Proceedings of the SMBE Tri-National Young Investigators’ Workshop 2005
Insight into the Diversity and Evolution of the Cryptomonad
Nucleomorph Genome
Christopher E. Lane,1 Hameed Khan,1 Melissa MacKinnon, Anna Fong,
Stan Theophilou,2 and John M. Archibald
Genome Atlantic and the Canadian Institute for Advanced Research, Program in Evolutionary Biology,
Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada
The cryptomonads are an enigmatic group of marine and freshwater unicellular algae that acquired their plastids through
the engulfment and retention of a eukaryotic (‘‘secondary’’) endosymbiont. Together with the chlorarachniophyte algae, the
cryptomonads are unusual in that they have retained the nucleus of their endosymbiont in a miniaturized form called
a nucleomorph. The nucleomorph genome of the cryptomonad Guillardia theta has been completely sequenced and with
only three chromosomes and a total size of 551 kb, is a model of nuclear genome compaction. Using this genome as
a reference, we have investigated the structure and content of nucleomorph genomes in a wide range of cryptomonad
algae. In this study, we have sequenced nine new cryptomonad nucleomorph 18S ribosomal DNA (rDNA) genes and
four heat shock protein 90 (hsp90) gene fragments, and using pulsed-field gel electrophoresis and Southern hybridizations,
have obtained nucleomorph genome size estimates for nine different species. We also used long-range polymerase
chain reaction to obtain nucleomorph genomic fragments from Hanusia phi CCMP325 and Proteomonas sulcata
CCMP704 that are syntenic with the subtelomeric region of nucleomorph chromosome I in G. theta. Our results indicate
that (1) the presence of three chromosomes is a common feature of the nucleomorph genomes of these organisms, (2)
nucleomorph genome size varies dramatically in the cryptomonads examined, (3) unidentified cryptomonad species
CCMP1178 has the largest nucleomorph genome identified to date at ;845 kb, (4) nucleomorph genome size reductions
appear to have occurred multiple times independently during cryptomonad evolution, (5) the relative positions of the 18S
rDNA, ubc4, and hsp90 genes are conserved in three different cryptomonad genera, and (6) interchromosomal recombination appears to be rapidly changing the size and sequence of a repetitive subtelomeric region of the nucleomorph
genome between the 18S rDNA and ubc4 loci. These results provide a glimpse into the genetic diversity of nucleomorph
genomes in cryptomonads and set the stage for more comprehensive sequence-based studies in closely and distantly
related taxa.
Introduction
Endosymbiosis has played a significant role in the genetic, biochemical, and ultrastructural diversification of the
eukaryotic cell. In the case of photosynthetic eukaryotes,
the primary endosymbiosis that gave rise to plastids (chloroplasts) probably occurred more than one billion years ago
(Yoon et al. 2004) and had a huge impact on the composition of the nuclear genome of plants and algae (Martin
et al. 2002; Archibald 2005). Three extant eukaryotic lineages, the glaucocystophytes (or glaucophytes), red algae,
and green algae (and their land plant relatives) harbor plastids that trace their ancestry directly back to the original
cyanobacterial endosymbiont. The plastids of all other photosynthetic eukaryotes were acquired more recently
through endosymbiotic mergers between two eukaryotic
cells in what is referred to as secondary endosymbiosis.
This process has occurred multiple times during eukaryotic
evolution and has involved both green and red algal secondary endosymbionts (see Delwiche 1999; Keeling 2004;
Archibald and Keeling 2005 for review). The molecular
and morphological diversity of secondary plastid-containing algae is immense and includes a significant fraction of
1
2
These authors contributed equally to this work.
Present address: DNA Technologies, Halifax, Nova Scotia, Canada.
Key words: nucleomorph, genome, cryptomonads, ribosomal RNA
genes, evolution.
E-mail: [email protected].
Mol. Biol. Evol. 23(5):856–865. 2006
doi:10.1093/molbev/msj066
Advance Access publication November 23, 2005
Ó The Author 2005. Published by Oxford University Press on behalf of
the Society for Molecular Biology and Evolution. All rights reserved.
For permissions, please e-mail: [email protected]
the primary producers in the world’s oceans such as the
haptophyte and dinoflagellate algae, heterokonts (e.g., diatoms and their multicellular relatives the brown algae),
cryptomonads, and the chlorarachniophytes (Delwiche
1999; Keeling 2004). Remarkably, several instances of
tertiary endosymbiosis have also been documented in the
dinoflagellates, where specific genera have replaced their
‘‘ancestral’’ secondary plastid with that of another secondary plastid-containing alga (see Bhattacharya, Yoon, and
Hackett 2003; Hackett et al. 2004 for comprehensive review). Unlike primary plastids, which are surrounded by
two membranes, secondary plastids are characterized by
the presence of three or four membranes surrounding the
organelle (Delwiche 1999), a feature that results in a more
complex plastid protein targeting pathway in secondary
plastid-containing algae (reviewed by McFadden 1999;
van Dooren et al. 2001).
The cryptomonad and chlorarachniophyte algae are of
particular interest with respect to the origin and evolution of
secondary plastids. This is because unlike all other secondary plastid-containing algae, they still retain the nucleus
of their eukaryotic endosymbionts in a highly reduced form called a ‘‘nucleomorph.’’ Nucleomorphs were first described by Greenwood (1974; Greenwood, Griffiths, and
Santore 1977) in cryptomonads as tiny double-membrane–
bound bodies nested between the inner and outer pairs of
plastid membranes, with nuclear pore-like structures and an
electron-dense region resembling a nucleolus (Morrall and
Greenwood 1982). Histological studies revealed the
Nucleomorph Genome Diversity in Cryptomonads 857
presence of DNA within the nucleomorph (Hansmann,
Falk, and Sitte 1985; Ludwig and Gibbs 1985), and gene
sequencing and immunolocalization studies confirmed that
cryptomonad and chlorarachniophyte nucleomorph genomes possess their own small subunit ribosomal (SSU)
RNA (18S rRNA) genes distinct from those encoded in
the host nucleus (Hansmann 1988; Douglas et al. 1991;
Eschbach et al. 1991; Maier et al. 1991; McFadden et al.
1994), protein genes typical of eukaryotic nuclear genomes
(Hofmann et al. 1994; Rensing et al. 1994; Gilson and
McFadden 1996; Zauner et al. 2000), as well as telomerelike repeats on the ends of their chromosomes (Gilson and
McFadden 1995; Gilson and McFadden 1996; Zauner et al.
2000). Maier et al. (1991) and Eschbach et al. (1991) pioneered the use of pulsed-field gel electrophoresis (PFGE) as
a tool for investigating the karyotypic structure of nucleomorph genomes. Using this technique, these authors showed
that the nucleomorph of the cryptomonad Rhodomonas
salina (formerly Pyrenomonas salina) harbors just three
chromosomes, ;195, 225, and 240 kb in size (Eschbach
et al. 1991). More recently, Rensing et al. (1994) showed
that the presence of three chromosomes, each with rDNA
cistrons, is a widespread feature of cryptomonad nucleomorphs, as is the presence of a nucleomorph-encoded heat
shock protein 70 (hsp70) gene.
