Clinical Investigation and Reports
Chlamydia pneumoniae Infection in Circulating Human
Monocytes Is Refractory to Antibiotic Treatment
Jens Gieffers, MD; Henriette Füllgraf; Jürgen Jahn, MD; Matthias Klinger, MD; Klaus Dalhoff, MD;
Hugo A. Katus, MD; Werner Solbach, MD; Matthias Maass, MD
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Background—Recovery of the intracellular bacterium Chlamydia pneumoniae from atherosclerotic plaques has initiated
large studies on antimicrobial therapy in coronary artery disease. The basic concept that antibiotic therapy may eliminate
and prevent vascular infection was evaluated in vitro and in vivo by examining the antibiotic susceptibility of C
pneumoniae in circulating human monocytes, which are thought to transport chlamydiae from the respiratory tract to the
vascular wall.
Methods and Results—Blood monocytes (CD14⫹) from 2 healthy volunteers were obtained before and after oral treatment
with azithromycin or rifampin and then inoculated with a vascular C pneumoniae strain and continuously cultured in the
presence of the respective antibiotic. Progress of infection and chlamydial viability was assessed by immunogoldlabeling and detection of C pneumoniae–specific mRNA transcripts. Circulating monocytes from patients undergoing
treatment with experimental azithromycin for coronary artery disease were examined for C pneumoniae infection by cell
culture. Antibiotics did not inhibit chlamydial growth within monocytes. Electron microscopy showed development of
chlamydial inclusion bodies. Reverse transcription–polymerase chain reaction demonstrated continuous synthesis of
chlamydial mRNA for 10 days without lysis of the monocytes. The in vivo presence of viable pathogen not eliminated
by azithromycin was shown by cultural recovery of C pneumoniae from the circulating monocytes of 2 patients with
coronary artery disease.
Conclusions—C pneumoniae uses monocytes as a transport system for systemic dissemination and enters a persistent state
not covered by an otherwise effective antichlamydial treatment. Prevention of vascular infection by antichlamydial
treatment may be problematic: circulating monocytes carrying a pathogen with reduced antimicrobial susceptibility
might initiate reinfection or promote atherosclerosis by the release of proinflammatory mediators. (Circulation. 2001;
103:351-356.)
Key Words: Chlamydia pneumoniae 䡲 atherosclerosis 䡲 infection 䡲 azithromycin 䡲 rifampin
T
establishment of a nonreplicating but viable state of chlamydiae in the host cells.8
Systemic dissemination of C pneumoniae from the respiratory tract to the cells of the vascular wall requires a cellular
transport system, because chlamydiae replicate exclusively
within their host cells. The elementary body, the metabolically inactive extracellular life stage of chlamydiae, has never
been found circulating free within the bloodstream. Circulating monocytes, which are pivotal to the development of
atherosclerosis, are known to migrate into the vascular wall.
Recent studies have described the in vitro infection of
monocyte-derived macrophages with C pneumoniae9 and the
presence of chlamydial DNA within peripheral blood mononuclear cells from patients with CAD.10,11 Furthermore, C
pneumoniae resists digestion in monocytes for 3 days, at least
he obligate intracellular pathogen Chlamydia pneumoniae has been related to atherosclerosis by seroepidemiology, detection of chlamydial structures and, most recently, recovery of viable chlamydiae from atherosclerotic
plaques.1,2 Chlamydiae may thus have a role in the multifactorial pathogenesis of atherosclerosis, a chronic inflammatory
condition of the vascular wall.3,4 On the basis of these
findings, antimicrobial treatment studies are currently underway, with the intention to improve the clinical condition of
patients with coronary artery disease (CAD) by chlamydial
eradication from atheromatous plaques.5 Endothelial and
smooth muscle cells can acquire a productive chlamydial
infection that can be inhibited in vitro by common antichlamydial antibiotics.6 However, chlamydiae are notorious
for causing chronic infections,7 and treatment failure is
common. These infections and failures may be due to the
Received October 24, 2000; revision received December 12, 2000; accepted December 14, 2000.
