DNA RESEARCH 6, 381-386 (1999)
Structural Analysis and Complete Physical Map of Arabidopsis
thaliana Chromosome 5 Including Centromeric and Telomeric
Regions
Hirokazu KOTANI,* Tsutomu HOSOUCHI, and Hisano TSURUOKA
Kazusa DNA Research Institute, 1532-3 Yana, Kisarazu, Chiba 292, Japan
(Received 1 December 1999)
Abstract
Previously, we have reported a fine physical map of Arabidopsis thaliana chromosome 5, except for the
centromeric and telomeric regions, by ordering clones from YAC, PI, TAC, and BAC libraries of the genome
consisting of the two contigs of upper arm and lower arm, 11.6 M bases and 14.2 M bases, respectively.1
Here, the remaining centromeric and telomeric regions of chromosome 5 are completely characterized by
the ordering of clones and PCR amplifications. Chromosome 5 of Arabidopsis thaliana ecotype Columbia
is about 28.4 M bases long. The centromeric region is estimated at about 2 M bases long between two
5S-rDNA clusters. The 180-bp repeat region mainly consists of blocks of 180-bp tandem family and various
type retroelements dispersed over a 500-kb region. The telomeric regions of chromosome 5 are characterized
by PCR cloning, sequencing and hybridization. The telomere repeats at both ends are about 2.5-kb long
and interestingly, telomere-associated repeats (~700 bp) are found near both ends of chromosome 5.
Key words: Arabidopsis thaliana chromosome 5; physical map; contig map; telomere; centromere
presence of repetitive sequences are, nevertheless, known
to be involved in processes essential for cellular functions
Because of the relative ease of genetic manipula- such as meiosis, mitosis, chromosomal stability and nutions, its short life cycle, and other unique character- cleolar organization. The key to a full understanding of
istics, Arabidopsis thaliana is now considered to be a these functions is, of course, elucidation of the fine strucmodel organism for the study of various aspects of bi- ture of these regions at the nucleotide level. At present, it
ological phenomena associated with higher plants. Ef- is known that the A. thaliana centromeres are heterochroforts to sequence the entire genome (approximately matic, contain tandem arrays of 180-bp repeats cover130 Mb) of the plant, initiated in 1996 by an inter- ing approximately 1 M bp, and resemble those of human
national consortium, have so far yielded sequence data chromosomes in size and genomic organization.5 The role
for approximately 70% of the genome (http://genome- of the telomeric repeats of A. thaliana (5'-TTTAGGGwww.stanford.edu/Arabidopsis/agi.html) and are ex- 3') is still not well understood but it seems highly likely
pected to be completed by the end of the year 2000, ex- that these repeats are involved in cellular senescence.6
cept for highly and moderately repetitive DNA regions
Following previous work,1 we constructed a complete
including telomeres, centromeres and nucleolar organi- physical map by the ordering of YAC and BAC clones
zation regions (NOR). Along the efforts, physical maps for the centromere region and PCR amplifications for the
of A. thaliana chromosomes have been constructed by telomeric regions of A. thaliana chromosome 5.
the ordering of PI, TAC, BAC, and YAC clones except
for telomeres, centromeres and NORs. 14 The regions
(telomeres, centromeres and NORs) left out from the ini- 2. Materials and Methods
tial efforts to sequence the entire genome because of the
2.1. Libraries, screening, clone analysis and sequencing
To construct a physical map of the centromeric region
Communicated by Michio Oishi
* To whom correspondence should be addressed. Tel. +81-438- by clone ordering, PCR screening of DNA pools was done
52-3920, Fax. +81-438-52-3921, E-mail: [email protected]
to identify positive clones harbored in YAC, IGF BAC,
t The nucleotide sequence data of the upper telomere and the
1
lower telomere regions will appear in the DDBJ, EMBL and and TAMU BAC libraries as described previously. SeGenBank nucleotide sequence databases with accession num- quencing of TAMU4G15.2 and the telomere regions was
bers AB033277 and AB033278, respectively.
done by the shotgun and/or primer walking method us1.
Introduction
[Vol. 6,
Complete Physical Map of Arabidopsis thaliana Chromosome 5
388
CO
O
a
a.