Genome-scale analyses have confirmed that the chlorarachniophyte and cryptomonad nucleomorphs harbor the
smallest and most compact eukaryotic genomes known.
The nucleomorph genomes of the cryptomonad Guillardia
theta and the chlorarachniophyte Bigelowiella natans have
been completely sequenced (Douglas et al. 2001; Gilson
and McFadden 2002; G. I. McFadden, personal communication) and are similar in size and structure. Both genomes
are comprised of three chromosomes: in G. theta, chromosomes I, II, and III are ;196, 181, and 174 kb, respectively,
with a total genome size of only 551 kb (Douglas et al.
2001). The B. natans genome is even smaller at ;380
kb, with chromosomes of ;145, 140, and 98 kb (Gilson
and McFadden 2002). Both genomes are extraordinarily
gene rich (approximately one gene per kilobase) and A
1 T biased (;75%; Gilson, Maier, and McFadden 1997;
Gilson 2001; Gilson and McFadden 2002). Overall, these
similarities represent a remarkable instance of convergent
evolution because molecular phylogenetic analyses have
revealed that the G. theta and B. natans nucleomorphs
are of independent origin: while the cryptomonad secondary endosymbiont is derived from a red alga (e.g., Douglas
et al. 1991; Van der Auwera et al. 1998; Archibald et al.
2001), the endosymbiont of chlorarachniophytes was most
likely a green alga (McFadden, Gilson, and Waller 1995;
Ishida et al. 1997; Ishida, Green, and Cavalier-Smith
1999; Archibald et al. 2003). The nucleomorph genomes
of both groups appear to have shrunk to approximately
the same size and structure from unrelated free-living algal
ancestors with presumably dozens of nuclear chromosomes.
While preliminary analyses of nucleomorph genomes
in cryptomonad and chlorarachniophyte algae have provided a wealth of information on their basic structure
and composition (see Gilson and McFadden 2002 for comprehensive review), very little is known about the diversity
of nucleomorphs within the two lineages. In order to study
the processes of nucleomorph-to-host-nucleus gene transfer
and nucleomorph genome reduction, and to begin to understand why nucleomorphs have been retained in cryptomonads and chlorarachniophytes but have been lost in all other
secondary plastid-containing algae, it is necessary to explore the diversity of nucleomorph genomes among different members of both groups. To that end, we are
investigating the structure and composition of nucleomorph
genomes in diverse cryptomonads using the complete
nucleomorph genome of G. theta as a reference (Douglas
et al. 2001). Here we present PFGE data indicating that
the presence of three nucleomorph chromosomes is a common feature of all cryptomonads investigated thus far
and that some species have nucleomorph genomes over
800 kb in size, much larger than that of G. theta. A comparison of nucleomorph genome fragments obtained by
long-range polymerase chain reaction (PCR) from
Hanusia phi CCMP325 and Proteomonas sulcata
CCMP704 with the G. theta genome provides insight
into the concerted evolution of cryptomonad nucleomorph
chromosome ends.
Materials and Methods
DNA Extraction, PCR, Cloning, and Sequencing
Cryptomonad cultures were obtained from public culture collections (table 1) and grown in the laboratory under
designated conditions. DNA was extracted from cell pellets
using a Tris-HCl digestion buffer (200 mM Tris-HCl (pH
7.5), 250 mM NaCl, 25 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 0.5% sodium dodecyl sulfate) at
50°C for 10 min. After incubation, samples were centrifuged for 5 min at 15,0003g, and the aqueous phase
was subjected to two rounds of protein extraction with phenol and chloroform. Nucleic acids were precipitated from
the aqueous layer and following centrifugation, pellets were
washed and rehydrated in 50 ll of water and stored at
ÿ20°C.
PCR was used to amplify nucleomorph 18S rDNA,
hsp90, ubc4-hsp90, 18S rDNA-ubc4, and 18S rDNAhsp90 gene fragments. For 18S rDNA amplifications,
primers were designed to preferentially amplify the
nucleomorph copy of the gene (CrNMSSU.F1—
CAGTAGTCATATGCTTGTCTTAAG and CrNMSSU.R1—
TGTACAAAGGGCAGGGACGTATTCAGC). The thermal profile for PCR amplification of 18S rDNA included
an initial denaturation cycle of 94°C for 5 min followed by
45 cycles of 94°C for 30 s, 50°C for 1 min, and 72°C for
4 min. A final extension step was performed at 72°C for
10 min followed by storage at 10°C until the samples
were processed. For hsp90, a degenerate set of primers
(hsp90F3—GCACCATTYGAYCTNTTYGANCC
and
hsp90R3—CATATTAGCACTCCANCCRTAYTCNCC)
was designed based on an alignment of diverse eukaryotic
hsp90 amino acid sequences. Reactions were performed as
above with annealing temperatures of 48–55°C and an extension time of 2 min. Long-range PCR was also used to amplify
nucleomorph genome fragments between the 18S rDNA and
ubc4 loci in H. phi (hpSSUrRNA.R1—GAGCCATTCGCAGTTTCACGGTAC and hpubc4.R1—GGAGCTGATTGAGAGTAATACC) and between the 18S rDNA
858 Lane et al.
Table 1
Taxa and GenBank Accession Numbers Used for Phylogenetic Analysis
Taxon Name
Chroomonas mesostigmatica R. Butcher ex
D. R. A. Hill
Chroomonas sp.
Chroomonas sp.
Chroomonas sp.
Chroomonas sp.
Chroomonas sp.
Cryptomonas borealis Skuja emend.
Hoef-Emden et Melkonian
Cryptomonas curvata Ehrenberg emend.
Hoef-Emden et Melkonian
Cryptomonas gyropyrenoidosa Hoef-Emden
et Melkonian
Cryptomonas lundii Hoef-Emden et
Melkonian
Cryptomonas marssonii (Braarud) Skuja
emend. Hoef-Emden et Melkonian
Cryptomonas ovata Ehrenberg emend.
Hoef-Emden et Melkonian
C. ovata
Cryptomonas paramecium (Ehrenberg)
Hoef-Emden et Melkonian
C. paramecium
Cryptomonas pyrenoidifera Geitler emend.
Hoef-Emden et Melkonian
C. pyrenoidifera
Cryptomonas sp.
Cryptomonas sp.
Cryptomonas sp.
Cryptomonas tetrapyrenoidosa Skuja emend.
Hoef-Emden et Melkonian
Falcomonas daucoides (W. Conrad &
H. Kufferath) D. R. A. Hill
Geminigera cryophila (D. L. Taylor &
C. C. Lee) D. R. A. Hill
Guillardia theta D. R. A. Hill & R. Wetherbee
Hanusia phi J. A. Deane
Hemiselmis rufescens Parke
Hemiselmis virescens Droop
Komma caudata (L. Geitler) D. R. A. Hill
Proteomonas sulcata D. R. A. Hill &
R. Wetherbee
Rhinomonas pauca D. R. A. Hill &
R. Wetherbee
Rhodomonas abbreviata (R. W. Butcher)
D. R. A. Hill & R. Wetherbee
Rhodomonas baltica Karsten
Rhodomonas lens Pascher & Ruttner
Rhodomonas mariana (Dangeard)
Lemmermann
Rhodomonas salina (Wislouch) D. R. A.