From the Institute of Medical Microbiology and Hygiene (J.G., H.F., W.S., M.M.), the Department of Internal Medicine II (J.J., K.D., H.A.K.), and
the Institute of Anatomy (M.K.), Medical University of Lübeck, Lübeck, Germany.
This article originally appeared Online on January 2, 2001 (Circulation. 2001;103:r1–r6).
Correspondence to Matthias Maass, MD, Institute of Medical Microbiology and Hygiene, Medical University of Lübeck, Ratzeburger Allee 160,
D-23538 Lübeck, Germany. E-mail [email protected]
© 2001 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org
351
352
Circulation
January 23. 2001
under in vitro cell culture conditions.12 Thus, monocytes are
a potential carrier system for C pneumoniae.
We were concerned that a persistent chlamydial infection
with reduced antibiotic susceptibility might exist in monocytes in vivo and that it might interfere with the basic concept
of antimicrobial treatment in coronary heart disease. If
monocyte infection is not eliminated by therapeutic intervention, continuous transmission to vascular cells after a decline
of the antibiotic tissue levels might affect long-term benefits.
Therefore, we studied chlamydial growth and activity within
monocytes in the presence of rifampin, the most effective
antichlamydial drug in vitro,13 and azithromycin, a macrolide
widely used in current treatment trials.5 To detect the pathogen, we used immunoelectron microscopy and Chlamydiaspecific mRNA transcripts, which are markers of bacterial
viability due to their short half-life. In addition, we attempted
to culture C pneumoniae from monocytes of patients with
unstable angina pectoris who were enrolled in a current trial
on the benefit of azithromycin in CAD.
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Methods
In Vitro and Ex Vivo Infection of Human
Monocytes in the Presence of Antibiotics
To asses the in vitro effect of antibiotics on the development of C
pneumoniae in human blood monocytes, CD-14 –positive cells were
infected with the CV-3 coronary artery isolate of C pneumoniae1 in
the presence of rifampin or azithromycin. Human blood monocytes
from 2 healthy male volunteers (28 and 36 years) were separated
using a Ficoll-Histopaque density gradient (Sigma) and subsequent
positive selection with anti CD-14 microbeads (MACS system,
Miltenyi Biotec GmbH). A total of 104 CD-14 –positive cells per well
were inoculated with 106 inclusion-forming units of C pneumoniae
strain CV-3 and continuously cultivated in 12-well tissue culture
plates for up to 10 days in RPMI medium (10% FCS; Gibco/BRL)
without antibiotics, with 10 ␮g/mL azithromycin (Pfizer), or with 10
␮g/mL rifampin (Sigma).
Antibiotics were added simultaneously with the chlamydiae. Two
hours after inoculation, monocytes were washed once with PBS to
remove nonphagocytized elementary bodies, and fresh medium with
the respective antibiotic was added. For immunoelectron microscopy, cells were grown on Thermanox coverslips (Nalgene Nunc
International) and collected at day 3. For reverse transcription–
polymerase chain reaction (RT-PCR) detection of chlamydial mRNA
synthesis, 104 cells were collected after 2 hours and 1, 3, and 10 days.
Experiments were made in duplicate. The culture assay was repeated
after oral treatment of the monocyte donors with azithromycin
(Zithromax, Pfizer GmbH; 500 mg/d for 3 days) or rifampin (Rifa,
Grünenthal GmbH; 600 mg/d for 6 days).
Serum drug concentrations were determined 2 hours after the last
application by high-performance liquid chromatography (azithromycin, 0.2 ␮g/mL; rifampin, 18.7 ␮g/mL). Monocytes were collected 2
hours after the last dose, inoculated with CV-3, and cultivated for up
to 10 days in the presence of azithromycin (10 ␮g/mL) or rifampin
(10 ␮g/mL), as described above. Monocytes collected before the first
application of the antibiotic and infected with CV-3 in the absence of
any antibiotics served as positive controls; uninfected monocytes
served as negative controls. After 2 hours and 1, 3, and 10 days,
viability of monocytes in culture was proven by Trypan blue
staining. Successful inoculation was controlled by immunofluorescence staining with an anti–C pneumoniae antibody (Dako); 104 cells
were collected for RT-PCR detection of chlamydial mRNA synthesis. Experiments were made in duplicate. In a control experiment,
immortalized laryngeal epithelial cells (HEp-2, ATCC CLL 23) were
infected with C pneumoniae with and without addition of azithromycin (10 ␮g/mL) or rifampin (10 ␮g/mL), as described previous-
ly.13 RT-PCR for chlamydial mRNA detection was performed 24
hours and 72 hours after infection.
