Mol. Cells, Vol. 1, pp. 345-349
Shift of Primary Transcription Initiation Site of E. coli lacUV5
Promoter by Purine-to-pyrimidine Change
Woojin Jeong and Changwon Kang*
Department of Life Science, Korea Advanced Institute of Science and Technology, Taqon 305701, Korea
(Received on August 1, 1991)
The lacUV5 promoter mutants carrying base substitutions at + 1 site were generated by
polymerase chain reaction (PCR) using mismatched primers. The transcription initiation
sites of lacUV5 wild-type promoter and its initiation site variants were determined by sizing
both run-off transcripts produced from linearized templates, and nucleotide-specific pausing
product RNAs produced by using 3'-deoxycytidine 5' -triphosphate instead of cytidine 5'triphosphate in in vitro transcription reactions. From lacUV5 wild-type promoter, transcription initiates also at -I G and + 2 A sites, while the major initiation site is + 1 A.
When the wild-type A at + 1 site was changed to a pyrimidine T or C, however, transcriptions initiated only at + 2 A. Also unexpected mutations occurred at - 38, - 18, and + 8
positions, which are presumed to be introduced during the PCR amplification. The base
substitutions at - 38, -18 and + 8 positions, and a deletion at -18 position did not
affect the selection of transcription initiation site. Thus, E. coli RNA polymerase appears
to prefer a pyrimidine-girt purine located at a flexible distance from the - 10 region of
promoter as an initiating nucleotide, and so initiates only at + 2 A when A at + 1 site
is changed to a pyrimidine.
Promoters which are recognized by E. coli RNA
polymerase have two regions of sequence homology,
located approximately 35 and 10 base pairs upstream
of the start point of transcription (Rosenberg and
Court, 1979; Siebenlist et al., 1980). Harley and Reynold (1987) have compiled and analyzed 263 E. coli
promoters with experimental dCita on the site of transcription initiation. Initiation with a purine is highly
preferred and 75% of the uniquely defined start points
are located at 7 ± I bases downstream of the - 10
hexamer. Therefore, it has generally been accepted
that E. coli RNA polymerase initiates transcription at
a purine about 7 base pairs downstream from the - 10
region. However, individual promoter start site is not
always consistent with this general notion (Hawley
and McClure, 1983) and contexts of consensus sequences of E. coli promoter affect transcription start sites
as well as transcription efficiencies (Jacquet and Reiss,
1990). Thus, the exact base at which transcription initiates is difficult to predict. In part, this arises because
the 5' end of the primary transcript of genes is often
determined by Sl mapping or primer extension studies
which do not identifY the exact 5' nucleotide. In addition, the 5' end of the primary transcript often appears
heterogeneous, which has usually been interpreted to
indicate multiple start points or limitations of the experimental method.
The role of sequence around transcription initiation
site in the choice of initiating nucleotide by E. coli
* To whom correspondence should be addressed
RNA polymerase has not been studied. We constructed several lacUV5 promoter mutants carrying base
substitutions at the predominant transcriptional start
site. We show here that mutations at initiation site
influence the selection of transcription initiation site.
Materials and Methods
Enzymes
Thermus aquaticus (Taq) DNA polymerase was purchased from Perkin-Elmer Cetus and Sequenase version 2.0 kit from United States Biochemical Corp. E.
coli RNA polymerase was a gift of Dr. Akira Ishihama
at National Institute of Genetics in Japan and had
been purified from E. coli strain W3350 essentially according to the method of Fukuda et al. (1974).
Oligonucleotide PeR primers
Two oligonucleotides were synthesized in 0.2-f..Imole
scale by DNA synthesizer Gene Assembler Plus (Phamacia LKB Biotechnology): JPI7, 5'ATTCGCCATTCAGGCTG3'; JP26, 5'TCCCCAATNCCACACATTATACGAGC3'. In the synthesis of primer JP26, a
mixture of G, A, T, and C was added in the ratio
of 2:2:1 :1 to the wobble position N.
Preparation of PeR template
A 1.4-kb fragment containing the lacUV5 promoter
was produced by digestion of plasmid pMKOO with
restriction enzymes XmnI and HindlII. pMKOO had
The abbreviation used is: PCR polymerase chain reaction.
© 1991 The Korean Society of Molecular Biology
346
Initiation Sites of E. coli faeUV5 Promoter Mutants
been constructed by inserting a 53-bp synthetic lacUV5
promoter fragment (from -49 to +4) at the SmaI
site of pUCl19 in Dr. Ishihama's laboratory.
