The concerted action of multiple post

University of Veterinary Medicine Hannover
Department of Physiological Chemistry
The concerted action of multiple post-translational
events regulates the trafficking and function of wild
type and mutant disaccharidases
INAUGURAL DOCTORAL THESIS
in partial fulfillment of the requirements of the degree of Doctor
of Natural Sciences
-Doctor rerum naturalium(Dr. rer. nat.)
submitted by
Lena Diekmann, M.Sc.
Bünde, Germany
Hannover 2016
Supervisor:
Prof. Dr. phil. nat. Hassan Y. Naim
Department of Physiological Chemistry
Institute for Biochemistry
University of Veterinary Medicine Hannover, Germany
Supervision group:
Prof. Dr. phil. nat. Hassan Y. Naim
Department of Physiological Chemistry
Institute for Biochemistry
University of Veterinary Medicine Hannover, Germany
Prof. Dr. rer. nat. Georg Herrler
Department of Infectious Diseases
Institute of Virology
University of Veterinary Medicine Hannover, Germany
1st Evaluation:
Prof. Dr. phil. nat. Hassan Y. Naim
Department of Physiological Chemistry
Institute for Biochemistry
University of Veterinary Medicine Hannover, Germany
2nd Evaluation:
Prof. Dr. rer. nat. Rita Gerardy-Schahn
Institute for Cellular Chemistry
Hannover Medical School, Germany
Date of the final exam:
19.04.2016
Dedicated to
my family
Table of contents
I
Table of contents
Table of contents ....................................................................................................... I
List of publications .................................................................................................. III
Abbreviations ........................................................................................................... IV
List of tables ........................................................................................................... VII
List of figures .......................................................................................................... VII
Abstract .................................................................................................................. VIII
Zusammenfassung ................................................................................................... X
Introduction............................................................................................................... 1
Types of lactase deficiencies .................................................................................. 2
Symptoms of lactose intolerance and secondary associated disorders .......................... 7
Diagnosis of lactose malabsorption and lactose intolerance ........................................... 8
Treatment of lactose intolerance in infants, children and adults .....................................10
Lactase-phlorizin hydrolase (LPH) ........................................................................ 10
Biosynthesis and intracellular processing ......................................................................12
Polarized sorting ...........................................................................................................14
Protein modifications, folding and quality control in the ER ................................... 15
Aim of the dissertation ........................................................................................... 22
Publications ............................................................................................................ 23
Congenital lactose intolerance is triggered by severe mutations on both alleles of
the lactase gene .................................................................................................... 25
The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several
Cancers ................................................................................................................. 27
Structural Determinants for transport of a multi-domain membrane glycoprotein in
the early secretory pathway .................................................................................. 28
II
Table of contents
Discussion .............................................................................................................. 66
Difficulties in the diagnosis and possible molecular causes of the low lactase
activity in CLD patients .......................................................................................... 66
Identification and molecular analysis of two novel mutations of the LCT gene
causing CLD .......................................................................................................... 68
Characterization and implication of the subdomains of LPH, a multi-domain protein,
on its function and folding ...................................................................................... 74
Conclusion .............................................................................................................. 79
References .............................................................................................................. 80
Acknowledgements .............................................................................................. 106
Eidesstattliche Erklärung..................................................................................... 107
List of publications
III
List of publications
Parts of this thesis were already published/are under revision
Diekmann L., Pfeiffer K., and Naim H. Y., Congenital lactose intolerance is triggered
by severe mutations on both alleles of the lactase gene. BMC Gastroenterol. 2015
Mar
21;15:36.
DOI:
10.1186/s12876-015-0261-y.
Amiri M.*, Diekmann L.*, von Köckritz-Blickwede M. and Naim H. Y., The Diverse
Forms of Lactose Intolerance and the Putative Linkage to Several Cancers.
Nutrients.
2015
Aug
28;7(9):7209-30.
DOI:
10.3390/nu7095332.
Diekmann L.*, Behrendt M.*, Amiri M. and Naim H. Y., Structural determinants for
transport of a multi-domain membrane glycoprotein in the early secretory pathway, J
Biol Chem., under revision
Publication (not relevant for this thesis)
Maria Henström*, Lena Diekmann*, … , Hassan Y. Naim° Mauro and D’Amato°,
Functional variants in the sucrase-isomaltase gene associate with increased risk of
irritable bowel syndrome, NEJM, in progress
*° Authors contributed equally
Conference contributions regarding this thesis
Lena Diekmann, Katrin Pfeiffer, and Hassan Naim, Compound heterozygous
mutations elicit congenital lactase deficiency in a Japanese infant, FASEB J April
2015 29:596.5
IV
Abbreviations
Abbreviations
ATH
adult type of hypolactasia
ATP
adenosine triphosphate
BiP
binding immunoglobulin protein
bp
base pairs
BSA
bovine serum albumin
°C
degree Celsius
cDNA
complementary DNA
CLD
congenital lactase deficiency
CNX
calnexin
COS-1
african green monkey kidney fibroblast-like cells
CRT
calreticulin
CSID
ongenital sucrase-isomaltase deficiency
DEAE
diethyle-amino-ethyle
del
deletion
DMEM
Dulbecco´s modified Eagle Medium
DNA
desoxyribonucleid acid
DTT
dithiothreitol
e.g.
(exempli gratia) for example
EDEM
ER degradation-enhancing α-mannosidase-like protein
endo H
endo-β-N-acetylglucosaminidase H
ER
endoplasmic reticulum
ERAD
ER-associated degradation
et al.