Hill & R. Wetherbee
R. salina
R. salina
Rhodomonas sp.
Storeatula major Butcher ex D. R. A. Hill
Teleaulax amphioxeia (W. Conrad)
D. R. A. Hill
Unidentified Cryptomonad
Unidentified Cryptomonad
Unidentified Cryptomonad
Culture Strain
GenBank Accession Number
CCMP1168
CCMP270
M1312
M1318
M1418
SAG B980-1
DQ228123
DQ228124
AJ420678
AJ420679
AJ420680
AJ420677
M1083
AJ566185
M1484
AJ566179
M1079
AJ420686
M0850
AJ566184
M1476
AJ566175
CCAC0064
M1097
AJ566178
AJ566178
CCAP979/2a
M1303
AJ715466
AJ420676
CCAP979/61
CCMP152
M0739
M0741
SAG2013
AJ420684
AJ420675
AJ420683
AJ566172
AJ566176
M1639
AJ566181
Fada ShP-CSUCC
AJ420689
CS-138
CCMP327
CCMP325
CCMP439
CCMP443
MUCC10
U53123
NC_002752
U53125
AJ420690
AJ420691
U53121
CCMP 704
AJ420692
MUCC47
U53131
CCMP976
RCC350
CCMP 739
U53127
DQ228118
DQ228121
M. Schorpp, 37097
X81374
CCMP1319
CCMP1170
Unknown
CCMP768
CCMP320
DQ228119
DQ228120
X55032
DQ228116
U53129
SCCAP K-0434
CCMP1178
CCMP2045
Uncultured
AJ421146
DQ228123
DQ228117
U53191
NOTE.—Numbers in bold were obtained in this study. Culture collection abbreviations are as follows: CCAC—Culture Collection
of Algae at the University of Cologne, Germany; CCAP—Culture Collection of Algae and Protozoa, USA; CCMP—Provasoli-Guillard National Center for Culture of Marine Phytoplankton, USA; CS—Commonwealth Scientific and Industrial Research Organization
Collection of Living Microalgae, Australia; M—Michael Melkonian, Germany; MU—Mugla University Collection of Microorganisms, Turkey; RCC—Roscoff Culture Collection, France; SAG—Sammlung von Algenkulturen Göttingen, Germany; SCCAP—
Scandinavian Culture Centre for Algae and Protozoa.
Nucleomorph Genome Diversity in Cryptomonads 859
and hsp90 genes in P. sulcata (18S.NMrRNA.R2—GAGACATGCATGGCTTAATCC and prsuNMhsp90.R1—
GGAAGATCTTCAGAGTCAATTACTCC).Reactionswere
performed as above with Platinum Taq DNA polymerase
High Fidelity (Invitrogen, Carlsbad, Calif.) and an extension time of 4 min.
PCR products were purified using the MinElute Gel
Extraction Kit (Catalog number 28604, Qiagen Sciences,
Valencia, Calif.) and sequenced directly or cloned using
the Topo TA Cloning Kit (Invitrogen, Carlsbad, Calif.)
according to the manufacturer’s protocol. Three to eight
independent clones were chosen per transformation for
sequencing using PCR and sequencing primers (SSUni1—
CAAGGAAGGCAGCAGGCGCG, SSUni3—TTGATCAAGAACGAAAGT, and SSUni2—CTGGGGGGAGTATGGTCGC). Sequencing reactions were performed using
the CEQ Dye Terminator Cycle Sequencing kit (Beckman
Coulter, Inc., Fullerton, Calif.) and a Beckman Coulter
CEQ8000. DNA sequences determined in this study have
been deposited in GenBank under the following accession
numbers: DQ228116–DQ228124.
PFGE
Agarose plugs for PFGE were prepared using the protocol of Eschbach et al. (1991) using 2 liters of log-phase culture for a final density of 1.5–2.0 3 108 cells. Plugs were run
in a CHEF-DR III Pulsed Field Electrophoresis System (BioRad Laboratories, Hercules, Calif.), on 1% agarose boric ethylenediamine tetraacetic acid (TBE) (13 TBE) gels in 0.5%
TBE buffer, at 14.0°C. PFGE was performed using a 60-h run
time, a voltage of 4.1 V/cm and a 30–10 s switch time.
Southern Blotting and Hybridization
Gels were blotted onto positively charged nylon membranes (Roche Diagnostics Corp., Indianapolis, Ill.) using
the method described in Current Protocols in Molecular
Biology (Wiley Interscience, http://www3.interscience.
wiley.com/cgi-bin/mrhome/104554809/HOME). An ;319bp fragment of nucleomorph 18S rDNA was PCR amplified
(SSUprb1—ATCATTCAAATTTCTGCC and SSUprb2—
GCAGTTAAAAAGCTCGTAGTCG) and labeled using
the PCR digoxygenin (DIG) Synthesis Kit (Roche Diagnostics Corp.) and used as a probe in Southern hybridizations.
Hybridization reactions were performed overnight at 57°C,
and membranes were processed using the DIG Luminescent
Detection Kit and CDP-Star substrate (Roche Diagnostics
Corp.). Probes for nucleomorph ubc4 and hsp90 genes were
generated similarly and used in hybridizations at 45–50°C.
Data Analyses
Overlapping DNA fragments were aligned and edited
in Sequencher 4.2 (Gene Codes Corporation, Ann Arbor,
Mich.). Artemis (The Sanger Institute) was used to search
for open reading frames (ORFs) in nucleomorph DNA and
to construct G 1 C content profiles, and codon usage patterns were determined using codonw (http://bioweb.pasteur.
fr/seqanal/interfaces/codonw.html). DNA fragments were
searched for the presence of tRNA genes using tRNAScan
(http://www.genetics.wustl.edu/eddy/tRNAscan-SE/).
Multiple sequence alignments of DNA and protein
sequences were constructed and edited with MacClade
4.06 (W. Maddison and D. Maddison 2003). Ambiguously
aligned data were removed from alignments prior to phylogenetic analysis. The nucleomorph 18S rDNA sequence
alignment (1428 nucleotide positions and 43 taxa) was subjected to maximum likelihood (ML), neighbor joining (NJ),
and bootstrap analyses in PAUP* v 4.0b10 (Swofford 2002),
whereas Bayesian analyses were performed with MrBayes v
3.0 (Huelsenbeck and Ronquist 2003). Model parameters
used in ML and NJ analyses were estimated in Modeltest
(Posada and Crandall 1998). Ten random addition replicates
under the heuristic search method, using Tree BisectionReconnection branch swapping, were completed under
ML analysis. Bootstrap analyses (1,000 replicates) were
calculated under NJ. Three independent runs of one million
generations and one of four million generations were run in
MrBayes using default values and the general time reversible
model (GTR 1 I 1 C) with parameters estimated during the
analyses. Trees were sampled every 100 generations and
‘‘burn-in’’ values around 160,000 generations were determined by visual inspection of likelihood values. The first
400,000 generations were discarded to ensure stabilization,
and the remaining trees were used to construct the consensus.