Polymerase chain reaction
Polymerase chain reactions were performed in a 0.5ml microcentrifuge tube by a thermal reactor (Hook
and Tucker Instrument, Ltd.). Samples of 100 ~ containing 5-50 ng of template DNA, 1.0 f.!M each primer,
200 f.!M each dNTP, and 2 units of Taq DNA polymerase in standard buffer (10 mM Tris-HCI, pH 8.3, 50
mM KC1, 1.5 mM MgCb, 0.01% (w/v) gelatin, 0.01%
tWeen20, and 0.01 % NP40) were subjected to 30 cycles
of amplification. Each cycle consisted of denaturation
at 94 °c for 1.5 min, annealing at 51 °c for 2 min,
and extension at 72 "c for 1 min. Extension time of
the last cycle was 10 min to ensure the last strand
synthesis to be complete. The completed reactions
were extracted twice with an equal volume of phenol
and chloroform and the DNA was concentrated by
ethanol precipitation.
Preparation of lacUV5 promoter mutants
PCR was performed as above using mismatched
primers to introduce mutations. The amplified products containing a mutated lacUV5 promoter were subcloned into pUC18 and each mutation was identified
by dideoxynucleotide sequencing method (Sanger et
al., 1977). Then, the promoter region of each mutant
was transferred to polylinker site of pJAC40. Plasmid
pJAC40 contains a 7-bp insert sequence, GGATCTA,
just in front of the BamHI site of a promoter probe
vector pJAC4 (laurin, 1987).
In vitro transcription
Plasmids were prepared by the alkaline lysis method (Sambrook et ai., 1989). All plasmids were digested with EcoNI and Clal, and 356-bp fragments containing the promoter region were isolated.
In vitro transcription reaction was performed as previously described by Nomura et al. (1986) with some
modifications. A 30-~ pre-reaction mixture containing
0.5 pmole of template DNA and a ,5-fold molar excess
of E. coli RNA polymerase holoenzyme in standard
reaction buffer (50 mM Tris-HCI, pH 7.6, 3 mM magnesium acetate, 0.1 mM EDTA, 0.1 mM dithiothreitol,
25 /lg/ml nuclease-free bovine serum albumin, and 50
mM NaCl) were preincubated at 37 °c for 10 min.
Transcription was initiated by adding 20 ~ of prewarmed substrate mixture containing 10 units of
RNAsin and heparin in standard reaction buffer. The
final concentrations of each unlabeled NTP and heparin were 160 f.!M and 200 /lg/ml, respectively.
In the nucleotide-specific pausing experiment, 160
f.!M 3'-deoxycytidine 5'-triphosphate was used instead
of cytidine 5'-triphosphate. For radioactive labeling of
transcripts, 2-4 /lCi [a-32P]GTP (400 Ci/mmole) or 10
/lCi [y_ 32P]ATP (30 Ci/mmole) was added to each
reaction. RNA synthesis was allowed to proceed for
5 min at 37 °c, and stopped by adding 50 ~ of a
stop solution containing 40 mM EDTA and 300 /lg/ml
E. coli tRNA. Transcripts were purified and analyzed
by denaturing polyacrylamide gel electrophoresis.
Results and Discussion
Mutagenesis of lacUV5 promoter by peR
In order to obtain mutations at transcription initiation site of lacUV5 promoter, polymerase chain reaction was carried out using mismatched primers under
the standard conditions. The PCR template was the
plasmid pMKOO which has an insert of 53-bp (from
llindlU
NurI
XmnI
Mol. Cells
550 •
380
227
79
ESc K Sm
nx
~!~!~-C========~>I
I
SI P Sp 11
!
!
!
I
'----'*.- .J P26
Figure I. Diagram of faeUV5 promoter region showing the
amplification primers used. The PCR template containing
faeUV5 promoter was prepared as described in Materials
and Methods. Primer sequences are shown in Materials and
Methods. In this diagram, E. Sc. K Sm. B, X Sl, P. Sp.
and H designate EeoRI, Sad, KpnI, Smal, BamHI, Xba! , SalI,
PstI, SphI, and HindIlI sites, respectively. Total length of the
region is 1.4 kb.
Figure 2. Electrophoretic analysis of the amplified products.
Polymerase chain reaction was carried out as described in
Materials and Methods. Electrophoresis was performed on
a 1.5% agarose gel. The length of the amplified product is
227 bp. Lanes 1 and 6 show size standards, HindIII-digested
SP6 genome and Sau961-digested pUC19, respectively. Lanes
2, 3, 4, and 5 show the amplified produ r t5 using 5, 10, 20,
and 50 ng of template DNA, respectively.