et alii (and others)
FCS
fetal calf serum
fs
frameshift
xg
acceleration of gravity
GABA
γ-aminobutyric acid
GH
glycoside hydrolase
GlcNAc
N-acetylglucosamine
GPI
glycosylphosphatidylinositol
Abbreviations
V
h
hour/hours
Hsp70
heat shock protein 70
IBS
irritable bowel syndrome
IP
immunoprecipitation
kbp
kilobase pair
kDa
kilo Dalton
KLD
Kongenitale Laktase Defizienz
LCT
lactase gene
LPH
lactase-phlorizin hydrolase
m
milli (10-3)
M
molar mass
µ
micro (10-6)
mAbs
monoclonal antibodies
MEM
methionine-free minimum essential medium
MGAM
maltase-glucoamylase
min
minute/minutes
mRNA
messenger RNA
NMD
nonsense-mediated mRNA decay
PDI
protein disulfide isomerase
PNGase F
peptide-N-Glycosidase F
RNA
ribonucleic acid
RT
room temperature
SDS
sodium dodecyl sulfate
SERCA
sarco(endo)plasmic reticulum Ca2+ ATPase
SI
sucrase-isomaltase
SDS-PAGE
sodium dodecylsulfate-polyacrylamide gel electrophoresis
sec
seconds
SGLT1
sodium/glucose co-transporter 1
SNPs
single nucleotide polymorphisms
TEMED
tetramethylethylenediamine
TGN
trans-Golgi network
VI
Abbreviations
TRIS
Tris(hydroxymethyl)aminomethan
UGGT
UDP-glucose:glycoprotein glucosyltransferase
UPF1
up-frameshift protein 1
UPR
unfolded protein response
w/v
weight/volume
X
stop codon
Amino acid
Three letter code One letter code
alanine
ala
A
arginine
arg
R
asparagine
asn
N
aspartic acid
asp
D
asparagine or aspartic acid
asx
B
cysteine
cys
C
glutamic acid
glu
E
glutamine
gln
Q
glutamine or glutamic acid
glx
Z
glycine
gly
G
histidine
his
H
isoleucine
ile
I
leucine
leu
L
lysine
lys
K
methionine
met
M
phenylalanine
phe
F
proline
pro
P
serine
ser
S
threonine
thr
T
tryptophan
trp
W
tyrosine
tyr
Y
valine
val
V
List of tables
VII
List of tables
Table 1: Different types of lactase deficiencies........................................................... 3
Table 2: Reported CLD patients with mutations in the LCT gene ............................... 6
List of figures
Figure 1: Maturation steps of LPH in the intestinal epithelial cells. ........................... 14
Figure 2: Structure of the N-linked core glycan......................................................... 17
Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum.
................................................................................................................................. 19
Figure 4: Potential requirements for heterodimerization of LPH wild type with a
pathogenic mutant. ................................................................................................... 73
VIII
Abstract
Abstract
Lena Diekmann
The concerted action of multiple post-translational events regulates the
trafficking and function of wild type and mutant disaccharidases
Lactose is the main carbohydrate of mammalian milk. For its uptake into the cell
previous hydrolysis into the monosaccharides glucose and galactose is required,
which is mediated by lactase-phlorizin hydrolase (LPH). LPH, the only βgalactosidase of the brush border membrane in the small intestine, is a membrane
glycoprotein, which is post-translationally modified along the secretory pathway by Nand O-glycosylation, dimerization and proteolytic cleavage steps.
Defects of intestinal lactose digestion due to insufficient lactase activity result in
gastrointestinal symptoms characteristic for lactose intolerance. Congenital lactase
deficiency (CLD) is the severe form of lactose intolerance, which is caused by
mutations in the coding region of the LPH gene.
The first part of this thesis investigated two novel mutations in the gene of LPH,
which were detected in a Japanese infant in a compound heterozygous inheritance
pattern. The influence of both mutations, Y1473X and D1796fs, on the structure,
biosynthesis and function of LPH was assessed by transient expression in COS-1
cells. Both mutants are mannose-rich N-glycosylated, misfolded and enzymatically
inactive proteins, which are retained in the endoplasmic reticulum (ER). Interestingly,
none of those anchorless pathogenic mutant forms undergo heterodimer formation
with the wild type, concluding that the transmembrane domain might be one
requirement for heterodimerization of LPH.
The second part of this thesis elucidated structural determinants of the multi-domain
membrane glycoprotein LPH for its transport and maturation along the secretory
pathway. By utilizing deletion variants, the role of the stretch region in domain II of
the ectodomain was determined as an important structural element. A possible
interaction of a potential N-glycosylation site in this stretch region with the ERresident chaperone calnexin (CNX) was confirmed by co-immunoprecipitation. The
constructs containing the stretch in domain II show an increased interaction with
CNX. The biochemical analyses of those constructs offered that domain I and III of
Abstract
IX
the ectodomain of LPH act as intramolecular chaperones, while domain II and IV are
not essential for transport competence.
Taken together, the present thesis provides insights into the pathophysiology of CLD
causing LPH mutations and complements the knowledge of the structural
determinants for post-translational events of the multi-domain glycoprotein LPH.
X
Zusammenfassung
Zusammenfassung
Lena Diekmann
Das Zusammenspiel von verschiedenen post-translationalen Ereignissen
reguliert den Transport und die Funktion von Wildtyp und Mutanten
Disaccharidasen
Laktose ist das häufigste Kohlenhydrat in der Milch von Säugetieren. Für die
Aufnahme in das Zellinnere ist eine vorherige Hydrolyse von Laktose in die
Monosaccharide Glukose und Galaktose notwendig, welche durch das Enzym
Laktase-Phlorizin Hydrolase (LPH) katalysiert wird. LPH ist die einzige βGalaktosidase der Bürstensaummembran im Dünndarm und gehört zur Proteinklasse
der membranständigen Glykoproteine. Während des Transports entlang des
sekretorischen Weges innerhalb der Zelle wird LPH post-translational durch N- und
O-Glykosylierung, Dimerisierung und proteolytische Spaltungsprozesse modifiziert.
Defekte im intestinalen Laktoseverdau, die durch unzureichende Laktase-Aktivität
ausgelöst werden, führen zu gastrointestinalen Symptomen, welche charakteristisch
für eine Lactoseintoleranz sind. Kongenitale Laktase Defizienz (KLD) ist die
schwerwiegendste Form von Laktoseintoleranz und wird durch Mutationen in der
kodierenden Sequenz des LPH Gens ausgelöst.
Im ersten Teil der vorliegenden Arbeit wurden zwei neue Mutationen im Gen von
LPH untersucht, welche in einem kombinierten heterozygoten Vererbungsmuster bei
einem japanischen Säugling entdeckt wurden. Der Einfluss von beiden Mutationen,
Y1473X und D1796fs, auf die Struktur, die Biosynthese und die Funktion von LPH
wurde mittels transienter Expression in COS-1 Zellen analysiert. Beide mutierten
Proteine sind mannosereich N-glykosyliert, falsch gefaltet, enzymatisch inaktiv und
werden im endoplasmatischen Retikulum (ER) zurückgehalten. Interessanterweise
interagiert keines der mutierten Proteine mit dem Wildtyp-Protein. Daher kommt es
nicht zur Bildung von Heterodimeren. Daraus lässt sich schließen, dass die
Transmembrandomäne, welche bei beiden Mutanten fehlt, eine notwendige
Voraussetzung für die Heterodimerisierung von LPH-Proteinen im ER darstellen
könnte.