Immunoelectron Microscopy
Cells grown on Thermanox slides were fixed with 2% paraformaldehyde and 0.1% glutaraldehyde in PBS (pH 7.4) for 1 hour at 4°C
and contrasted with 2% uranyl acetate in cacodylate buffer. After
dehydration in a graded acetone series, cells were embedded in LR
White (London Resin Co). Ultrathin sections were mounted on 300
mesh nickel grids and were blocked for 30 minutes with 0.5% bovine
serum albumin (Sigma) in Tris-buffered saline (TBS). The sections
were incubated for 16 hours with chlamydia genus–specific mouse
anti-HSP60 IgG (Affinity BioReagents) diluted 1:250 with TBS.
After rinsing with TBS, sections were incubated for 2 hours with
donkey anti-mouse IgG coupled to 12-nm gold particles (Jackson
ImmunoResearch) diluted 1:100 with TBS. Sections were contrasted
with uranyl acetate and lead citrate and were examined for
immunogold-stained chlamydial structures with a Philips EM 400
electron microscope. In control incubations, normal mouse serum
was substituted for the primary antibody.
Chlamydial mRNA Synthesis in the
Presence of Antibiotics
C pneumoniae–specific mRNA was extracted by standard methods
using TRIZOL Reagent (Gibco/BRL). RT of RNA and cDNA
amplification was performed using the Access RT-PCR System
(Promega) according to the manufacturer’s instructions. cDNA
synthesis was performed at 48°C for 50 minutes. After 2 minutes of
initial denaturation at 95°C, the samples were subjected to 40 cycles
of denaturation (95°C, 40 s), annealing (55°C, 90 s), and extension
(70°C, 120 s), followed by a final extension at 70°C for 10 minutes.
Targets were the genes of the major outer membrane protein
(MOMP) and the 60-kDa heat shock protein (HSP60). Primers for
MOMP mRNA were Cpn 201 (5⬘TGGTCTCGAGCAACTTTTGATG3⬘) and Cpn 202 (5⬘AGCTCCTACAGTAACTCCACA3⬘), as
originally described by Gaydos et al.14 Primers for the HSP60
mRNA were GE-1 (5⬘AGCTCACGTAGTTATAGATAAGAG3⬘)
and GE-2 (5⬘AAGTAGCTGGAGAGGTATCCACGG3⬘), as described by Airenne et al.12
As a control for the absence of DNA in the RNA preparation, each
sample was additionally amplified without prior RT. PCR products
were separated on a 2% agarose gel and transferred on a nitrocellulose membrane by vacuum blotting. For improved sensitivity and
specificity, nonradioactive DNA hybridization was performed using
probes 3⬘-tailed with digoxigenin-11 dUTP/dATP (Roche Diagnostics), according to the manufacturer’s instructions. Probes were
designed according to the sequence of the amplicons and checked for
genus-specificity in a BLAST 2.0 search (5⬘GCAATCTATAGCGAAGGTCT3⬘ for HSP60 amplicons; 5⬘TAACATCCGCATTGCTCAGC3⬘ for MOMP amplicons).
C pneumoniae Culture From Monocytes of CAD
Patients Under Azithromycin Treatment
Two male patients (68 and 57 years) admitted to our emergency
room because of acute chest pain were diagnosed as having unstable
angina pectoris on the basis of coronary angiography, electrocardiography, clinical presentation, and laboratory parameters. The first
patient was admitted with a myocardial infarction of the inferior
wall. Coronary angiography showed 2-vessel disease (right coronary
artery and left circumflex artery). The occluded right coronary artery
was reopened by PTCA. The patient’s risk factors were diabetes
mellitus, arterial hypertension, and smoking. The second patient was
admitted for a myocardial infarction of the anterior wall. Two-vessel
disease (left anterior descending artery and left circumflex artery)
was documented by coronary angiography, and the occluded left
anterior descending artery was reopened by PTCA. Risk factors in
this patient were arterial hypertension and obesity.