Amino acid sequences inferred from partial cryptomonad nucleomorph hsp90 genes were added to a preexisting
alignment of eukaryotic hsp90 proteins. Phylogenetic trees
were inferred from C-corrected distance matrices (calculated using Tree-Puzzle 5.0 [http://www.tree-puzzle.de/]
with eight rate categories and an invariable rate category)
using Fitch-Margoliash in PHYLIP 3.6 (http://evolution.
genetics.washington.edu/phylip.html) and weighted neighbor joining (Bruno, Socci, and Halpern 2000).
Results
Nucleomorph Genome Size Diversity
We used a combination of PFGE and Southern hybridizations to explore the diversity of nucleomorph genomes in
a wide range of cryptomonad species. Preliminary experiments were performed on 15 different strains, nine of which
proved amenable to chromosome preparation and PFGE
analysis. The visibility of nucleomorph chromosomes under ethidium bromide staining varied from strain to strain,
but Southern blots with a heterologous G. theta nucleomorph 18S rDNA probe produced clear hybridization signals for three chromosomes in each of the nine organisms
(significant cross-hybridization with higher molecular
weight host nuclear chromosomes also occurred; fig. 1).
The known sizes of the yeast and G. theta nucleomorph
chromosomes were used to construct a standard logarithmic
curve against which the migration distances of these chromosomes were compared (data not shown), and sizes were
interpolated and rounded to the nearest 5 kb. The relative
nucleomorph chromosome sizes were consistent across
multiple independent PFGE runs, although should be considered rough estimates because variations in the total
amount of DNA per lane can influence the chromosome
migration rate.
Overall, cryptomonad nucleomorph genome size was
found to vary significantly in the different strains tested,
860 Lane et al.
FIG. 1.—Nucleomorph genome size diversity in cryptomonad algae.
(Left) Ethidium bromide-stained chromosomes of the model cryptomonad
Guillardia theta (CCMP327) separated by PFGE. The size standard shown
is the yeast, Saccharomyces cerevisiae. (Right) Southern hybridization of
PFGE-separated chromosomes using a G. theta nucleomorph SSU rDNA
probe (see Materials and Methods). Arrowheads indicate the inferred positions of nucleomorph chromosomes based on multiple exposures of this
and other Southern hybridizations. Cryptomonad species left to right are G.
theta, Proteomonas sulcata, Rhodomonas salina, unidentified (Unid) cryptomonad species, Rhodomonas lens, Chroomonas mesostigmatica, Chroomonas sp., and Rhodomonas sp. Numbers provided are CCMP strain
designations. Total nucleomorph genome size estimates are shown at
the bottom of each lane (see Results). Significant cross-hybridization with
the host nucleus 18S rDNA is apparent in most species.
between ;570 and ;845 kb (fig. 1). The nucleomorph genome of P. sulcata CCMP704 is most similar in size to that
of G. theta (551 kb) and at ;570 kb is significantly smaller
than any of the other strains examined. Within strains classified as members of the genus Rhodomonas, nucleomorph
genome size is quite variable, between ;650 and ;755 kb.
Despite this variation, a common feature in these organisms
is the presence of two large chromosomes that are close
in size and a significantly smaller one. At ;845 kb, the
nucleomorph genome of the unidentified cryptomonad species 1178 is the largest identified to date. Our study reveals
that members of the distantly related genus Chroomonas
also possess large nucleomorph genomes, with three similarly sized chromosomes totaling over 800 kb (fig. 1).
Cryptomonad 18S rDNA Phylogeny
With the goal of placing the nucleomorph karyotype
data in a phylogenetic context, we sequenced the nucleomorph 18S rDNA gene from each of the cryptomonad
strains examined above, with the exception of R. salina
CCMP1420 and P. sulcata CCMP704 (GenBank accession
number AJ420692). The 18S rDNA genes were also sequenced from Rhodomonas baltica and unidentified cryptomonad CCMP2045, two species for which we were
unable to obtain nucleomorph karyotype data. These genes
were added to a comprehensive alignment of publicly available 18S rDNA sequences, and a variety of rooted and unrooted phylogenetic analyses were performed. In rooted
analyses, a set of eight bangiophyte sequences were used
as an outgroup to the cryptomonad nucleomorph genes,
and the position of the root was found to lie between the
Rhodomonas clade and all other cryptomonads (data not
shown). While this topology is well supported and consistent with the nuclear 18S phylogenies of Deane et al.
(2002), it is at odds with other studies, which place either
the genus Cryptomonas or the Chroomonas/Hemiselmis
clade at the base of the cryptomonad tree (Cavalier-Smith
et al. 1996; Marin, Klingberg, and Melkonian 1998; HoefEmden, Marin, and Melkonian 2002). In the interest of
obtaining better resolution among the ingroup taxa, the
outgroup was removed and the analyses were repeated using an alignment containing more sites. A Bayesian phylogeny (identical topology to ML tree) is shown in figure 2,
arbitrarily rooted between the Rhodomonas clade and the
remaining taxa. The topology is largely congruent with
the phylogenies presented in two recent comprehensive
studies using nuclear 18S (Deane et al. 2002; Hoef-Emden,
Marin, and Melkonian 2002) and nucleomorph 18S data
(Hoef-Emden, Marin, and Melkonian 2002). This includes
the resolution of a monophyletic Rhodomonas clade (which
also includes Storeatula major and Rhinomonas pauca)
and strongly-supported Cryptomonas and Chroomonas/
Hemiselmis clades.
The 18S phylogeny allowed us to place formerly unidentified taxa in a generic context (unidentified cryptomonad species CCMP1178 and CCMP2045 both branched
within the Rhodomonas clade) as well as interpret the PFGE
data from an evolutionary perspective. For comparison, the
nucleomorph genome size estimates shown in figure 1 and
those taken from previous studies (Rensing et al. 1994;
Deane et al. 1998) are mapped onto the 18S rDNA phylogeny shown in figure 2. The size variations within the wellsupported Rhodomonas, Cryptomonas, and Chroomonas/
Hemiselmis clades, combined with the fact that nucleomorph genome sizes of over 800 kb are present within Rhodomonas and Chroomonas, suggest that nucleomorph
genome size reductions have occurred multiple times independently during cryptomonad evolution, including a 23%
size reduction within Rhodomonas, if CCMP1178 is
considered a member of this genus.