Zusammenfassung
XI
Im zweiten Teil der These wurden die strukturellen Determinanten, die für den
Transport und die Reifung von LPH entlang des sekretorischen Weges in der Zelle
wichtig sind, detaillierter untersucht. Durch Deletionsmutanten konnte gezeigt
werden, dass die Stretchregion in Domäne II der Ektodomäne ein wichtiges
Strukturelement darstellt. Eine mögliche Interaktion mit dem ER-ständigen Chaperon
Calnexin (CXN) durch die N-Glykosylierungssequenz in exakt dieser Stretchregion
konnte durch ein Co-Immunpräzipitationsexperiment (IP) bewiesen werden. Die
eingesetzten Konstrukte, welche die Stretchregion in Domäne II enthalten, zeigten
eine verstärkte Interaktion mit Calnexin (CXN). Mit Hilfe dieser verschiedenen
Konstrukte konnte des Weiteren gezeigt werden, dass Domäne I und III der
Ektodomäne von LPH als intramolekulare Chaperone dienen, während Domäne II
und IV keine essentielle Rolle für die Transportkompetenz aufweisen.
Die vorliegende Arbeit bietet fundamentale Einblicke in die Pathophysiologie von
Mutationen im Gen von LPH, die KLD verursachen und komplementiert das Wissen
über strukturelle Determinanten, die wichtig sind für post-translationale Ereignisse
des Multidomänen-Glykoproteins LPH.
Introduction
1
Introduction
The primary distinguishing characteristic of the class Mammalia, to which humans
belong, is the presence of the mammary glands on females, in order to secrete milk
and nurse the offspring. Milk is composed of lactose, fat, proteins and crucial
electrolytes (Brussow, 2013). In mammalian milk, the lactose concentration is 7.2
mg/100 ml, whereas cow´s milk only contains 4.7 mg/100 ml (Solomons, 2002). Dairy
products made out of milk, like butter, yoghurt, cheeses and sour cream, contain
lower amounts of lactose due to its manufacturing process. Nowadays lactose is also
used as a commercial food additive, which is found in foods like processed meats,
margarines, sliced bread, breakfast cereals, potato chips, medications or protein
supplements. Lactose is the main energy source for infants and provides almost half
of their total energy supply (Vesa et al., 2000). Despite this important role, lactose
may enhance divalent cation uptake in the intestine, like calcium, and functions as an
immune-stimulant through its role as a substrate for the gut microbiome (Kwak, 2012;
Venema, 2012; Savaiano, 2014). Lactose also shows direct cellular effects on the
generation of antimicrobial peptides (AMP) such as cathelicidins (Cederlund et al.,
2013).
Lactose is a disaccharide that is formed in the mammary glands from the
monosaccharides glucose and galactose by the action of lactase synthase (Kuhn and
White, 2009). Glucose is the key source of energy for the human body. Through
glycolysis or later in the reactions of the citric acid cycle or oxidative phosphorylation,
glucose is needed to generate ATP. The availability of glucose also influences
physiological processes by providing almost all energy for the brain (Pramoud, 1997).
In eukaryotes, Galactose plays an important role in the biosynthesis of glycoproteins,
glycolipids and complex carbohydrates (Varki et al., 2009). Due to its conversion to
N-acetylgalactosamine, galactose is also used for the formation of gangliosides,
which play a central role in the immunity and signal transduction (Wang and BrandMiller, 2003).
2
Introduction
In order to digest and absorb lactose from the digestive system, it must be
hydrolyzed by a β-D-galactosidase located at the enterocytes of the small intestine
(Hauri et al., 1985; Naim et al., 1987). This β-galactosidase, called lactase-phlorizin
hydrolase (LPH, EC 3.2.1.23/108/62), belongs to the class of disaccharidases, which
are all located at the brush border membrane of enterocytes in the small intestine
(Naim et al., 1987; Naim et al., 1988; Naim et al., 1988). LPH is responsible for the
hydrolysis of lactose and the cleavage of glycosylceramides (Leese and Semenza,
1973; Semenza, 1986; Zecca et al., 1998). Besides the β-galactosidase, the two αglucosidases sucrase-isomaltase (SI) and maltase-glucoamylase (MGAM) are
required for the final hydrolysis of di- and oligosaccharides. While MGAM essentially
cleaves maltose, SI is responsible for the breakdown of the disaccharides sucrose,
isomaltose and partially maltose (Sim et al., 2010). The activities of the
disaccharidases are not equally distributed along the small intestine. LPH and SI
exhibit their highest activities in the proximal intestine, while MGAM reaches its
maximal activity in the ileum (Triadou et al., 1983). The area of the small intestine of
an adult human is 30 m2 (Helander and Fandriks, 2014). It is build up by microvilli
which lead to an increase in the cell surface to fulfill its function by absorbing the
digestive products into the blood stream. The hydrolysis of the di- and
oligosaccharides is indispensable to the absorption of monosaccharides across the
brush border membrane into the cell interior. The uptake of glucose and galactose is
mediated through SGLT1 transporters in the membrane of the epithelial cells
(Ferraris, 2001).
Absent or reduced activity of LPH leads to lactose malabsorption and in the presence
of gastrointestinal symptoms to lactose intolerance.
Types of lactase deficiencies
Three different forms of lactase deficiencies are known in humans (Table 1). The
primary lactase deficiency, also called adult type of hypolactasia (ATH) or lactase
Introduction
3
non-persistence, is a normal, developmental downregulation of lactase activity after
weaning (Sahi, 1994). The secondary or acquired lactase deficiency is induced by
gastrointestinal diseases causing (partial) atrophy of the small bowel villi (Heyman,
2006). Congenital lactase deficiency is a rare, but severe disease with absent lactase
activity in infants from birth on (Kuokkanen et al., 2006). Developmental lactase
deficiency is a disorder in preterm infants due to the fact that lactase activity is not
optimally developed before week 35-38 of gestation (Antonowicz and Lebenthal,
1977; Erasmus et al., 2002; Heyman, 2006).