After informed consent was given, both patients were enrolled in
an ongoing clinical trial on the benefit of azithromycin in CAD and
received oral courses of 500 mg/d azithromycin on days 1 to 3 and
Gieffers et al
Refractory C pneumoniae Infection in Monocytes
353
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Figure 1. Immunogold-labeling for chlamydia HSP60 in isolated human monocytes (CD14⫹) infected in presence of 10 ␮g/mL azithromycin after 3 days (A, B). Infected but untreated epithelial HEp-2 cells served as controls (C). Inoculation of monocytes in presence of
azithromycin resulted in development of chlamydial inclusion bodies, as indicated by accumulation of gold particles. These inclusions
were frequently of aberrant morphology in comparison with those seen in epithelial cells. They were less dense and contained fewer
reticulate and elementary bodies. Identical inclusions were produced in medium without antibiotic supplementation. Bars indicate 0.5
␮m.
on days 14 to 16 after coronary angiography. These patients yielded
a positive result for C pneumoniae DNA in their peripheral blood
mononuclear cells, which were collected at day 1, as determined in
a previously described nested PCR technique.15 Thus, CD14-positive
cells from 8 mL of blood were isolated on day 28, as described
above, and subjected to C pneumoniae culture. Separated CD14positive cells were disrupted with glass beads on a vortex and
centrifuged onto HEp-2-cell monolayers in 6-well tissue culture
plates and cultured in serial subcultures, as described previously for
vascular materials.1 Productive infection was detected by immunofluorescence using a C pneumoniae monoclonal antibody (Syva,
Dako).
Results
Chlamydial Growth in the Presence of Antibiotics
Rifampin and azithromycin had no discernible effect on
chlamydial growth and metabolic activity within monocytes
in vitro. Inoculation of the freshly isolated human monocytes
resulted in the development of inclusion bodies after 3 days
whether antibiotics were added or not. These inclusions were
proven to be of chlamydial origin by staining with the
anti-chlamydial HSP60 antibody using immunoelectron microscopy. However, the inclusions were frequently of aberrant morphology in comparison with those seen in epithelial
cells. They contained fewer and less dense reticulate and
elementary bodies (Figure 1).
mRNA Synthesis in the Presence of Antibiotics
and After Prior Systemic Antibiotic Treatment
Chlamydiae within monocytes were metabolically active and
did not cause host cell lysis; thus, they were proven to persist.
Infected CD14-positive cells were viable until the end of the
experiment (10 days), as shown by Trypan blue and immunofluorescence staining. RT-PCR demonstrated chlamydial
HSP60 and MOMP mRNA synthesis, which indicated the
viability of the pathogen in the presence of azithromycin or
rifampin at 2 hours and 1, 3, and 10 days after infection.
Similarly, mRNA transcripts of HSP60 and MOMP were
continuously expressed from 2 hours to 10 days, despite of
prior systemic treatment of the monocyte donors with conventional courses of the respective antibiotics and their
permanent presence in the culture medium (Figure 2). In a
control experiment, synthesis of HSP60 and MOMP mRNA
ceased completely in infected HEp-2 cells treated with
azithromycin or rifampin within 72 hours, thus demonstrating
the in vitro efficiency of the antibiotics in epithelial cells in
the same setting (Figure 3).