-11.1 Mb
0.2 Mb
•+•
3.9 M b — - I -
i
Upper
telomere
'"-'•:'.:•
SS-rDNA Repeats
Cltj(ME04, <2Stft(B
\
'o.i Mb
. . • • • . " • • • . ' - . • • . " • • ' ' . : ? ; • • •• • • • • . " • • ' ' •
'••'
L
o
w
Centromere
region
CICO7A02. 460KB
13.3 Mb
i
e
Total 28.6 Mb
r
lelomere
- - -.
5S-fDNA Repeats
180-bp Repeats region
I CIC04F1O,36OKB
I
| CIC06A01. 4 5 0 K B ~ l
I CtC11fQ1.5Z0KS
CIC03D06, a30KB~
[CtC1Z003,360KB|
Q
:
26J33
M
IGF12KI9
•MTAM20K19
|TAfc0003
I
IMCJ3 '
Centromere Region
2 Mb
TAMU4G15_2
18OUP Repeats
10 kb
Figure 1. Genomic organization of A thaliana chromosome 5. a. Schematic structure of A. thaliana chromosome 5. A fine physical map
from PDC3 to nga76 and PhyC to CD3-42 was described previously.1 The centromere region, 5S-rDNA cluster locus and telomere
repeats are indicated by red, yellow and blue bars, respectively, b. A physical map of the A. thaliana chromosome 5 centromere
region. The name and size of the CIC YAC clones are indicated in wide-open boxes. Bacterial clones constituting the minimum
tiling path are shown by open boxes (previous work1) and closed boxes (this work) below the wide YAC boxes. The names of
bacterial clones are indicated on the right side of the boxes as PI ( M # # # ) , TAC ( K # # # ) , IGF BAC ( I G F # # # ) and TAMU BAC
( T A M # # # ) . The red and the light blue striped box show the 180-bp repeat region and 5S-rDNA cluster locus, respectively, c.
Schematic structure of the TAM4G15.2 clone. The red striped boxes show the block of 180-bp repeats. The black and gray boxes
show the regions homologous to LTR and inner sequence of the Athila retroelement, respectively. The green and the striped boxes
show high homology regions to the LTR-like and inner sequences of the retro-like element coded in T9E19, respectively. The yellow
and purple boxes show low homology regions to the LTR-like sequence of the retro-like element coded in T9E19.
ing a Big dye terminator cycle sequencing kit, and the 3. Results and Discussion
sequences were assembled by an Autoassembler (PerkinConstruction of physical map of centromeric region
Elmer-ABI, Foster, CA). Sequence data were subjected 3.1.
For construction of the physical map of the cento homology search by the BLAST and FASTA programs
tromeric regions, we isolated 4 YAC clones and 230
(GCG, Madison, WI).
BAC clones by PCR screening from BAC end sequences
and ordered them. The order was confirmed
2.2.
Characterization of telomere regions
PCR
using primers designed from end sequences as
by
For the amplification of telomeric regions, LA
well
as
the
information obtained from restriction entaq (TAKARA, Kyoto, Japan) and the following
zyme
digestion
patterns of the isolated clones compared
primers were used: A. thaliana telomere primer
in
the
BAC fingerprint data base (http://
to
those
(5'-CCCTAAACCCTAAACCCTAAACCCTAAACC-3'),
and IGF
genome.wustl.edu/gsc/arab/arabidopsis.html)
IGF10P11SP primer (5'-TTTCTCGGCTTTCCTCTGBAC
Contig
data
base
(http://194.94.225.l/private_
ACATGGCATCTC-3'), K9I9T7 primer (5'-AACTAGCTTCATATGGGGAAGACGATGCTC-3'), and yeast workgroups/pg_101/bac.html). A complete physical map
telomere primer (5'-CACACCCACACACCACACCCA- of the chromosome 5 centromeric region of A. thaliana
CAC-3')- The LA PCR mixture was held at 96° C for was thus constructed as shown in Fig. 1. Recently, Tutois
3 min, subjected to 35 cycles at 96°C for 30 sec and et al. reported the partial contig mapping of the pericen-7
68°C for 10 min and then held at 4°C. [[Aren't there 3 tromeric region of chromosome 5 using a YAC library.
stages to the PCR cycle? Denaturation, annealing, and However, the orientation of their map differs from that
of ours. Their orientation might be based on the interextension?!]