Nucleomorph Genome Synteny
The complete nucleomorph genome of G. theta consists of three chromosomes (;196, 181, and 174 kb in size),
each with subtelomeric rDNA cistrons (comprised of 5S,
28S, 5.8S, and 18S genes) and a stretch of repetitive
DNA encoding a set of five small hypothetical ORFs
(Douglas et al. 2001). A gene for the ubiquitin conjugating
enzyme (ubc4) follows this repetitive region on five of the
six chromosome ends (missing on one end of chromosome
I), and a single-copy gene encoding hsp90 is internal to
ubc4 (Zauner et al. 2000; Douglas et al. 2001; fig. 1A).
As a launch point for sequence-based nucleomorph genome
diversity studies, we used degenerate PCR to isolate
Nucleomorph Genome Diversity in Cryptomonads 861
FIG. 2.—Bayesian phylogenetic tree of cryptomonad nucleomorph 18S rDNA genes. Sequences obtained in this study are in bold and both posterior
probabilities (left) and boostrap support values (right) are provided. Nucleomorph genome sizes estimated in this study are shown. The nucleomorph
genome of Guillardia theta CCMP 327 has been completely sequenced (Douglas et al. 2001), and our sizes estimated from the data of Rensing et al.
(1994), and those by Deane et al. (1998), are labeled with a superscript 1 and 2, respectively. The topology shown here was identical to that from ML
analysis. ‘‘*’’ indicates a support value of 100, whereas ‘‘ÿ’’ is used for values less than 50. The scale bar indicates the inferred number of nucleotide
substitutions per site.
a 742-bp hsp90 gene fragment from H. phi CCMP325, P.
sulcata CCMP704, R. salina CCMP1319, and Chroomonas mesostigmatica CCMP1168. Phylogenetic analysis
of these sequences in the context of a range of eukaryotic
cytosolic hsp90 proteins revealed that, as expected, the new
genes were most similar to the G. theta nucleomorph hsp90
sequence (data not shown) and exhibited similar base composition biases (28%–30% G 1 C). These data are consistent with the hypothesis that the new hsp90 sequences are
encoded in the nucleomorph genome in these species. PCR
experiments using the same primers on Storeatula sp.
CCMP1868 and Rhodomonas lens CCMP739 gDNAs
failed to generate products of the expected size.
In an attempt to determine the genomic context of the
hsp90 genes described above, we employed the ‘‘walking
PCR’’ approach of Katz et al. (2000). We were successful in
determining the complete 3# end of the hsp90 gene from C.
mesostigmatica, but the maximum extension product went
only 37 bp beyond the stop codon and did not reveal
the identity of the adjacent gene. Similar attempts to extend the hsp90 gene fragment in P. sulcata failed, and we
therefore focused on a more directed approach, designing
862 Lane et al.
FIG. 3.—Conservation of nucleomorph genome structure and content in the cryptomonads Guillardia theta, Hanusia phi, and Proteomonas sulcata.
(A) Top, schematic of subtelomeric region of nucleomorph chromosome I in G. theta (nucleotides 6,175–14,828). ORFs are shown as in Douglas et al.
(2001), except hsp82 is labeled hsp90. The positions of PCR primers are shown. Bottom, plot of the variation in G 1 C content across this region
calculated with a 100 bp sliding window. (B and C) Syntenic regions obtained by PCR from H. phi (B) and P. sulcata (C). G 1 C content is shown
as in (A), with arrowheads indicating a shift in G 1 C content downstream of the ubc4 gene. For P. sulcata, G 1 C profiles were calculated separately for
the 5# and 3# ends of the fragment and scale to one another, because the two ends could not be linked together (see text). Hypothetical ORFs encoding
proteins greater than 60 amino acids in length are annotated. Genes shown above the line are transcribed left to right, those on the bottom, right to left.
gene-specific primers base on the arrangement of genes in
the G. theta genome. To determine if hsp90 is next to ubc4
in other cryptomonad nucleomorph genomes, primers were
designed to the ubc4 and hsp90 genes and used in PCRs on
gDNAs from C. mesostigmatica, R. salina, P. sulcata, and
H. phi, a cryptomonad closely related to G. theta (fig. 2;
Deane et al. 1998). Bands of the expected size (;1,600
bp) were obtained from H. phi and P. sulcata, although only
the H. phi product proved to be a bona fide ubc4-hsp90
product. We then used long-range PCR to extend this genomic fragment across to the 5# end of the 18S rDNA gene
in H. phi and PCR amplified and sequenced a fragment of
nucleomorph DNA between the 18S and hsp90 loci in P.
sulcata. Attempts to extend these fragments to the gamma
tubulin gene (tubG), which is located three genes downstream of hsp90 on chromosome I in G. theta, were unsuccessful. We also tried and failed to determine the genomic
context of the hsp70 gene in H. phi. Hsp70 has been shown
to be present in a wide range of cryptomonad nucleomorph
genomes (Rensing et al. 1994) and in G. theta is located
near the center of chromosome I, flanked by genes for proteasome subunit B6 (prs B6) and U3 small nucleolar ribonucleoprotein IMP4 (Douglas et al. 2001). Degenerate
primers designed to these three genes failed to give PCR
products of the expected sizes, possibly because of genomic
rearrangements or loss of one or more of these genes in the
H. phi nucleomorph genome (see Discussion).
The results of the successful long-range PCR experiments are summarized in figure 3. A comparison of the H.
phi and P. sulcata genomic fragments with the subtelomeric
region of chromosome I in G. theta (fig. 3A) revealed that
while the relative positions of the 18S rDNA, ubc4, and
hsp90 genes are conserved, the intergenic spacers vary considerably and are comprised of repetitive and low-complexity sequence. The distance between the 5# end of the 18S
rDNA and ubc4 genes in G. theta is 4,050 bp but is only
3,412 and ;830 bp in H. phi and P. sulcata, respectively.
As in G. theta, several short hypothetical ORFs were identified between the 18S rDNA and ubc4 genes in H. phi (fig.
3B), although these showed no similarity to those in the G.
theta genome (Douglas et al. 2001). No tRNA genes were
found. In P. sulcata, a short hypothetical ORF was present
in the ;400-bp region between ubc4 and hsp90 and another
was adjacent to the 18S rDNA gene (fig. 3C). We were unable to sequence ;300 bp of this fragment due to the presence of G 1 C-rich tracts that prematurely terminated
extension reactions. Attempts to sequence through this area
using smaller PCR and cloned products as template and
with a variety of alternative primers and sequencing protocols were unsuccessful.
To explore the genomic structure of the P. sulcata nucleomorph further, we used a P. sulcata ubc4 probe in
a Southern blot against PFGE-separated chromosomes
and obtained positive hybridization signals for all three
Nucleomorph Genome Diversity in Cryptomonads 863
nucleomorph chromosomes in this organism and in G. theta
(data not shown). This indicates that the ubc4 gene is present
in at least one copy on all three chromosomes in P. sulcata,
as is the case in G. theta (Douglas et al. 2001) (and likely in
H. phi). Apart from three instances of clonal length heterogeneity in poly-A tracts near the 3# end of ORF87 in H. phi
(1-, 2-, or 3-bp differences), and another in P. sulcata, very
little sequence variability was observed in the long-range
PCR products described in this study. For example, three
independent clones were completely sequenced for the P.
sulcata fragment, and only eight ambiguities were apparent
in ;3.3 kb of sequence (some of these could also be PCRinduced errors even though a high-fidelity polymerase was
used for amplifications). This suggests that within a given
nucleomorph genome, the repeated sequences on the chromosome ends are very similar to one another. Attempts to
determine the copy number and genomic location of the
hsp90 gene in P. sulcata using Southern hybridizations were
unsuccessful, perhaps due to the extremely low G 1 C content of the hsp90 probe.