Cultural Recovery of C pneumoniae Under
Azithromycin Treatment
Viable C pneumoniae was isolated and continuously cultured
from CD14-positive cells of both CAD patients who had
undergone azithromycin treatment. Prior treatment with
azithromycin did not eradicate C pneumoniae from circulating monocytes. The minimal inhibitory concentration of
azithromycin, as determined in a standard system in laryngeal
HEp-2 cells,13 was 0.08 ␮g/mL for both strains. There was no
evidence that the patients suffered from a systemic inflammatory response syndrome, according to current consensus
criteria.16
Discussion
There are 2 main findings in this study: (1) monocytes can
disseminate the viable respiratory pathogen C pneumoniae
within the systemic circulation, and (2) the pathogen cannot
be eliminated from its monocyte host by standard antichlamy-
354
Circulation
January 23. 2001
Figure 2. Detection of C pneumoniae–specific HSP60 mRNA and MOMP mRNA transcripts as markers of viability in infected human
monocytes. Chlamydial metabolic activity persists under in vitro application of 10 ␮g/mL azithromycin or rifampin, as well as after oral
in vivo pretreatment with azithromycin (3 days, 500 mg/d) or rifampin (5 days, 600 mg/d). Chlamydial mRNA transcripts are detectable
for at least 10 days, indicating an intracellular infection that is refractory to antibiotic treatment. M indicates DNA marker VIII,
digoxigenin-labeled (Boehringer); A, uninfected monocytes; and ⫹, C pneumoniae–infected monocytes in absence of antibiotics (3 days
after infection).
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
dial treatment. The continuous presence of azithromycin or
rifampin does not protect cultured human monocytes from C
pneumoniae infection in vitro. In addition, monocytes isolated after a standard course of azithromycin or rifampin
treatment, and thus already replenished with antibiotics, still
acquire C pneumoniae infection when subsequently cultured
in the presence of antibiotics. Intracellular development
beyond mere phagocytic ingestion was shown electronmicroscopically by immunogold-labeling of reticulate and
elementary bodies within inclusions. These inclusions and
their content were morphologically different from what is
found in the acute infection of epithelial cells, but their
viability and metabolic activity was proven by continuous
detection of chlamydial mRNA transcripts. The pathogen
remained viable without initiating the host cell lysis that
otherwise marks the end of the regular chlamydial replication
cycle. Thus, the monocytes acquire a persistent infection.
Finally, the cultural retrieval of C pneumoniae from circulating CD14-positive cells of CAD patients undergoing experimental azithromycin treatment for coronary sclerosis proved
the presence of viable chlamydiae in the bloodstream, despite
antichlamydial therapy.
In this study, we defined systemically circulating CD14positive cells as hosts for C pneumoniae. This fills the current
gap between the respiratory epithelium, the primary target of
Figure 3. Eradication of C pneumoniae from epithelial HEp-2
cells by antibiotics (AB). C pneumoniae HSP60 mRNA transcripts are detectable in untreated HEp-2 cells 1 and 3 days
after infection (inf) but not in cells treated with 10 ␮g/mL
azithromycin (Azithro) or rifampin (Rifa). Acute infection can be
eliminated in this in vitro setting. M indicates DNA marker VIII,
digoxigenin-labeled (Boehringer); A, uninfected HEp-2 cells.
this pathogen, and the vascular wall, where the chlamydiae
were detected by various techniques,1,17–19 although their
origin remained unexplained. The recovery of C pneumoniae
from monocytes now illustrates one method whereby the
obligate intracellular organism may gain access to the vascular system. Other studies suggested that monocytes could be
a potential vector system for chlamydial distribution on basis
of DNA detection within peripheral blood mononuclear
cells10,11 or CD14-positive cells,15 but these studies lacked
evidence of viability. In the lung, C pneumoniae enters
epithelial cells and alveolar macrophages,20 but the exact site
of transmission of chlamydiae to blood monocytes remains to
be defined. In vitro data indicate that monocytes may transmit
C pneumoniae to vascular endothelial cells,21 but in vivo data
are lacking. For initiation or promotion of atherogenesis,
however, infection of the vascular wall does not seem
mandatory because a release of proinflammatory mediators
by circulating or transendothelially migrating infected monocytes might be sufficient.22
In acute infection, host cells disintegrate and release newly
produced elementary bodies within 3 days. In monocytes,
however, a persistent infection was established for the observation period of 10 days. This persistent state seems to be
typical of chlamydiae ingested by human monocytes under in
vitro culture conditions and is not induced by antibiotics,
because it occurs without any antibiotic supplementation. In a
previous study, C trachomatis serovar K–specific mRNA was
detected in monocytes for 10 days.23 Airenne et al12 showed
that C pneumoniae was transcriptionally active for 3 days in
vitro and did not develop infectious progeny in human
monocytes. However, because we were able to culture the
organism from monocytes from CAD patients, the data
suggest that the ability to replicate is not lost within the
monocytes. Interestingly, an establishment of the persistent
infection could not be prevented by antichlamydial treatment.