H. Kotani, T. Hosouchi, and H. Tsuruoka
No. 6]
YpAt7(A thaliana Landsberg)
Telomere repeats
AB033277
-2.5 kb
III)
1)1)
IGF10P11
TAS
-2.5 kb
Telomere repeats
AB033278
T9I9
CIC3B1L, 670 kb
> Yeast Telomere
Telomere repeats
1 kb
Figure 2. Schematic structures of the upper and lower telomere regions of A. thaliana chromosome 5. a. Structure of the upper
telomere region, b. Structure of the lower telomere region. The blue and yellow boxes show telomere repeats and variant telomere
repeats, respectively. The red arrows and light blue striped boxes indicate TAS and homologues regions between the upper telomere
region and YpAt7, respectively. The solid bars show the sequenced regions, and accession numbers are indicated on the right side
of the solid bars. The green boxes show the end positions of the IGFlOPll and T9I9 clones. The purple box shows the schematic
structure of CIC3B1L. D, HD, and HP below the solid bars are Dra I, Hindlll, and Hpa I restriction sites, respectively. The red bar
shows the probe for the Southern hybridization used in Fig. 4.
pretation of hybridization and the chimera YAC clone,
CIC9F5, as the upper anchor clone. A. thaliana pericentric heterochromatin can be subdivided into a central
domain, the functional centromere, and two flanking domains as revealed by FISH experiments using pachytene
chromosomes. In A. thaliana (Columbia ecotype) chromosome, 5S-rDNA loci have been mapped to the pericentromeric heterochromatin regions of chromosome 3,
the short arm of chromosome 4 and the upper arm of
chromosome 5.8 We found, however, that two loci of 5SrDNA clusters are located between the nga76 and PhyC
markers. The first 5S-rDNA gene cluster is located at a
site approximately 500 kb distal to nga76. The cluster
should consist of over 200 copies of the 5S-rDNA gene as
evidenced from the fact that (1) clone CIC4E4 (< 250 kb)
covered this 5S rDNA cluster completely and (2) approximately one-half of the region in this YAC clone, which
was covered by clone TAMU30A15, did not contain a 5S
rDNA gene cluster. The second 5S rDNA cluster covered by clone TAM19B10 is located at a site approximately 2 Mb from the first and consists of approximately
30 copies of the 5S rDNA gene as determined by Southern
hybridization and partial sequencing. In the fluorescence
in situ hybridization (FISH) picture of chromosome 5 in
Murata et al.,8 the satellite signal 5S-rDNA was observed
at the top end of the lower arm of chromosome 5. Also,
Fransz et al. reported that a minor 5S-rDNA locus in the
lower arm of chromosome 5 was often detected in several
ecotypes of A. thaliana including Columbia.9 The satellite signal was probably the second 5S-rDNA cluster on
our physical map.
In the central domain, the 180-bp tandem repeats and
the 106B family10 are interspersed rather than forming
separate regions in the five Arabidopsis chromosomes.9
This 180-bp tandem repeated DNA sequence is present
in arrays of over 50 kb, has been shown to locate in the
heterochromatin moiety surrounding the centromere11'12
and to hybridize equally to both sides of the centromere
on all five chromosome pairs.13 Among the two 5S-rDNA
clusters, the blocks of 180-bp tandem repeats were dispersed over approximately 500 kb as confirmed by PCR,
restriction patterns and partial sequencing of the subclones derived from clones comprising this region. One
clone, TAMU4G15_2 (approximately 75 kb, the sequence