Table 1: Different types of lactase deficiencies
Type
Pathogenesis
Primary lactase
deficiency
developmental downregulation of
the lactase activity after weaning
Secondary
lactase
deficiency
reduced lactase activity due to an
injury of the gastrointestinal tract
Congenital
lactase
deficiency
absent lactase activity from birth
on
Prevalence
~ 60-70% worldwide (Holden and
Mace, 1997);
varies from less than 5% to almost
100% (Sahi, 1994)
variable;
e.g. ~ 60% of postinfectious IBS
patients (Ruchkina et al., 2013)
really rare disease (Savilahti et al.,
1983);
1:60000 in Finland (Kuokkanen et
al., 2006)
Two-thirds of the world population is affected by the developmental downregulation
of the lactase activity level to 5%-10% of the level at birth during childhood and
adolescence (Sahi, 1994). The prevalence of adult type of hypolactasia (ATH) varies
between different populations, but appears to be more frequent in populations with a
history of dairying (Simoons, 1969; Simoons, 1970; Holden and Mace, 1997). In
Europe the frequency is between 2% in Scandinavia and 70% in some regions of
4
Introduction
Italy, while in Asia the incidence of ATH is nearly 100% (Scrimshaw and Murray,
1988; Sahi, 1994; Ozdemir et al., 2009). Lactase persistence appears due to a
polymorphism of a single autosomal gene, which leads to the failure to repress the
synthesis of lactase (Sahi, 1994; Harvey et al., 1995). Initially, a genotype/phenotype
study detected the two single nucleotide polymorphisms (SNPs) C/T −13910 and
G/A−22018 in the LCT gene, but nowadays other SNPs are known to be associated
with lactase persistence (Enattah et al., 2002; Ingram et al., 2007; Tishkoff et al.,
2007; Coelho et al., 2009; Ingram et al., 2009; Jensen et al., 2011). The molecular
mechanism is not completely understood, but it is established that all SNPs activate
the promotor of the LCT gene with a similar cis-acting effect (Olds and Sibley, 2003;
Lewinsky et al., 2005; Ingram et al., 2007; Ingram et al., 2009; Jensen et al., 2011).
Recently, Dzialanski et al. suggested an intermediate phenotype, because the
heterozygote CT−13910 and homozygote TT−13910, determined as lactase persistent,
differ in their physiological response to lactose intake (Dzialanski et al., 2015).
Secondary or acquired lactase deficiency is caused by a decrease in lactase
production after a gastrointestinal disease, an injury or a surgery. Examples of such
gastrointestinal diseases are gastroenteritis, celiac disease or inflammatory bowel
disease (Usai-Satta et al., 2012). Clinically, secondary lactase deficiency occurs after
small bowel injury, such as viral or parasitic infections. Giardia infections are
described to be associated with lactose intolerance (Gendrel et al., 1992), as well as
the human immunodeficiency virus (HIV) (Miller et al., 1991). Secondary lactase
deficiency is only a temporally disorder, which can be completely overcome after a
few months.
Congenital lactase deficiency (CLD) leads to a complete elimination of lactase
activity from birth on and represents a very severe disorder in infants due to the lifethreatening dehydration and loss of electrolytes (Holzel et al., 1962; Holzel, 1967).
Un- or misdiagnosis of CLD can lead to developmental disorders and to defects of
Introduction
5
the liver and the brain (Berg et al., 1969; Hoskova et al., 1980). The prevalence of
CLD is very low. Until now, only a few cases are described so far (Savilahti et al.,
1983; Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida et al., 2012; Sala
Coromina et al., 2014; Fazeli et al., 2015). Small intestinal biopsies reveal normal
histological characteristics but low or completely absent lactase activity (Asp et al.,
1973; Freiburghaus et al., 1976). The lack of lactase activity is associated with
mutations in the coding region of LPH, which are inherited in an autosomal recessive
way. The most common types of mutations result in a truncated protein as a result of
frameshifts or stop codons (Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida
et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015) (Table 2, 9 out of 13
belong to these types). The other mutations lead to an amino acid exchange, which
affects the function of LPH (Kuokkanen et al., 2006; Torniainen et al., 2009). All of
the mutations appear in a homozygous or compound heterozygous pattern of
inheritance (Table 2). The origin of the genetic background is probably located in
Finland, because five mutations were detected in a study with 32 Finnish patients
and additional two mutations were also found in Finnish patients in another study
(Kuokkanen et al., 2006). Out of the five mutations in the first study, the mutation
Y1390X, also called the Finmajor, had the highest prevalence with 84%. This result
could be confirmed in a screening of 556 anonymous blood donors in Finland
(Kuokkanen et al., 2006). The other four mutations were only detected in the first
study, except the G1363S mutation, which was also found in another study in two
siblings of Turkish origin (Enattah et al., 2008). This study also detected two
mutations in an Italian patient. Recently, four other mutations were detected in
patients from Japan, Spain and Turkey (Uchida et al., 2012; Sala Coromina et al.,
2014; Fazeli et al., 2015).
On the protein level only the G1363S-, the Y1473X- and D1796fs-mutant were
analyzed in more detail. The G1363S-mutant resulted in a misfolded protein that was
blocked in the ER and was enzymatically inactive (Behrendt et al., 2009).