A sliding-window analysis of the G 1 C content of the
subtelomeric region in G. theta, H. phi, and P. sulcata revealed considerable intrachromosomal variation, with
a moderate G 1 C content between (and including) the
18S rDNA and ubc4 genes, and a sharp drop in G 1 C content at the beginning of hsp90 (fig. 3A–C). A codon usage
analysis of ubc4 and hsp90 showed significant differences
between the two genes: while hsp90 exhibits a codon usage
pattern typical of nucleomorph housekeeping genes, that is,
with a bias toward A 1 T-rich codons, ubc4 shows the reverse pattern. This is most pronounced in P. sulcata, where
the ubc4 gene is 63% G 1 C overall and exhibits a strong
bias toward G 1 C in silent codon positions.
Discussion
We have investigated the karyotypic diversity of nine
different cryptomonad strains and obtained the first nucleomorph comparative genomic data from within this poorly
studied lineage. Our three-species comparison of a region
of subtelomeric nucleomorph DNA reveals that while the
relative positions of the rDNA cistron, ubc4, and hsp90
genes are conserved, the intergenic spacers bear no resemblance to one another in length or sequence. Indeed, the hypothetical ORFs assigned to the ;4-kb region between the
18S rDNA and ubc4 loci in G. theta (Douglas et al. 2001)
do not exist in H. phi or P. sulcata, and are thus not likely to
be real genes. Our results are consistent with the hypothesis
of Zauner et al. (2000), namely, that the process of gene
conversion is actively homogenizing the terminal repeats
of the nucleomorph chromosomes in G. theta. We conclude
that such recombination appears to have led to a situation in
which the noncoding sequences at each of the chromosome
ends within a genome are identical (or nearly so), but are
hypervariable between genomes, even between those that
are closely related. Given that ubc4 is present on at least
one end of each of the three P. sulcata nucleomorph chromosomes, our data are also consistent with the possibility
that the ubc4 gene in H. phi and P. sulcata marks the boundary between repetitive sequences and single-copy DNA, as
is the case in G. theta. This terminal repeat region is char-
acterized by a moderate to high G 1 C content, and while
an elevated G 1 C content for the rDNA genes can be explained by demands placed on their ability to maintain secondary structure, it is not obvious why the G 1 C content is
elevated throughout the repeat region—most of which appears to be noncoding DNA—and drops dramatically at the
ubc4/hsp90 junction (fig. 3). Clearly, the mutational and
selective pressures influencing the base composition of
the repetitive regions of the G. theta, H. phi, and P. sulcata
nucleomorph genomes are very different from those acting
on single-copy DNA. Intriguingly, a similar pattern of
rDNA repeats and elevated G 1 C contents are seen in
the chromosome extremities of the genome of the microsporidian parasite Encephalitozoon cuniculi (Katinka
et al. 2001; Peyret et al. 2001).
With respect to cryptomonad nucleomorph genome
size, our PFGE results compliment and expand those of
Rensing et al. (1994), and indicate that nucleomorph
genomes vary from ;450 kb in size in Cryptomonas paramecium (Rensing et al. 1994) to well over 800 kb in unidentified species CCMP1178 and members of the genus
Chroomonas (fig. 1). The karyotypic diversity within the
genus Rhodomonas is surprising when compared to the
small genome size differences between Hanusia, Guillardia, and Proteomonas. The PFGE results of Deane et al.
(1998) indicate that the nucleomorph genome karyotype
of H. phi is indistinguishable from that of G. theta, and
we estimate no more than a 20-kb difference in nucleomorph
genome size between these two genera and Proteomonas
(fig. 1). In stark contrast, strains designated as R. salina vary
by as much as 95 kb (fig. 1; Eschbach et al. 1991), and within
Rhodomonas we observe a size difference of 100–200 kb,
depending on whether one includes unidentified species
CCMP1178. This species branches with Rhodomonas
abbreviata in our trees, and previous nuclear 18S phylogenies (e.g., Deane et al. 2002; Hoef-Emden, Marin, and
Melkonian 2002) indicate that R. abbreviata does not group
closely with the other members of the genus and may be an
outlier. Our karyotype data support this conclusion as all of
the Rhodomonas species investigated showed similar karyotypes (two large chromosomes and one small one), the only
exception being CCMP1178 (one large chromosome and
two small). Even without considering CCMP1178, the
variation in nucleomorph genome sizes within Rhodomonas
far exceeds that found between some other genera. Whether
this is the result of increased rates of nucleomorph genome
evolution within Rhodomonas or is a function of the classification system imposed upon these taxa is unclear, and detailed analyses of both nucleomorph and nuclear sequences
will be required to resolve this issue.
Significant nucleomorph genome size variation is also
apparent within the genus Cryptomonas (Rensing et al.
1994; fig. 2), although it should be noted that only two species have been investigated thus far, including one that is
nonphotosynthetic (C. paramecium). The heterogeneous
evolutionary rate of the nucleomorph rDNA in C. paramecium is well documented (Hoef-Emden and Melkonian
2003; Hoef-Emden 2005), and preliminary karyotype
data from our laboratory suggests that the small size of
the C. paramecium nucleomorph genome is likely the exception in this genus, rather than the rule (C. Lane and
864 Lane et al.
J. Archibald, unpublished data). In contrast to Cryptomonas,
the evolutionary rate of the Rhodomonas rDNA appears relatively uniform (fig. 2; Hoef-Emden, Marin, and Melkonian
2002), making the nucleomorph genome size variation in
this genus all the more surprising.
Given that nucleomorph genome sizes vary dramatically in the cryptomonads examined, the most obvious
question is why? It is well known that nuclear genomes vary
dramatically in size and structure across the evolutionary
tree of eukaryotes. Yet, nucleomorphs represent a special
case of nuclear genome evolution, similar in many ways
to the evolution of organellar DNA. It is possible that at
least some of the nucleomorph genome size heterogeneity
observed in this study is due to differences in the size and
abundance of introns in different nucleomorphs and in the
length of intergenic spacers. Furthermore, larger nucleomorph genomes with more noncoding DNA could be
inherently more variable in size, due to the fact that recombination or insertion/deletion events would be less likely to
disrupt essential coding regions. However, the extraordinary compactness of the G. theta nucleomorph genome,
combined with the small size of the few spliceosomal introns it does possess (Douglas et al. 2001), suggests that
differences in amount of noncoding DNA are unlikely to
contribute greatly to genome size variation, at least in cryptomonads with relatively small nucleomorph genomes.