Although monocytes were subjected in vitro and in vivo to
adequate amounts of antibiotic substance, they still promoted
persistent infection with a vascular C pneumoniae strain.
When tested under standard susceptibility testing conditions,
Gieffers et al
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
the very same strain was highly sensitive to rifampin and
azithromycin. This may explain the treatment failures seen in
respiratory infections with strains that seemed susceptible in
vitro.24 Current chlamydial susceptibility testing is focused
on acute infection in epithelial cells and apparently does not
apply to persistent infection.
The present study suggests that chlamydiae can survive an
antichlamydial therapy within monocytes in vitro and in vivo.
Optimal regimens for chlamydial eradication from monocytes
are not known, but cultural recovery of the pathogen from
circulating monocytes after 2 conventional courses of azithromycin treatment clearly indicates that a standard approach, as
used in acute lung infection, may not be successful. Thus,
endogenous reinfection of vascular cells after a decline of the
antibiotic tissue levels cannot be excluded. In fact, this may
seriously affect the current efforts made in large prospective
trials to alleviate clinical CAD symptoms by antichlamydial
treatment. This notion is supported by recent data from
ongoing treatment trials. In the largest study on antimicrobial
treatment in CAD patients published to date, azithromycin
treatment had no significant effects on clinical events after 6
months and 2 years.25 A statistically significant benefit
among roxithromycin-treated CAD patients seen after 30
days in the Roxithromycin Ischemic Syndromes (ROXIS)
study was not reproduced after 6 months.26 Erythromycin or
tetracycline treatment within the last 5 years had no effect on
the risk of having a first myocardial infarction in a retrospective study.27 In contrast, another retrospective analysis of
first-time myocardial infarction cases and controls reported a
favorable effect of tetracycline and quinolone antibiotics but
not macrolides.28 In a rabbit model on the acceleration of
atherogenesis by chlamydial infection, azithromycin treatment had a documented protective effect. However, C pneumoniae antigen was still detected in the vessel walls after a
7-week azithromycin course, indicating persistence.29
It is important to note that antibiotics can inhibit chlamydial growth in the atherogenetically relevant endothelial and
smooth muscle cells.6 Thus, chlamydial eradication from
cells other than monocytes/macrophages is potentially feasible. However, there is evidence suggesting that persistence
may be established in those cells, too. In a recently described
in vitro model of continuous C pneumoniae infection, epithelial cells sustained infection for 2 years without an addition of
fresh host cells or chlamydiae. Six-day courses of azithromycin or ofloxacin did not eliminate the infection.30 It is
unknown if this corresponds to the in vivo situation in
pulmonary or vascular tissue.
In vivo, chlamydial persistence has been observed in only
monocytes thus far, but it can be induced in endothelial and
epithelial cells in vitro by tryptophan depletion, interferon-␥,
or tumor necrosis factor-␣.8,31 When a corresponding mechanism was studied for monocytes, growth inhibition could not
be neutralized by tryptophan or interferon-␥ antibodies.12,23
Apparently, the persistent state can be entered spontaneously
in monocytes/macrophages but is dependent on the cytokine
network in other cell populations. Nevertheless, the absence
of essential nutrients in the vacuole of the intracellular
parasite may be the cause of growth arrest. Persistence seems
to be the result of a stress response, as indicated by the
Refractory C pneumoniae Infection in Monocytes
355
prominent production of HSP60. We speculate that the
altered metabolic condition in this state is also the cause of
the ineffectiveness of the antimicrobial agents described in
this study and that this state is based on differentially
displayed chlamydial genes for cell differentiation, cytokinesis, and stress response. Therefore, we suggest the use of
infected monocytes as a model system for further examination of the genetic background of chlamydial persistence and
for the definition of targets for the eradication of persisting
chlamydiae.