6
Introduction
Table 2: Reported CLD patients with mutations in the LCT gene
Author/year
Ethnic
origin
Inheritance
pattern
Mutation
Effect
Domain
Kuokkanen
2006
Finland
homozygous
c.4170T > A
p.Y1390X
III
Finland
compound
heterozygous
c.4998_5001delTGAG
p.S1666KfsX58
IV
Finland
compound
heterozygous
c.653_654delCT
p.S218CfsX6
I
Finland
compound
heterozygous
c.804G > C
p.Q268H
I
Finland
compound
heterozygous
c.4087G > A
p.G1363S
III
Italian
compound
heterozygous
c.2062T > C
p.S688P
II
Italian
compound
heterozygous
c.4834G > T
p.E1612X
IV
Finland
compound
heterozygous
c.1692_1696delAGTGG
p.V565LfsX3
II
Finland
compound
heterozygous
c.4760G > A
p.R1587H
IV
Turkish
homozygous
c.4087G > A
p.G1363S
III
Japanese
compound
heterozygous
c.4419C > G
p.Y1473X
IV
Japanese
compound
heterozygous
c.5387delA
p.D1796AfsX18
IV
Coromina
2015
Spanish
homozygous
c.2232 2253dup22
p.L752KfsX18
II
Fazeli
2015
Turkish
homozygous
c.3448delT
p.1150PfsX19
III
Torniainen
2009
Uchida
2012
Introduction
7
Symptoms of lactose intolerance and secondary associated disorders
Typical symptoms are generated by the undigested and non-absorbed lactose, which
is fermented by the gastrointestinal microbiota. Products of the fermentation are short
fatty acid, hydrogen, carbon dioxide and methane (Matthews et al., 2005). Typical
gastrointestinal symptoms of lactose intolerance are abdominal pain, cramps,
borborygmi, bloating and flatulence, watery and acidic diarrhea, nausea and vomiting
(Vesa et al., 2000). The pathophysiological mechanisms causing these symptoms
are the production of gas and the osmotic change due to the undigested lactose in
the colon. The severity of the symptoms due to lactose intolerance is dependent on
whether small intestinal lactase activity is present (Swallow, 2003), the ingested
lactose load, the distribution of lactose intake across the day (Lomer et al., 2008),
associated food and nutrient properties (Shaukat et al., 2010), intestinal microbiota
(Zhong et al., 2004) and gut motility (Wahlqvist, 2015). Furthermore prior infection,
the usage of antibiotics and other gastrointestinal disorders (Zhao et al., 2010) such
as irritable bowel syndrome (Yang et al., 2013) have to be taken under consideration
in regard to the origin of the gastrointestinal symptoms. Due to these different factors
affecting the appearance of symptoms, it might be explicable, why the association of
self-reported lactose intolerance and the occurrence of symptoms after lactose
ingestion is very poor (Suarez et al., 1995) even in patients with lactase deficiency
(Zheng et al., 2015). One possible explanation for this lack of symptoms may be the
adaptation of the colonic microbiome in lactose intolerant persons or as a result of
the inheritance pattern of pathogenic mutations in CLD.
Reduced consumption of dairy products in lactose intolerant persons may lead to
higher risk of secondary disorders due to the reduced intake of milk and dairies
ingredients. Some studies reported that the risk of bone loss might be increased due
to the restriction of dairy products, which are the major source of calcium in many
individuals (Obermayer-Pietsch et al., 2004; Laaksonen et al., 2009). Calcium
absorption in the intestine and the incorporation of calcium into the bones are
facilitate by casein, a prominent component of the milk (Scholz-Ahrens and
Schrezenmeir, 2000). Conversely, another study could not detect any evidence of a
8
Introduction
detrimental effect of lactase deficiency on adult bone mass, but they suggested
changes in the activity of bacterial anaerobes in the intestine (Slemenda et al., 1991).
Lactose and milk consumption is reported to have a protective effect on the risk of
developing colon or colorectal cancer (Jarvinen et al., 2001). One possible
explanation for this phenomenon is that butyrate, a product of the lactose
fermentation in the colon, reduces the central cell proliferation of cancer cells in
culture (Jarvinen et al., 2001). Another explanation is that galactose, a product of the
lactose hydrolysis in the intestine, can bind and thereby block lectins, which stimulate
monolayer proliferation (Evans et al., 2002). The effect of milk and dairy products on
the development of ovarian cancer has not yet been conclusively determined. While
some studies support the view that high doses of lactose and dairy products lead to
an increased risk of ovarian cancer (Rock, 2011; Lerchbaum et al., 2012), others do
not advocate the correlation of milk consumption and ovarian cancer (Herrinton et al.,
1995).
Diagnosis of lactose malabsorption and lactose intolerance
Nowadays, there are various methods available to diagnose lactose malabsorption
and lactose intolerance (Misselwitz et al., 2013). Testing of lactase activity in
duodenal biopsies is regarded as the reference standard (Newcomer et al., 1975).
Thereby the minimal normal lactase activity in infants is defined to 11 U/g (Nichols et
al., 2002). The advantage of this method is the direct testing of the enzymatic activity
per se without any influencing factors, like the intestinal microbiota. Limitations of the
biopsy activity measurement include the inhomogeneous expression of lactase
(Maiuri et al., 1994) and the invasiveness of the procedure, which is especially
problematic for infants with suspected CLD. Another possibility to test lactose
malabsorption is the genetic test, which is useful for identifying the known
polymorphisms that are connected to lactase non-persistence (Rasinpera et al.,
Introduction
9
2004). In case of CLD, the genetic test is really useful because it is most harmless for
the infant who suffer from severe gastrointestinal symptoms.
Lactose maldigestion and the associated symptoms can be assessed by the lactose
tolerance test (Arola, 1994) and the hydrogen-breath test (Metz et al., 1975). During
the lactose tolerance test the changes of glucose levels in the blood are monitored
after ingestion of lactose. The test principle is based on an increase of blood sugar
after lactose challenge due to its hydrolysis in the intestine. Logically, individuals who
maldigest lactose do not have an increase in their blood glucose levels. The
disadvantage of this method is the fluctuations of postprandial blood sugar, which
can lead to false-negative outcomes. The hydrogen breath test displays the changes
in the H2-levels in the exhaled air after lactose intake. The test principle is the
increase of H2-levels in respiratory air after lactose challenge due to bacterial
degradation of lactose in the colon. Individuals who maldigest lactose have an
increase in H2-levels of the exhaled air, while lactose tolerant persons lack this
increase due to normal lactose hydrolysis. False-negative tests may occur due to the
presence of hydrogen non-producing bacteria in the colon (2%-43%) (Gasbarrini et
al., 2009). Both test principles, the lactose tolerance test and the hydrogen-breath
test, may lead to false-negative results due to the increased rapid gastrointestinal
transit triggered by the lactose intolerance.
Other methods to prove if lactose intolerance is the reason for gastrointestinal
symptoms are the fecal reducing substances test, which relies on the presence of
undigested lactose in the stool due to the failed hydrolysis (Caballero et al., 1983)
and the fecal pH test, which measures the changes in the pH due to fermentation of
lactose (Maffei et al., 1984). Individuals who maldigest lactose are identified by a
colour change in the fecal reducing substances test or by a decrease in the stool pH
of 6 or lower in the fecal pH test (Tomar, 2014).