An alternative explanation is that cryptomonads differ
significantly in the coding capacity of their nucleomorph
genomes, that is, in the amount of gene loss and nucleomorph-to-host-nucleus gene transfer that has occurred during cryptomonad evolution. Evidence for nucleomorph
genome dynamics comes from an analysis of the hsp70 locus by Rensing et al. (1994). These authors showed that this
gene is located on the largest chromosome in some cryptomonad species (including G. theta) but on the second largest in others. Either the hsp70 gene has moved between
nonhomologous nucleomorph chromosomes in different
species or homologous chromosomes have changed significantly in size in different cryptomonad lineages (Rensing
et al. 1994). At present we are unable to distinguish between
these two possibilities.
If differential gene content is the major factor contributing to cryptomonad nucleomorph genome size variation,
sequence data from species with large genomes will be particularly useful. For example, genes present in the large
genomes of Chroomonas and Rhodomonas species, but absent in the smaller G. theta nucleomorph are good candidates for recent transfers to the G. theta nucleus. In the
context of a robust phylogenetic framework, not only will
it be possible to recognize and study such transfers but it
should also be possible to identify gene transfers that have
independently taken place multiple times. The data presented here thus provide a start point for detailed investigations into the pattern and process of nucleomorph
gene transfer. Such studies will hopefully address one of
the fundamental issues of nucleomorph genome evolution,
that is, whether the nucleomorphs of cryptomonads and
chlorarachniophytes have been reduced to an endpoint beyond which no further reduction is possible or whether they
will eventually be eliminated like the endosymbiont nuclei
of all other secondary plastid-containing algae.
Acknowledgments
We thank Tom Cavalier-Smith and Uwe Maier for
cryptomonad genomic DNAs, Susan Douglas for H. phi
cell pellets, Kristen Hoef-Emden and James Deane for
SSU rDNA alignments, Paul Gilson for helpful discussion,
and Krystal van den Heuval for generating nucleomorphspecific DNA probes. Two anonymous reviewers are also
thanked for their helpful comments. This research was supported by Genome Atlantic and a discovery grant from the
Natural Sciences and Engineering Research Council of
Canada. J.M.A. is a scholar of the Canadian for Advanced
Research, Program in Evolutionary biology.
Literature Cited
Archibald, J. M. 2005. Jumping genes and shrinking genomes—
probing the evolution of eukaryotic photosynthesis using
genomics. IUBMB Life 57:539–547.
Archibald, J. M., T. Cavalier-Smith, U. Maier, and S. Douglas.
2001. Molecular chaperones encoded by a reduced nucleus—
the cryptomonad nucleomorph. J. Mol. Evol. 52:490–501.
Archibald, J. M., and P. J. Keeling. 2005. On the origin and
evolution of plastids. Pp. 238–260 in J. Saap, ed. Microbial
phylogeny and evolution. Oxford University Press, New York.
Archibald, J. M., M. B. Rogers, M. Toop, K. Ishida, and P. J.
Keeling. 2003. Lateral gene transfer and the evolution of
plastid-targeted proteins in the secondary plastid-containing
alga Bigelowiella natans. Proc. Natl. Acad. Sci. USA 100:
7678–7683.
Bhattacharya, D., H. S. Yoon, and J. D. Hackett. 2003. Photosynthetic eukaryotes unite: endosymbiosis connects the dots.
Bioessays 26:50–60.
Bruno, W. J., N. D. Socci, and A. L. Halpern. 2000. Weighted
neighbor joining: a likelihood-based approach to distancebased phylogeny reconstruction. Mol. Biol. Evol. 17:189–197.
Cavalier-Smith, T., J. A. Couch, K. E. Thorsteinsen, P. Gilson,
J. A. Deane, D. R. A. Hill, and G. I. McFadden. 1996. Cryptomonad nuclear and nucleomorph 18S rRNA phylogeny. Eur.
J. Phycol. 31:315–328.
Deane, J. A., D. R. A. Hill, S. J. Brett, and G. I. McFadden. 1998.
Hanusia phi gen. et sp. nov. (Cryptophyceae): characterization
of ÔCryptomonas sp. phiÕ. Eur. J. Phycol. 33:149–154.
Deane, J. A., I. M. Strachan, G. W. Saunders, D. R. A. Hill, and
G. I. McFadden. 2002. Cryptomonad evolution: nuclear 18S
rDNA phylogeny versus cell morphology and pigmentation.
J. Phycol. 38:1236–1244.
Delwiche, C. F. 1999. Tracing the thread of plastid diversity
through the tapestry of life. Am. Nat. 154(Suppl.):S164–S177.
Douglas, S. E., C. A. Murphy, D. F. Spencer, and M. W. Gray.
1991. Cryptomonad algae are evolutionary chimaeras of two
phylogenetically distinct unicellular eukaryotes. Nature
350:148–151.
Douglas, S. E., S. Zauner, M. Fraunholz, M. Beaton, S. Penny, L.
Deng, X. Wu, M. Reith, T. Cavalier-Smith, and U.-G. Maier.
2001. The highly reduced genome of an enslaved algal
nucleus. Nature 410:1091–1096.
Eschbach, S., C. J. Hofmann, U. G. Maier, P. Sitte, and
P. Hansmann. 1991. A eukaryotic genome of 660 kb: electrophoretic karyotype of nucleomorph and cell nucleus of the
cryptomonad alga, Pyrenomonas salina. Nucleic Acids Res.
19:1779–1781.
Gilson, P. R. 2001. Nucleomorph genomes: much ado about practically nothing. Genome Biol. 2:R1022.1–R1022.5.
Nucleomorph Genome Diversity in Cryptomonads 865
Gilson, P. R., U. G. Maier, and G. I. McFadden. 1997. Size isn’t
everything: lessons in genetic miniaturisation from nucleomorphs. Curr. Opin. Genet. Dev. 7:800–806.
Gilson, P., and G. I. McFadden. 1995. The chlorarachniophyte:
a cell with two different nuclei and two different telomeres.
Chromosoma 103:635–641.
Gilson, P. R., and G. I. McFadden. 1996. The miniaturized nuclear
genome of eukaryotic endosymbiont contains genes that overlap, genes that are cotranscribed, and the smallest known spliceosomal introns. Proc. Natl. Acad. Sci. USA 93:7737–7742.
———. 2002. Jam packed genomes—a preliminary, comparative
analysis of nucleomorphs. Genetica 115:13–28.
Greenwood, A. D. 1974. The Cryptophyta in relation to phylogeny
and photosynthesis. Pp. 566–567 in J. V. Sanders and D. J.
Goodchild, eds. Electron microscopy 1974. Australian Academy of Sciences, Canberra, Australia.
Greenwood, A. D., H. B. Griffiths, and U. J. Santore. 1977. Chloroplasts and cell compartments in Cryptophyceae. Br. J. Phycol.
12:119.
Hackett, J. D., D. M. Anderson, D. L. Erdner, and D. Bhattacharya.