347
Woojin Jeong & Changwon Kang
Vol. 1 (1991)
-49 to +4) [acUV5 promoter fragment at the SmaI
site of pUC1l9 (Fig. 1). As shown in Figure 1,
the region between the upstream primer JP17 and the
downstream, mismatch-containing primers JP26 was
designed to be amplified. Regardless to the various
template concentrations, the expected short duplex of
227 bp was primarily obtained (Fig. 2).
The promoter region of amplified products from the
KpnI site to the primer JP26 was subcloned into
KpnI/HincII site of pUC18 as shown in Figure 3.
About 60 derivatives of pUC18 were sequenced in the
promoter-containing region from - 56 to +40, and
8 different mutants were identified. Then, promoter
portions of pUC18 derivatives were transferred to
pJAC40 as shown in Figure 3. Among the designed
mutations at + 1, change of A to G has not been
found. Also, unexpected mutations, which are presumed to have been introduced during the amplification
by Taq DNA polymerase, occurred at - 38, -18 and
+8 positions: pKW2l , pKW24, pKW25 and pKW26
(Fig. 4).
The fidelity of DNA synthesis in vitro depends on
exonuclease activity of the polymerase being employed, the DNA sequences of the template-primer. and
reaction conditions (especially the relative and the absolute ' concentrations of the dNTP substrates) (Kunkel
and Eckert. 1989). A low fidelity of Taq polymerase
gave us additionally interesting mutants. To obtain
only the designed mutation, however, it would be necessary to increase the fidelity of DNA synthesis. Improvement of the fidelity may be accomplished by using
Vent DNA polymerase which possesses a 3'-exonuclease proofreading activity in addition to its extreme
thermal stability.
Klenow
Mulanl! Selection
by
Sequencing
pJAC40
(6.7 kb)
pJAC40
derivatives
~I
Figure 3. Schematic illustration for generation of lacUV5
promoter variants. Details are described in Results and Discussion.
Transcription initiation sites of lacUV5 promoter
In order to determine the transcription start site of
[aeUV5 promoter, both run-off transcription and nucPlaslllids
PCR Products (227bp)
pUC18
Sequences
-40
-30
-20
-10
+1
.
+10
.
+20
.
+30
.
pKW18
•. CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGGGG GACCTGCAGGCATGCAAGCTAATTCATCG
pKW19
.. ----------------------------------------------T------- -----------------------------
pKW20
.. ----------------------------------------------T-------A-----------------------------
pKW21
.. ----------------------------A-----------------T-------A-----------------------------
pKW22
pKW23
.. ----------------------------------------------C------- ----------------------------.. ----------------------------------------------C-------A-----------------------------
pKW24
.. --------A-------------------------------------C-------A-----------------------------
pKW25
.. ----------------------------_-----------------C-------A-----------------------------
pKW26
.. ----------------------------------------------C------T -----------------------------
Figure 4. Nucleotide sequences of lacUV5 promoter variants in the pJAC40 derivatives. The predominant transcription startpoint of lacUV5 wild-type promoter in pKW18 is numbered + 1. The same nucleotide as in pKW18 was indicated by
a hyphen and deletion by an empty underline. The consensus - 35 and -10 regions are shown by bold characters.
Initiation Sites of E. eoli laeUVS Promoter Mutants
348
leotide-specific pausing experiment were carried out.
The incorporation of chain terminating 3'-deoxyribonucleoside 5' -triphosphates at the 3' end of transcript
prevents the further addition of ribonucleotides. These~
chain terminators have previously been used to obtain
sequencing ladders in transcription reactions (Monforte et ai., 1990; Axelrod and Kramer, 1985).
It was previously reported that the in vitro transcription initiation site of iacUV5 is multiple in a small
region rather than a unique site and the distribution
of 5' ends of lac mRNA synthesized varies upon single
base-pair mutations in the non-transcribed region of
the promoter (Carpousis et al., 1982). According to this
report, transcription initiates at -1, + I, + 2, and + 5
positions in the ratio of 29:55:9:7. However, the sequence (TGAGC··) downstream of + 5 they used is
different from the sequence (GGGGA" ') used in this
experiment, while the upstream sequence is identical.
Also they used different methodology; labeling transcripts at 5' ends by incorporation of [y_ 32 P]GTP and
[y_ 32P]ATP and digesting them to completion with
pancreatic ribonuclease A.