An infectious component in the chronic inflammatory
condition of atherosclerosis may provide additional explanations for unclear phenomena of atherogenesis, such as mesenchymal cell proliferation and its distinct inflammatory
component. The obvious appeal of treating a bacterial pathogen in this setting, the leading cause of death in the industrialized nations, has initiated a variety of prospective antimicrobial intervention studies with ⬎10 000 patients enrolled.5
However, evidence is increasing that eradication may face
enormous problems due to the chlamydial ability to enter a
refractory state of persistent infection that seems unique to
chlamydiae.
Acknowledgments
This study was supported by grants from the Deutsche Forschungsgemeinschaft, Bonn, Germany, to Dr Maass (Ma 2070/2–1
and SFB 367, B11).
References
1. Maass M, Bartels C, Engel PM, et al. Endovascular presence of viable
Chlamydia pneumoniae is a common phenomenon in coronary artery
disease. J Am Coll Cardiol. 1998;31:823– 827.
2. Ramirez JA, Chlamydia pneumoniae/Atherosclerosis Study Group. Isolation of Chlamydia pneumoniae from the coronary artery of a patient
with coronary arteriosclerosis. Ann Intern Med. 1996;125:979 –982.
3. Libby P. Atheroma: more than mush. Lancet. 1996;348(suppl 1):4 –7.
4. Ross R. Atherosclerosis: an inflammatory disease. N Engl J Med. 1999;
340:115–126.
5. Grayston JT. Antibiotic treatment trials for secondary prevention of
coronary artery disease events. Circulation. 1999;99:1538 –1539.
6. Gieffers J, Solbach W, Maass M. Activity of antibiotics in eliminating
Chlamydia pneumoniae cardiovascular strains from cell types involved in
the pathogenesis of arteriosclerosis. Clin Microbiol Infect. 1999;5(suppl
3):381. Abstract.
7. Ward ME. The immunobiology and immunopathology of chlamydial
infections. APMIS. 1995;103:769 –796.
8. Beatty WL, Byrne GI, Morrison RP. Morphologic and antigenetic characterization of interferon gamma-mediated persistent Chlamydia trachomatis infection in vitro. Proc Nat Acad Sci U S A. 1993;90:
3998 – 4002.
9. Gaydos CA, Summersgill JT, Sahney NN, et al. Replication of Chlamydia
pneumoniae in vitro in human macrophages, endothelial cells, and aortic
artery smooth muscle cells. Infect Immun. 1996;64:1614 –1620.
10. Boman J, Sonderberg S, Forsberg J, et al. High prevalence of Chlamydia
pneumoniae DNA in peripheral blood mononuclear cells in patients with
cardiovascular disease and in middle-aged blood donors. J Infect Dis.
1998;178:274 –277.
11. Wong YK, Dawkins KD, Ward ME. Circulating Chlamydia pneumoniae
DNA as a predictor of coronary artery disease. J Am Coll Cardiol.
1999;34:1435–1439.
12. Airenne S, Surcel HM, Alakärppä H, et al. Chlamydia pneumoniae
infection in human monocytes. Infect Immun. 1999;67:1445–1449.
13. Gieffers J, Solbach W, Maass M. In vitro susceptibilities of Chlamydia
pneumoniae strains recovered from atherosclerotic coronary arteries.
Antimicrob Agents Chemother. 1998;42:2762–2764.
14. Gaydos CA, Quinn CT, Bobo LD, et al. Similarity of Chlamydia pneumoniae strains in the variable domain IV region of the major outer
membrane protein gene. Infect Immun. 1992;60:5319 –5323.
356
Circulation
January 23. 2001
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
15. Maass M, Jahn J, Gieffers J, et al. Detection of Chlamydia pneumoniae
within peripheral blood monocytes of patients with unstable angina or
myocardial infarction. J Infect Dis. 2000;181(suppl 3):449 – 451.