Complete Physical Map of Arabidopsis thaliana Chromosome 5
384
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
3069
ACCATATACCTATACCATACCCTAAATCOCTATACCATATACCCTATACCCT
1
TATACCATGTACCCTCAACCTTAAAACCCT
ATAACCCTAAACCCCTATACCCTAAAACCCTATACCATGTACCCTCAACCTTAAATCCCT
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
ATACCCTATACCCTAAATCCCTAAACCCTAAACTCTAAACC3TAGGGTTTATGAGTTTGC
AAAACCTATACTATAAATCTTTAAAACCTATACTCTAAACCVTAGGGTTTGTGAGTTTGC
AAAACCTATACTATAAATCTTTAAAACCTATACTCTAAACC VTAGGGTTTGTGAGTTTGC
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
ATAAAGTGTCTTGTATAAGTGTTTCTAACATGTGAGTTTGCATAAGAGTC-TCAACTATG
ATAAAGCGTCACGTATAAGTGTTTCTAACATGTGAGTTTGCATAAGAGTC-TCGACTATG
ATAAAGTGTCACGTATAAGTGTTTCTAACATGTGAGTTTGCATAAGAGTCCACGTATAAG
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
TGTTTGTTCAAACGTGACGTAAGTGTTTAGACCAGAGCCGGCCGTGAGCACAAGCGGGTC
TGTTTGTTCAAAAGTGACGTAAGTGTTTAGACTAGAGCCGGCCGTGAGCACAAGCGGGCC
TGTTT -CTAACATGTGA
GTTT- -GC ATAAG AGTCCCGTGAGCACAAGC-GGCC
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
AAGCCCATGCTTGCGGCCGATTATCATATAATTATGTTTTGCTGCTTCATAATTTTGAAA
AAGCCCATGCTTGCGGCAGATTATCCTATAATTATGTTTTGCGGCTTTACAATTTTGAAT
AAGCCCATGCTTGCGGCAGATTATCCTATAATTATGTTTTGCGGCTTCACAATTTTGAAA
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
TTGTTTTGTGGTTAAGTGGTCGGGTCGGAGATGAGTTAGTTCTCATAC ATCTC AAA - TTC
TTGTTTTGTTGTTTAGTGGTCGAGTCAGGGATGAGTTTGTTCTCAAACATCTCAAATTTC
TTGTTTTGTTGTTTAGTGGTCGAGTCAGGGATGAGTTTGTTCTCAAACATCTCAAATTTC
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
AAATCTTCCAAAATGTTAGGTTCACTCTACTTTATTTTATTTTTATTTTTTA-AGTTTAA
TAATCTTCC-AAGTGTTAGGTTCACTCTACCTTATTTTTTTTTTTTTTTTTT-ATTTTAA
TAATCTTCC-AAGTGTTAGGTTCACTCTACCTTATTTTTTTTTATTTTTTTTTATTTTAA
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
ATTTCCATTAGAAATAACTTGAACTTTATTTCAAATGAACATTAGAAAGAATTGTCACTC
ATTTCTATTAGAAAGAACTTGAACCTTATTTCAAGTGAACATTAAAAAGAATTGTAACCC
ATTTCTATTAGAAAGAACTTGAACCTTATTTCAAGTGAACATTAGAAAGAATTGTAACCC
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
TACCTTATTTCTATTATTATGAATACGTGTAAAGTAATTCTTTTTTACAATAAACATGTA
TACCTTATTTCTATTATTATGAATATGTGTAAAGTAAAT-TTTTTTACAATAAGCATGTA
TACCTTATTTCTATTATTATGAATATGTGTAAAGTAAAT-TTTTTTACAATAAGCATGTA
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
TAAAGTGACCTACTTTTGTTCTTTTCTTATAGCCTTGTAAATCATAGGGACGGCTCTAGT
TAAAGTAACATATTTTTGTTCTTTTCTTATAGCCTTGTAAATCATAGGGACGGATCTAGT
TAAAGTAACCTATTTTTGTTCTTTTCTTATAGCCTTGTAAATCATAGGGACGGATCTAGT
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
TT AGAATAAAGTGTTGC ATAAGTGCTTCG ACTAAC ATATGAGTCC ATTTTTGTGAG - TTT
TTAGAATAAAGTGTTGCATAAGTTCTTCGACTAACATATGAGTCCATTTTTGTGAGTTTT
TTAGAATAAAATGTTGCATAAGTGCTTCGACTAACATATGAGTCCATTTTTGTGAGTTTT
Lower TAS(C)
Upper TAS(C)
YpAt7
GCATAAGTGTTGCGCGTTCGACAATTTGAATTTGATGCATAAGTGCTTTGACTAATTTAT
GCATAACTTTTGCGCCTTCGACAATTTGAATTTTATGCATAAGTGCTTTGACTAATTTAT
GCATAACTTTTGCGCCTTTGACAATTTGAATTTTATGCATAAATGCTTTGACTAATTTAT
Lower TAS(C)
Upper TAS(C)
YpAt7 TAS
GAGTTTTGTCTAAGTGATTCGACATTTCGACTAA
ATGTTTTGTCTAAGTGATTCGACATTTCGACTAA
ATGTTTTGTCTAAGTGATTCGACATTTCGACTAA
[Vol. 6,
2328 A. thaliana ecotype Columbia Chromosome 5
720 A. thaliana ecotype Columbia Chromosome 5
A. thaliana ecotype Landsberg
Z12170
Figure 3. Alignment of T A S sequences of the upper and lower telomere regions of A. thaliana ecotype Columbia and Y p A t 7 of ecotype
Landsberg. The red and green letters show same bases among three T A S s and the direct repeat in TASs, respectively. The variant
telomere repeats are boxed.