10
Introduction
Treatment of lactose intolerance in infants, children and adults
The treatment strategy is based on the form of lactase deficiency, the age and the
general state of health of the patient. Milk containing lactose is the major source of
energy and nutrients of infants, which is the reason why lactose intolerance has such
severe consequences for the patients, if it remains mis- or undiagnosed. The
treatment of these patients is a lactose-free diet. Later in life, dairy products form an
essential component of the human diet in many cultures. Children who are lactose
intolerant should not avoid milk and dairy products, because of the recommended
amount of calcium needed for normal calcium accretion and bone mineralization
especially during their development (Stallings et al., 1994). In general it is
recommended not to restrict milk and dairy products completely from the diet,
because of their calcium and vitamin D contents. Otherwise supplementation of those
components is required. Patients with self-reported lactose intolerance can digest up
to 12 g lactose without any symptoms (Savaiano et al., 2006). One approach in the
management of lactose intolerance is therefore the steadily increase of the lactose
load in the diet, giving the colon time to adapt, which in turn may lead to a reduction
in symptoms. To avoid high contents of lactose there is lactose-hydrolyzed or
lactose-reduced milk available or simply milk-derived products containing less
lactose, such as yoghurt. Other main pharmacological approaches are the use of
lactase replacement supplements and the involvement of probiotics. Lactase
obtained from Kluyveromyces lactis represents a valid therapeutic strategy (Montalto
et al., 2005), while in the choice of probiotics Lactobacillus casei Shirota and
Bifidobacterium breve Yakult reach the best effects (Almeida et al., 2012).
Lactase-phlorizin hydrolase (LPH)
LPH is a β-galactosidase of the brush border membrane, which comprises two main
catalytic activities: the lactase activity in domain IV at position Glu1749 and the
phlorizin hydrolase activity in domain III at position Glu1273 (Zecca et al., 1998). Due
Introduction
11
to its lactase activity, LPH is able to cleave lactose, the main carbohydrate in
mammalian milk and based on its phlorizin hydrolase activity LPH has a wide
specificity of substrates like glycosyl-N-acylspingosines, phlorizin and flavonoid
glycosides, which are present in many fruits and vegetables and are known for their
anticarcinogenic and antiantherogenic activities (Day et al., 2000; Nemeth et al.,
2003). The expression of LPH is barely detectable in the crypts, but its expression
reaches its maximum between the lower and midvilli and decreases at the villus tip
(Hauri et al., 1985; Rings et al., 1992). During development, the expression of LPH
follows a similar pattern at the protein and mRNA levels (Fajardo et al., 1994). The
gene of human LPH is located on chromosome 2, is approximately 55 kb in size and
comprises 17 exons (Kruse et al., 1988; Boll et al., 1991). Furthermore, the gene
contains binding sites for transcription factors such as CTF/NF-1 and AP2 (Boukamel
and Freund, 1992; Troelsen et al., 1994). The regulation of lactase levels within the
cell is probably due to a nuclear protein (NF-LPH1) that binds upstream from the
transcription site (Troelsen et al., 1992; Troelsen et al., 1994; Troelsen et al., 1997).
Another regulatory mechanism of lactase levels at the cell surface is glycosylation.
LPH is highly N- and O-glycosylated, which is important for correct folding of the
protein and thereby for its enzymatic activity. It is known that reduced glycosylation
leads to reduced lactase activity and reduced levels of LPH at the cell surface (Naim
and Lentze, 1992; Jacob et al., 2000). These co-and post-translational events are
discussed in more detail in the paragraphs about biosynthesis and intracellular
processing and protein modification, folding and quality control in the ER. The cDNA
of LPH is built of 6274 bp and encodes a 1927 amino acid long protein (Mantei et al.,
1988). LPH, as a type I membrane glycoprotein, consists of an N-terminal
extracellular domain and a C-terminal cytosolic domain. LPH is composed of different
protein domains and is therefore a multi-domain protein, but the role of each single
domain has not been determined so far. The N-terminal domain consists of a 19
amino acid long signal sequence that is needed for the translocation of newly
synthesized LPH proteins into the ER-lumen, followed by an ectodomain that
consists of four homologous domains with 38% - 55% identity to each other (Mantei
et al., 1988). Those four domains are highly conserved, which led to the hypothesis
12
Introduction
that LPH might have arisen from two subsequent duplications (Wacker et al., 1992).
Domains I and II are described as the profragment that is cleaved off during the
transport of LPH to the cell surface. The mature LPH consists only of domains III and
IV, which comprise the catalytic sites of LPH. The anchoring of LPH is mediated
through 19 hydrophobic amino acids, while the cytosolic domain is built of 26 amino
acids, which are highly hydrophilic (Mantei et al., 1988).
Biosynthesis and intracellular processing
LPH is synthesized as a monomeric pro-LPH molecule with a molecular weight of
215 kDa in the ER (Naim et al., 1991). In this organelle, the first co- and posttranslational modifications take place before LPH is further transported to the Golgi
apparatus along the secretory pathway. In the ER, during its synthesis, LPH is cotranslationally modified by N-glycosylation, which leads to the formation of the
mannose-rich N-glycosylated form of the protein. This modification of proteins is
experimentally detectable by the usage of endo-β-N-acetylglucosaminidase H (endo
H), that only cleaves mannose-rich and some hybrid N-glycans between the two Nacetylglucosamines. The N-glycosylation in the ER plays an indispensable role in the
folding of LPH, which consists of 15 potential N-glycosylation sites. The correct
folding of the protein is monitored by the quality control system of the ER, which is
explained in more detail in the paragraph about protein modification, folding and
quality control in the ER. Before LPH is further transported, another requirement, that
is important for its function has to be fulfilled. This is the dimerization step of two proLPH molecules, which is mediated through the presence of the transmembrane
domain and is dependent on a stretch of 87 amino acids in the ectodomain between
position 1646 and position 1559 at the C-terminus of domain IV (Danielsen, 1990;
Naim and Naim, 1996; Panzer et al., 1998). After successful exit out of the ER, LPH
is transported to the Golgi apparatus, where complex N-glycosylation and Oglycosylation occur. Thereby a pro-LPH molecule with a molecular weight of 230 kDa
is generated (Hauri et al., 1985; Naim et al., 1991). Complex N-glycans are
Introduction
13
experimentally detectable by the usage of Peptide-N-Glycosidase F (PNGase F),
which cleaves all forms of N-glycans, except the fucosylated ones. This posttranslational modification is crucial for the correct folding, the transport and the
enzymatic activity of LPH (Naim, 1992; Naim and Lentze, 1992; Jacob et al., 2000).