2004. Dinoflagellates: a remarkable evolutionary experiment.
Am. J. Bot. 91:1523–1534.
Hansmann, P. 1988. Ultrastructural localization of RNA in cryptomonads. Protoplasma 146:81–88.
Hansmann, P., H. Falk, and P. Sitte. 1985. DNA in the nucleomorph of Cryptomonas demonstrated by DAPI fluorescence.
Z. Naturforsch. 40c:933–935.
Hoef-Emden, K. 2005. Multiple independent losses of photosynthesis and differing evolutionary rates in the genus Cryptomonas (Cryptophyceae): combined phylogenetic analyses of
DNA sequences of the nuclear and the nucleomorph ribosomal
operons. J. Mol. Evol. 60:183–195.
Hoef-Emden, K., B. Marin, and M. Melkonian. 2002. Nuclear and
nucleomorph SSU rDNA phylogeny in the Cryptophyta and
the evolution of cryptophyte diversity. J. Mol. Evol. 55:
161–179.
Hoef-Emden, K., and M. Melkonian. 2003. Revision of the genus
Cryptomonas (Cryptophyceae): a combination of molecular
phylogeny and morphology provides insights into a longhidden dimorphism. Protist 154:371–409.
Hofmann, C. J., S. A. Rensing, M. M. Hauber, W. F. Martin, S. B.
Muller, J. Couch, G. I. McFadden, G. L. Igloi, and U. G. Maier.
1994. The smallest known eukaryotic genomes encode a protein gene: towards an understanding of nucleomorph functions.
Mol. Gen. Genet. 243:600–604.
Huelsenbeck, J., and F. Ronquist. 2003. MrBayes. Evolutionary
Biology Centre, Uppsala University, Uppsala, Sweden.
Ishida, K., Y. Cao, M. Hasegawa, N. Okada, and Y. Hara. 1997.
The origin of chlorarachniophyte plastids, as inferred from
phylogenetic comparisons of amino acid sequences of EFTu. J. Mol. Evol. 45:682–687.
Ishida, K., B. R. Green, and T. Cavalier-Smith. 1999. Diversification of a chimaeric algal group, the chlorarachniophytes:
phylogeny of nuclear and nucleomorph small-subunit rRNA
genes. Mol. Biol. Evol. 16:321–331.
Katinka, M. D., S. Duprat, E. Cornillot et al. (17 co-authors). 2001.
Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature 414:450–453.
Katz, L. A., E. A. Curtis, M. Pfunder, and L. F. Landweber. 2000.
Characterization of novel sequences from distantly related taxa
by walking PCR. Mol. Phylogenet. Evol. 14:318–321.
Keeling, P. J. 2004. Diversity and evolutionary history of plastids
and their hosts. Am. J. Bot. 91:1481–1493.
Ludwig, M., and S. P. Gibbs. 1985. DNA is present in the nucleomorph of cryptomonads: further evidence that the chloroplast
evolved from a eukaryotic endosymbiont. Protoplasma 127:
9–20.
Maddison, W., and D. Maddison. 2003. MacClade. Sinauer Associates, Sunderland, Mass.
Maier, U. G., C. J. Hofmann, S. Eschbach, J. Wolters, and G. L.
Igloi. 1991. Demonstration of nucleomorph-encoded eukaryotic small subunit ribosomal RNA in cryptomonads. Mol.
Gen. Genet. 230:155–160.
Marin, B., M. Klingberg, and M. Melkonian. 1998. Phylogenetic
relationships among the Cryptophyta: analyses of nuclearencoded SSU rRNA sequences support the monophyly of extant plastid-containing lineages. Protist 149:265–276.
Martin, W., T. Rujan, E. Richly, A. Hansen, S. Cornelsen, T. Lins,
D. Leister, B. Stoebe, M. Hasegawa, and D. Penny. 2002. Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of
cyanobacterial genes in the nucleus. Proc. Natl. Acad. Sci.
USA 99:12246–12251.
McFadden, G. I. 1999. Plastids and protein targeting. J. Eukaryot.
Microbiol. 46:339–346.
McFadden, G. I., P. R. Gilson, C. J. Hofmann, G. J. Adcock, and
U. G. Maier. 1994. Evidence that an amoeba acquired a chloroplast by retaining part of an engulfed eukaryotic alga. Proc.
Natl. Acad. Sci. USA 91:3690–3694.
McFadden, G. I., P. R. Gilson, and R. F. Waller. 1995. Molecular
phylogeny of chlorarachniophytes based on plastid rRNA and
rbcL sequences. Arch. Protistenkd. 145:231–239.
Morrall, S., and A. D. Greenwood. 1982. Ultrastructure of nucleomorph division in species of Cryptophyceae and its evolutionary implication. J. Cell Sci. 54:311–328.
Peyret, P., M. D. Katinka, S. Duprat, F. Duffieux, V. Barbe, M.
Barbazanges, J. Weissenbach, W. Saurin, and C. P. Vivares.
2001. Sequence and analysis of chromosome I of the amitochondriate intracellular parasite Encephalitozoon cuniculi
(Microspora). Genome Res. 11:198–207.
Posada, D., and K. A. Crandall. 1998. Modeltest: testing the model
of DNA substitution. Bioinformatics 14:817–818.
Rensing, S. A., M. Goddemeier, C. J. Hofmann, and U. G. Maier.
1994. The presence of a nucleomorph hsp70 gene is a common
feature of Cryptophyta and Chlorarachniophyta. Curr. Genet.
26:451–455.
Swofford, D. L. 2002. Phylogenetic analysis using parsimony (*and other methods), version 4.0B10 PPC. Sinauer
Associates, Sunderland, Mass.
Van der Auwera, G., C. J. B. Hofmann, P. De Rijk, and R. De
Wachter. 1998. The origin of red algae and cryptomonad
nucleomorphs: a comparative phylogeny based on small and
large subunit rRNA sequences of Palmaria palmata,
Gracilaria verrucosa, and the Guillardia theta nucleomorph.
Mol. Phylogenet. Evol. 10:333–342.
van Dooren, G. G., S. D. Schwartzbach, T. Osafune, and G. I.
McFadden. 2001. Translocation of proteins across the multiple
membranes of complex plastids. Biochim. Biophys. Acta
1541:34–53.
Yoon, H. S., J. D. Hackett, C. Ciniglia, G. Pinto, and D. Bhattacharya.
2004. A molecular timeline for the origin of photosynthetic
eukaryotes. Mol. Biol. Evol. 21:809–818.
Zauner, S., M. Fraunholz, J. Wastl, S. Penny, M. Beaton,
T. Cavalier-Smith, U.-G. Maier, and S. E. Douglas. 2000.
Chloroplast protein and centrosomal genes, a tRNA intron,
and odd telomeres in an unusually compact eukaryotic genome, the cryptomonad nucleomorph. Proc. Natl. Acad. Sci.
USA 97:200–205.
Laura Katz, Associate Editor
Accepted November 14, 2005