16. The ACCP/SCCM Consensus Conference Committee. American College
of Chest Physicians/Society of Crit Care Med: definitions for sepsis and
organ failure and guidelines for the use of innovative therapies in sepsis.
Chest. 1992;101:1644 –1655.
17. Muhlestein JB, Hammond EH, Carlquist JF, et al. Increased incidence of
Chlamydia species within the coronary arteries of patients with symptomatic atherosclerotic versus other forms of cardiovascular diseases.
J Am Coll Cardiol. 1996;27:1555–1561.
18. Kuo CC, Shor A, Campbell LA, et al. Demonstration of Chlamydia
pneumoniae in atherosclerotic lesions of coronary arteries. J Infect Dis.
1993;167:841– 849.
19. Shor A, Phillips JI, Ong G, et al. Chlamydia pneumoniae in atheroma:
consideration of criteria for causality. J Clin Pathol. 1998;51:812– 817.
20. Redecke V, Dalhoff K, Bohnet S, et al. Interaction of Chlamydia pneumoniae and human alveolar macrophages: infection and inflammatory
response. Am J Respir Cell Mol Biol. 1998;19:721–727.
21. Quinn TC, Gaydos CA. In vitro infection and pathogenesis of Chlamydia
pneumoniae in endovascular cells. Am Heart J. 1999;138(suppl):
507–511.
22. Kol A, Libby P. Molecular mediators of arterial inflammation: a role for
microbial products? Am Heart J. 1999;138(suppl):450 – 452.
23. Koehler L, Nettelnbreker E, Hudson AP, et al. Ultrastructural and
molecular analysis of the persistence of Chlamydia trachomatis (serovar
K) in human monocytes. Microb Pathog. 1997;22:133–142.
24. Hammerschlag MR, Chirgwin K, Roblin PM, et al. Persistent infection
with Chlamydia pneumoniae following acute respiratory illness. Clin
Infect Dis. 1992;14:178 –182.
25. Muhlestein JB, Anderson JL, Carlquist J, et al. Randomized secondary
prevention trial of azithromycin in patients with coronary artery disease:
primary clinical results of the ACADEMIC study. Circulation. 2000;102:
1755–1760.
26. Gurfinkel E, Bozovich G, Beck E, et al. Treatment with the antibiotic
roxithromycin in patients with acute non-Q-wave coronary syndromes.
Eur Heart J. 1999;20:121–127.
27. Jackson LA, Smith NL, Heckbert SR, et al. Lack of association between
first myocardial infarction and past use of erythromycin, tetracycline, or
doxycycline. Emerg Infect Dis. 1999;5:281–284.
28. Meier CR, Derby LE, Jick SS, et al. Antibiotics and risk of subsequent
first-time acute myocardial infarction. JAMA. 1999;281:427– 431.
29. Muhlestein J, Jeffrey LA, Hammond EH, et al. Infection with Chlamydia
pneumoniae accelerates the development of atherosclerosis and treatment
with azithromycin prevents it in a rabbit model. Circulation. 1998;97:
633– 636.
30. Kutlin A, Roblin PM, Hammerschlag MR. In vitro activities of
azithromycin and ofloxacin against Chlamydia pneumoniae in a
continuous-infection model. Antimicrob Agents Chemother. 1999;43:
2268 –2272.
31. Beatty WL, Belanger TA, Desal AA, et al. Tryptophan depletion as a
mechanism of gamma interferon-mediated chlamydial persistence. Infect
Immun. 1994;62:3705–3711.
Chlamydia pneumoniae Infection in Circulating Human Monocytes Is Refractory to
Antibiotic Treatment
Jens Gieffers, Henriette Füllgraf, Jürgen Jahn, Matthias Klinger, Klaus Dalhoff, Hugo A. Katus,
Werner Solbach and Matthias Maass
Downloaded from http://circ.ahajournals.org/ by guest on June 16, 2017
Circulation. 2001;103:351-356
doi: 10.1161/01.CIR.103.3.351
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2001 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/103/3/351
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/