The importance of O-glycosylation for its enzymatic function was shown in a previous
study due to the 4-fold increased activity of the N-and O-glycosylated form compared
to the N-glycosylated form of the protein (Naim and Lentze, 1992).
The intracellular processing of LPH is mediated through two proteolytic cleavage
steps, which take place in the trans-Golgi network (TGN) and at the cell surface
(Naim et al., 1987; Jacob et al., 1996; Wuthrich et al., 1996). The first cleavage at
position Arg734/Leu735 leads to the conversion of pro-LPH to LPHβinitial by the cut-off
of domain I and most of domain II that, together, form the profragment LPHα (Figure
1). After further transport of LPH to the apical membrane of the epithelial cell, the
second proteolytic cleavage occur by a pancreatic trypsin at position Arg868/Ala869
leading to the mature form of LPH, called LPHβfinal. The molecular weight LPHβfinal is
160 kDa (Danielsen et al., 1984; Naim et al., 1987).
The profragment LPHα is directly involved in the folding of the protein and functions
thereby as an intramolecular chaperone (Jacob et al., 2002). LPHα, despite its five
potential N-glycosylation sites, is neither N- nor O-glycosylated and is directly
degraded after the cleavage (Naim et al., 1994). Another intramolecular chaperone of
LPH is domain III, which is important for the correct folding of LPH. Its deletion leads
to a misfolded protein in the ER, which is probably degraded (Behrendt et al., 2010).
14
Introduction
Figure 1: Maturation steps of LPH in the intestinal epithelial cells. (A) The protein is
synthesized as a monomeric pro-LPH molecule by translocation in the ER. LPH consists of a
luminal C-terminus, a membrane anchor and an ectodomain with four highly-conserved
structural and functional domains and an extracellular N-terminus. (B) Prior to its exit from
the ER, pro-LPH molecules form homodimers. (C) In the Golgi apparatus, pro-LPH is
cleaved in the trans-Golgi network, which leads to the removal of LPHα, leaving LPHβinitial.
(D) After proper sorting of the protein to the apical membrane, LPHβinitial is cleaved by
pancreatic trypsin in the intestinal lumen to generate the mature form of the protein, called
LPHβfinal, consisting only of domains III and IV (Taken from Amiri and Diekmann et al. (Amiri
et al., 2015)).
Polarized sorting
LPH has to be transported to the apical membrane of epithelial cells to fulfill its
physiological functions. This sorting process is achieved by a number of sorting
signals within the protein or by cellular components, which interact with those signals.
One example of such a signal is the glycophosphatidylinositol (GPI) anchor, which
mediates apical sorting by interacting with membrane microdomains enriched in
glycospingolipids and cholesterol (Brown and Rose, 1992; Danielsen, 1995; Simons
and Ikonen, 1997). LPH does not interact with these membrane microdomains
(Naim, 1994; Danielsen, 1995; Jacob et al., 1999). Another common sorting signal of
apical sorting is mediated through N- and O-glycans by interacting with cellular
components. One example for this mechanism is SI, which requires O-glycosylation
Introduction
15
for its association with membrane microdomains and thereby for correct apical
sorting (Alfalah et al., 1999; Jacob et al., 2000). Previous studies have shown that Nand O-glycosylation are not required for correct sorting of LPH (Naim, 1994;
Danielsen, 1995; Jacob et al., 1999) and that neither the proteolytic cleavage step is
implicated into the sorting nor does the profragment contain any sorting signals
(Grunberg et al., 1992; Jacob et al., 1994). One requirement for correct sorting of
LPH is the presence of the transmembrane domain and it is strongly suggested that
domain IV contains a sorting signal for apical sorting (Jacob et al., 1997; Panzer et
al., 1998).
In general the transport of apical membrane proteins after the TGN is mediated by
distinct vesicles called SI-associated vesicels and LPH-associated vesicles (Jacob
and Naim, 2001; Jacob et al., 2003). In the past, research had unravelled interactions
of different galectins with lipids and glycoproteins in in the secretory pathway of cells.
They stabilize transport platforms for apical trafficking or sort apical glycoproteins into
specific vesicle populations (Delacour et al., 2009). Galactin-3 has been identified to
play an important role in this process by functioning as a sorting receptor (Delacour
et al., 2006; Delacour et al., 2007; Delacour et al., 2009).
Protein modifications, folding and quality control in the ER
The biosynthesis of proteins is comprised of a complex set of cellular events that are
strictly regulated to ensure the functionality of the end products. In eukaryotic cells up
to 30% of all proteins are targeted to the secretory pathway (Lemus and Goder,
2014). The folding status of nascent polypeptides is indicated by multiple posttranslational modifications that are added to the primary structure. Currently, more
than 200 forms of post-translational modifications are known, ranging from chemical
modifications such as phosphorylation or acetylation, to the addition of saccharides in
case of glycosylation or the addition of complete proteins like ubiquitin in the process
of ubiquitylation (Minguez et al., 2012). The biological role of glycans can be divided
16
Introduction
into two groups: I) the recognition of glycans by other molecules, which is important
for cell-cell interaction, detection of microbial adhesions, agglutinins or toxins and II)
the structural and modulatory properties, which are crucial for protective, stabilizing,
organizational and barrier functions e.g. proteoglycans in the maintenance of tissue
structure, porosity and integrity (Varki and Lowe, 2009).
The most common modification of proteins is the glycosylation (Apweiler et al.,
1999). During this process certain oligosaccharides are co- or post-translationally
attached to the polypeptide or later modified by trimming or adding further
oligosaccharides (Varki and Lowe, 2009). These glycans can be detected by
chaperones and other proteins that assist in their folding and transport to their final
intra- and extracellular destinations. In the ER, glycoproteins are modified by
mannose-rich N-glycosylation and later, along the secretory pathway, further
complex N-glycosylation and O-glycosylation in the Golgi apparatus take place.