of this clone will appear in the near future.), which
mapped to the left side of the 180-bp repeats region was
analyzed by sequencing. As shown in Fig. lc, this region consisted of six 180-bp repeats blocks (0.5 ~ 12 kb)
and several full or partial sized retro elements containing long terminal repeats (LTR). In A. thaliana, two
types of retrotransposons have been described.14'15 The
Tal retrotransposon was the first transposable element
shown to carry all the structural and coding features
characteristic of retrotransposon.14 A second type of
retroelement called Athila found in the heterochromatin
region has the characteristics of retrotransposons such as
LTRs, primer binding site (PBS) and polypurine tract
(PPT). In T4G15.2, a LTR like sequcence of Athila
LTR (> 90%), two Athila type retro-like elements coded
in TAMU9E19 (afl04920.gb.pl2), and two LTR like sequences with low homo logy (> 60% against the LTR of
T9E19) are found. Southern hybridization of the ordered
clones of the 180-bp repeats region (500 kb) using LTR
probe of the retro like element of the T9E19 clone showed
that the 180-bp repeats region contained over 20 copies
of LTR sequence (data not shown). This means that this
region is a mosaic structure of the block of 180-bp repeats
and retro-elements like the T4G15.2 clone.
Based on the density of the heterochromatin
(> 300 kb/nm) and the average size of 180-bp repeats
No. 6]
H. Kotani, T. Hosouchi, and H. Tsuruoka
hybridizing region (1.5-1.8 nm) discussed by Fransz et
al.,9 it is estimated that the 180-bp repeat region is more
than 450 kb long. This value is consistent with the 180bp region of our map (Fig. lb) and similar to that for
the fully functional centromere of Drosophila minichromosome (420 kb).16 Preuss et al. reported a technique
that utilizes tetrad analysis to identify the chromosomal
domains that contain the functional centromere.17 It is
necessary to further research the locus of the functional
centromere.
385
1 2 3
**
.23.1 Kb
.9.41 Kb
-6.55 Kb
•4.36 Kb
3.2. Structures of telomeric regions of chromosome 5
Previously,1 we isolated MQA11 as the upper end
1949 bp
clone, and K9I9 and CIC3B1L as lower end clones. Further genome walking using the BAC library was then
carried out. One clone, IGF10P11, was isolated as a
upper end clone by PCR screening using primers of
825 bp
MQA11T7 end. Nevertheless, further genome walking
599 bp
for both ends using primers of IGF10P11SP end for the
upper direction and K9I9T7 end for the lower direction
333 bp
did not succeed. It seemed that IGF10P11 and K9I9
were closely linked to the upper and the lower telomere regions, respectively. Therefore, PCR amplification
was done to characterize the structure of the telomere- Figure 4. Southern hybridization of the telomere regions of A.
thaliana chromosome 5. 2 fig of genomic DNA was digested by
associated regions of A. thaliana Columbia chromosome
ffindlll (lane 1), Dra I (lane 2) and Hpa I (lane 3). * and **
5 using primers of telomere repeats and end clones. In
show the upper and lower telomere regions containing telomere
repeats, respectively. Signals of 1949 and 333 bp are driven by
the case of the upper telomere region, an approximately
Dra I fragments of the upper telomere region. Signals of 825
4.8 kb of DNA fragment was amplified. Through seand 599 bp are driven by Dra I fragments of the lower telomere
quence analysis and a BLAST search, this amplified fragregion. Probe was used for the upper TAS region as shown in
ment (Accession No. AB033277) was found to be highly
Fig. 2. Arrows show A Hindlll fragment size markers.
homologous to the YpAt7 which contained the telomeric region of A. thaliana Landsberg erecta isolated by
17
Richards et al.18 as shown in Fig. 2. So, we concluded upper, lower telomeric regions and YpAt7 shows good
that this amplified fragment was the upper telomere of homology including 15-bp direct repeats (Fig. 3). Southern hybridization revealed TASs to be specific for both
chromosome 5 and is linked to the IGF10P11 clone.