Therefore, the transcription initiation site of pKWI8
carrying the wild-type {acUV5 promoter was first determined. When the in vitro transcripts from the wildtype lacUV5 promoter (pKW I8) were labeled with [0.J1P]GTP in the presence of 3'-dCTP, IO-mer, II-mer,
and 12-mer were shown in an autoradiograph of an
RNA-sizing gel, as shown in Figure 5, lane j. Because
the C comes first in the position II (note that + 9
A is missing in pKWI8), 3'-dCTP-terminating transcript would be II-mer, if transcription starts only at
abc d e f 9 h i j kIm n
0
+ I A. Production of . three sized transcripts indicate
that transcription starts not only at + I A but also
at - I G and + 2 A.
This observation was confirmed by labeling the 3'dCTP-terminating transcripts by [y_ 32P]ATP. This method labels only the transcripts starting with ATP, because the J2 p label is on the y phosphate of ATP.
As expectedly, only lO-mer and ll-mer were produced,
as shown in Figure 5, lane a. Thus, the lO-mer and
II-mer contain A fit 5' end and the 12-mer does not
contain A but contains presumably G at 5' end. Both
labeling experiment results also indicate that the major initiation site is certainly + I A. And initiation
at - I G is less predominant than initiation at + 2
A, as relative radioactivities of the bands show in
Figure 5, lanes a and j.
Also run-off transcripts were produced from the template pKWl8 linearized by digestion with EcoNI and
Clal. If the termination occurs only at the very end
of lower coding strand having Clal-produced 5' 2-nt
overhang, transcription starting at + 1 A would produce 37-mer RNA. As shown in Figure 6, lane 1, 37mer and 36-mer are apparent. Also 35-mer and 38-mer
bands are faint but present. This appearance of multiple bands can not be explained only by multiple initiation, but can be explained by multiple termination
from each initiation. In other words, + I A-starting
transcription terminates both at the very end and one
base upstream, producing 37-mer and 36-mer, respectively. Likewise + 2 A-starting transcription produces
36-mer and 35-mer, and - 1 G-starting one, 38-mer
and 37-mer. This interpretation makes more sense
1
p q r
---...........
...- ...
. .."".. ..
_
12
11
10
Mol. Cells
2
3
4
5
6
7
8
9
37
36
[y_ 32P] ATP
Figure 5. Electrophoretic separation of nucleotide-specific
pausing transcripts on a 20% polyacrylamide-SO% urea gel.
3' -deoxycytidine 5' -triphosphate was used in place of cytidine
5'-triphosphate in single-round in vitro transcription reaction.
F rom lane a to i, transcripts were labeled with to /lCi [yJ2p]ATP (30 Ci/ mmole) and from lane j to r, transcripts
were labeled with 2 /lCi [a-J'P]GTP (400 Ci/mmole). Lanes
are denoted as follows: lanes a and j , pKW1 8; lanes band
k pKWI9; la nes c and I, pKW20; lanes d and m. pKW21 :
lanes e and n, pKW22; lanes f and 0 , pKW23; lanes g and
p, pKW24; lanes hand q, pKW2S; lanes i and r, pKW26.
In the case of pKW18, cytosine-specific pausing product of
transcription having initiated at + I site is II-mer.
Figure 6. Electrophoretic separation of run-off transcripts
produced from the linearized templates of pJAC40 derivatives digested with EeoNl and Clal. Transcription reaction was
performed as described in Materials and Methods and transcripts were labeled with 4 /lCi [a-32 P]GTP (400 Ci/mmole).
Electrophoresis was carried out at 70 W on a 15% polyacrylamide-SO% urea gel. Gel was covered with Clean-wrap and
exposed to X-ray film at - 70 °C with intensifYing screens
for 36 h. In the case of pKWI8 carrying laeUVS wild-type
promoter. run-off products of transcription having initiated
at + I site are 36-mer and 37-mer. Plasmid samples are,
from the left, pKWI8 (lane I), pKWI9 (lane 2), pKW20 (lane
3), pKW21 (lane 4), pKW22 (lane 5), pKW23 (lane 6), pKW
24 (lane 7), pKW2S (lane 8), and pKW26 (lane 9).
Vol. 1 (1991)
Woojin Jeong & Changwon Kang
when the relative band intensities are compared.
These results clearly indicate that the RNA polymerase does not always read up to the very end of the
coding strand. Thus one should be careful of using
run-off transcription in determining initiation site.
