydration. Zygote 1: 173–179
Vitale A, Raikhel NV (1999) What do proteins need to reach different
vacuoles? Trends Plant Sci 4: 149–155
Yamamoto Y, Nishimura M, Hara-Nishimura I, Noguchi T (2003) Behavior
of vacuoles during microspore and pollen development in Arabidopsis
thaliana. Plant Cell Physiol 44: 1192–1201
Downloaded from on June 16, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
1239