In the case of the lower telomeric region, PCR ampli- ends of chromosome 5 (Fig. 4. Lane 2; the signals of
fication from genomic DNA using the telomere primer 1949 bp and 333-bp are from the upper TAS region, and
and K9I9T7 primer was not successful. Previously, we the signals of 825 bp and 599 bp are from the lower TAS
characterized the CIC3B1 clone as containing two YACs, region) and the telomere repeats of the two regions to
termed CIC3B1S and CIC3B1L. CIC3B1L was mapped be approximately 2.5 Kb long (Fig. 4. Lanes 1 and 3).
to the lower end of chromosome 5 and covered the K9I9 Adjacent to the terminal telomeric repeat array is a reclone completely.1 Futhermore CIC3B1L was unstable gion that contains a number of more variable repeated
and lacked the R arm of pYAC4.19 Because of the possi- sequences, which may be shared by nonhomologous chrobility that CIC3B1L covered the lower telomeric end of mosome ends, and TAS repeats show a polymorphic dischromosome 5, PCR amplification from CIC3B1L DNA tribution with respect to both the position and the20 numwas done using K9I9T7 primer and a yeast telomere bers of repeats found on any one chromosome. The
primer. Approximately 4 kb of DNA was amplified. The 700 bp TASs at either end of the same chromosome are
sequence (Accession No. AB033278) of this DNA frag- unknown and may be a unique feature of A. thaliana.
ment contained 40 telomere repeats (TTTAGGG) of A. chromosome 5. Although the telomeric repeat array is
thaliana. Thus, we concluded that CIC3B1L covered essential and sufficient for protecting the integrity and
the lower telomeric region of chromosome 5. Interest- stability of the chromosome end, the function of TAS
ingly, approximately 700 bp of the telomere associated is not clear. The function of telomeres and/or TAS is
sequences (TASs) following the variant telomere repeats speculated to be association with the nuclear membrane,
were found at both ends of chromosome 5 as shown in an important role in chromosome movement, association
Fig. 2 and the alignment among the TAS sequences of and pairing of chromosomes during meiosis,21'22 the high
rate of recombination23 and unequal sister chromatid
386
Complete Physical Map of Arabidopsis thaliana Chromosome 5
exchange.24 Moreover, TASs of chromosome 5 may affect the recognition of both ends of one chromosome.
We have here reported the fine structure of the remaining centromeric and telomeric regions, thus completing
construction of the physical map of A. thaliana chromosome 5. Based on the results presented here and in a previous study,1 chromosome 5 of A. thaliana is estimated
to be approximately 28.4 Mb long and to consist of an
11.7 Mb upper arm (upper telomere to first 5S rDNA
locus), 2 Mb centromere region (first 5S-rDNA locus to
second 5S-rDNA locus) and 14.9 Mb lower arm (second
5S rDNA locus to lower telomere) (Fig. la). Sequencing
of the entire centromeric region by using ordered clones is
now in progress and will be completed in the near future.
Acknowledgements: We are grateful to Drs. S. Choi
and R. Wing of Texas A & M University, T. Altman of
the Max Plank Institute and I. Bancroft of the John Innes
Centre for providing the TAMU and IGF BAC libraries.
We thank Ms. A. Sueda and Ms. E. Usami for their skillful technical assistance and Ms. A. Tanaka for partial
sequencing of T19B10 clone. This work was supported
by the Kazusa DNA Research Institute Foundation. We
also thank M. Takanami and M. Oishi for their support
and encouragement.
References
1. Kotani, H., Sato, S., Fukami, M. et al. 1997, Afinephysical map of Arabidopsis thaliana chromosome 5: Construction of sequence ready contig map, DNA Res., 4,
371-378.
2. Sato, S., Kotani, H., Hayashi, R. et al. 1998, A physical
map of Arabidopsis thaliana chromosome 3 represented
by two contigs of CIC YAC, PI, TAC, and BAC clones,
DNA Res., 5, 163-168.
3. Marra, M., Kucaba, T., Sekhon, M. et al. 1999, A map
for sequence analysis of the Arabidopsis thaliana, Nature
Genet., 22, 265-270.