Transcription initiation sites of lacUV5 promoter
mutants
The major focus of this study is to determine th.e
transcription initiation sites of lacUV5 promoter vanants which carry a purine-to-pyrimidine mutation at
the wild-type major start site + 1. The plasmid pKW19
carries A ~ T transversion mutation at + 1, compared
to pKW18 (Fig. 4). As shown in Figure 5, lanes b
and I<, labeling of C-pausing transcripts from pKW19
by either [y-32PJATP or [a-32pJGTP showed only 10mer, indicating transcription started only at + 2 A
This was confirmed by the two bands of 35-mer and
36-mer (Fig. 6, lane 2) which were produced in runoff transcription with the two running-off sites; the
5' very end and one base upstream in the ClaI-produ c
ced 5' 2-nt overhang coding strand. The same results
were obtained from the plasmid pKW22 (Fig. 4) carrying A ~ C transversion mutation at + 1 (Fig. 5, lanes
e and f; Fig. 6, lane 5).
If E. coli RNA polymerase only prefers a purine
located at a flexible distance from the - 10 region
of promoter, transcription would have initiated at - 1
G and + 2 A., when A at predominant transcription
start site + 1 is changed to a pyrimidine. However,
our results show that transcriptions initiate uniquely
at + 2 position, when + 1 A was changed to T or
C (Figs. 5 and 6). Therefore, E. coli RNA polymerase
appears to prefer a purine, especially a purine surrounded with pyrimidine, as an initiating nucleotide. If
this presumption is true, the rate of transcription initiation may increase by a pyrimidine-girt purine positioned properly at initiation region, as E. coli RNA
polymerase would not need to scruple to select the
initiation site.
As mentioned above, mutations other than the expected were also obtained during PCR reactions. A
deletion/addition at positions +9 (pKW20 and pKW
23) and -1 8 (PKW25), and a base substitution at positions at -38 (pKW24), - 18 (PKW21) and +8 (pKW
26) did not affect the selection of transcription start
site (Figs. 5 and 6). In the choice of transcription initiation site, effects of mutations at transcription initiation site appear to be more direct and dramatic than
those of mutations in the non-transcribed region of
promoter.
Analysis of run-off products
In the case of pKW22 through pKW26, the wild-
349
type + 1 position contains C. Thus in the 3' -dCTP
containing reactions (Fig. 5), transcription cannot start
at the + 1 site. Therefore, one may argue that the experiments shown in Figure 5 with the p~a~I?ids c?~­
taining + 1 C artificially eliminated possibilIty of 1nItiation at + 1 C. To check this possibility, run-off products from transcriptions with all ribonucleotides were
analyzed. As shown in Figure 6, lanes 5 to 9, only
two bands are always shown, indicating the double
running-off sites with single initiation site. Thus, the
mutant containing + 1 C does not initiate at + 1 C
but only at + 2 A
Acknowledgment
Weare grateful to Dr. Akira lshihama for E. coli
RNA polymerase holoenzyme.
This work was supported by grants from Korea
Science and Engineering Foundation and Korea Advanced Insititute of Science and Technology.
References
Axelrod, V. D., and Kramer, F. R (1985) Biochemistry
24, 5716-5723
Carpousis, A J., Stefano, 1. E., and Gralla, J. D . (1982)
J Mol. BioI. 157, 619-633
Fukuda, R , Iwakura, Y., and Ishihama, A (1974) J
Mol. BioI. 83, 353-367
Harley, C. B., and Reynolds, R P. (1987) Nucleic Acids
Res. 15, 2343-2361
Hawley, D. K, and McClure, W. R (1983) Nucleic
Acids Res. II, 2237-2255
Jacquet, M. A , and Reiss, C. (1990) Nucleic Acids Res.
18, 1137-1143
Jaurin, B. (1987) Nucleic Acids Res. 15, 8567
Kunkel, T A, and Eckert, K. A (1989) in Polymerase
Chain Reaction (Erlich, H. A, Gibbs, R, and Kazarian, H. H. Jr., eds), pp. 5-10, Cold Spring Harbor
Laboratory Press, New York
Monforte, 1. A, Kahn, J. D., and Hearst, 1. E. (1990)
Biochemistry 29, 7882-7890
Nomura, T, Fujita, N., and Ishihama, A (1986) Nucleic
Acids Res. 14, 6857-6870
Rosenberg, M., and Coult, D. (1979) Annu. Rev. Genet.
13, 319-353
Sambrool<, 1.. Fritsch, F. F., and Maniatis, T (1989)
Molecular Cloning. 2nd Ed, pp. 14.14-14.20, Cold Spring Harbor Laboratory Press, New York
Sanger, F., Nicklen, S., and Coulson, A R (1977) Proc.
Nat!. Acad. Sci. U S. A. 74, 5463- 5467
Siebenlist, u., Simpson, R B., and Gilbert, W. (1980)
Cell 20, 269-281