4. Mozo, T., Dewar, K., Ecker, J. R. et al. 1999, A complete
BAC-based physical map of the Arabidopsis thaliana
genome, Nature Genet., 22, 271-275.
5. Round, E. K., Flowes, S. K., and Richards, E. J. 1997,
Arabidopsis thaliana centromere regions: Genetic map
positions and repetitive DNA structure, Genome Res.,
7, 1045-1057.
6. Richards, E. J. and Ausubel, F. M. 1988, Isolation of
a higher eukaryote telomere form Arabidopsis thaliana,
Cell, 53, 127-136.
7. Tutois, S., Cloix, C , Cuvillier, C. et al. 1999, Structural
analysis and physical mapping of a pericentric region of
chromosome 5 of Arabidopsis thaliana, Chrom. Res., 7,
143-156.
8. Murata, M., Heslop-Harrison, J. S., and Motoyoshi, F.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
[Vol. 6,
1997, Physical mapping of the 5S ribosomal RNA genes
in Arabidopsis thaliana by multi-color fluorescence in situ
hybridization with cosmid clone, Plant J., 12, 31-37.
Fransz, P., Armstrong, S., Alonso-Blanco, C , Fischer, T.
C , Torres-Ruiz, R. A., and Jones, G. 1998, Cytogenetics
for the model system Arabidopsis thaliana, Plant J., 13,
867-876.
Thompson, H. L., Schmidt, R., and Dean, C. 1996, Identification and distribution of seven classes of middlerepetitive DNA in the Arabidopsis thaliana, Nucl. Acids
Res., 24, 3017-3022.
Bauwens, S., Van Oostvelt, P., Engler, G., and Van
Montague, M. 1991, Distribution of the rDNA and three
classes of highly repetitive DNA in the chromatin of interphase nuclei of Arabidopsis thaliana, Chromosoma, 101
41-48.
Maluszynska, J. and Heslop-Harrison, J. S. 1991, Localization of tandemly repeated DNA sequences in Arabidopsis thaliana, Plant J., 1, 159-166.
Schmidt, R., Putterill, J., West, J. et al. 1994, Analysis
of clones carrying repeated DNA sequences in two YAC
libraries of Arabidopsis thaliana, Plant J., 5, 735-744.
Voytas, D. F. and Auseubel, F. M. 1998, A copia-like
transposable element family in Arabidopsis thaliana, Nature, 336, 242-244.
Pelissier, T. et al. 1995, Athia, a new retroelement from
Arabidopsis thaliana, Plant Mol. Bioi, 29, 441-452.
Sun, X., Wahlstrom, J., and Karpen, G. 1997, Molecular
structure of a functional Drosophila centromere, Cell, 91,
1007-1019.
Copenhaver, G. P., Browne, W. E., and Preuss, D. 1998
Asseying genome-wide recombination and centromere
functions with Arabidopsis tetrads, Proc. Natl. Acad., 95,
247-252.
Richards, E. J., Chao, S., Vongs, A., and Yang, J. 1994,
Characterization of Arabidopsis thaliana telomeres isolated in yeast, Nucl. Acids Res., 20, 4039-4046.
Kuhn, R. M. and Ludwig, R. A. 1994, Complete sequence
of the yeast artificial chromosome cloning vector pYAC4,
Gene, 141, 125-127.
Hing, A. V., Helms, C , and Doinis-Keller, H. 1993,
VNTR and microsatellite polymorphisms within the subtelomic region of 7q, Am. J. Hum. Genet., 53, 509-517.
Chikashige, Y., Ding, D. Q., Funabiki, H. et al. 1994,
Telomere-led premeiotic chromosome movement in fission
yeast, Science, 264, 270-273.
Marphy, T. D. and Karpen, G. H. 1995, Interactions between nod+ kinesin like gene and extracentromeric sequences are required for transmission of a Drosophila
minichromosome, Cell, 81, 139-148.
Ashley, T. 1994, Mammalian meiotic recombination: A
reexamination, Hum. Genet., 94, 587-593.
Louis, E. J., Naumova, E. S., Lee, A., Naumov, G., and
Haber, J. E. 1994, The chromosome end in yeast: Its mosaic nature and influence on recombinational dynamics,
Genetics, 136, 789-802.