Changes in the glycosylation state of proteins can lead to several genetic and chronic
diseases, like cancer (Saldova et al., 2011; Miwa et al., 2012; Bull et al., 2013;
Balmana et al., 2016), inflammation (Gornik and Lauc, 2008), Alzheimer’s disease
(Schedin-Weiss et al., 2014), diabetes (Thanabalasingham et al., 2013; ZurawskaPlaksej et al., 2015) and metabolic disorders such as cystic fibrosis (Rhim et al.,
2004).
Membrane glycoproteins, like LPH, or secretory glycoproteins are synthesized at the
ribosomes and translocated into the ER. During the translocation, N-linked
glycosylation may cotranslationally occur on the nascent protein if the tripeptide
sequence Asn-X-Ser or Asn-X-Thr is present (Kornfeld and Kornfeld, 1985; Petrescu
et al., 2004). The asparagine residue of this consensus sequence is rapidly modified
through a pre-assembled oligosaccharide, which is built on a dolichol phosphate, a
lipid anchor in the membrane of the ER. The pre-assembled oligosaccharide is
composed of three glucose residues, nine mannoses and two N-acetylglucosamines
(Glc3Man9GlcNAc2) ((Ferris et al., 2014), Figure 2). The oligosaccharides attached
to glycoproteins seem to play an important role in the correct folding and the stability
of many proteins in the ER (Helenius and Aebi, 2004). The transfer of the pre-
Introduction
17
assembled oligosaccharide on the newly synthesized protein is catalyzed by an
oligosaccharyltransferase, an ER-membrane bound protein complex (Dejgaard et al.,
2010; Mohorko et al., 2011; Pfeffer et al., 2014). Further modifications by trimming
the oligosaccharides are mediated through two glucosidases: glucosidase I, a type II
membrane glycoprotein, which cleaves the terminal glucose residue and glucosidase
II, a soluble heterodimeric enzyme, which removes sequentially the next two glucose
residues ((Hirschberg and Snider, 1987; Shailubhai et al., 1991; Pelletier et al.,
2000), Figure 2). During these modifications an important quality control of the newly
synthesized protein takes place.
Figure
2:
Structure
of
the
N-linked
core
glycan.
The
triantennary
tetradecaoligosaccharide is assembled on the ER membrane and is covalently linked to the
Asn side chains in the context of the N-glycosylation consensus sequence of newly
translocated proteins. The 14-sugar form, starting from the Asn residue, contains two Nacetylglucosamine (GlcNAc, squares), nine mannose (circles) and three glucose (triangles)
residues (modified from (Ferris et al., 2014)).
After the first trimming step of glucosidase II, the Ca2+-dependent lectin chaperones
calnexin (CNX) and calreticulin (CRT) recognize the maturing polypeptide by its
monoglucosylated glycans (Hammond et al., 1994). Calnexin is a type I membrane
protein and calreticulin is its soluble paralog that is localized in the ER-lumen. Both
proteins function in conjunction with ERp57, an ER-resident oxireductase, as the
major chaperone complex in the CNX/CRT cycle (Williams, 2006). The N-terminal
18
Introduction
domain of calnexin or calreticulin interacts with the monoglucosylated glycans on the
nascent protein, while ERp57 builds transient mixed disulfide bonds with the
polypeptide to improve its folding (Hebert and Molinari, 2007).
The second trimming step of glucosidase II releases the protein from the lectin
chaperones due to their low affinity to glycans lacking the terminal glucose residue
and leads to the exit of the native glycoprotein from the ER and its transit through the
secretory pathway. The UDP-glucose:glycoprotein glucosyltransferase (UGGT),
which can re-attach the last glucose of the N-linked glycan of improperly folded
glycoproteins and allows the re-entering into the CNX/CRT cycle, plays an essential
role in the quality control (Trombetta and Parodi, 2003; Hebert et al., 2005).
Besides calnexin and calreticulin, there are additional ER-resident chaperones
involved in protein folding, including an immunoglobulin binding protein (BiP) and a
protein disulfide isomerase (PDI) (Fink, 1999; Braakman and Hebert, 2013). BiP, a
member of the Hsp70 family, consists of a C-terminal substrate-binding domain and
an N-terminal nucleotide-binding domain (Munro and Pelham, 1986; Flynn et al.,
1991). BiP can either increase or decrease the protein folding rate in an ATPdependent way (Bukau et al., 2006). While BiP binds the substrate to allow
accomplishment of the native confirmation, other chaperones like PDI may generate
or rearrange disulfide bonds within the substrate that are properly paired (Freedman
et al., 1989).
The accumulation of misfolded proteins leads to the activation of the unfolded protein
response (UPR) (Zhang and Kaufman, 2006). The activation of the UPR results in
reduced total protein expression, upregulated expression of ER chaperones and
increased ER-associated degradation (Travers et al., 2000; Schroder, 2008). In case
the homeostasis situation is not restored or if the conditions become more severe,
UPR can lead to the induction of apoptosis (Oyadomari et al., 2002; Briant et al.,
2015; Lobo et al., 2016). Several transmembrane proteins are involved in UPR, such
as activating transcription factor 6, protein-kinase RNA-like ER kinase and inositolrequiring protein 1 (Cox et al., 1993; Harding et al., 1999; Ye et al., 2000; Ron and
Walter, 2007). Unsurprisingly, many human diseases like lysosomal storage
Introduction
19
diseases, myelination diseases, cystic fibrosis, systemic amyloidoses such as light
chain myeloma, and neurodegenerative diseases including Alzheimer's disease have
recently been linked to ER stress or to misfolding and/or misassembly of membrane
proteins (Hutt et al., 2009; Ng et al., 2012). The accumulation of misfolded proteins
leads to a disruption of the ER function. Therefore it is essential that those misfolded
proteins are quickly and efficiently removed from the ER.
Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum.
Glycoproteins first enter the CNX/CRT cycle after removal of the two terminal glucose
residues of the attached N-glycan by glucosidases I and II. The resulting monoglucosylated
N-glycan binds to the ER-resident chaperones CNX and CRT, which associate with ERp57
supporting the catalysis of disulfide-bond formation. The substrate dissociates from
CNX/CRT upon glucosidase II-mediated removal of the terminal glucose residue from the N-
20
Introduction
glycan. At this point, the folding status of the glycoprotein is controlled by the UGGT, which
specifically binds nearly-native folding forms and reglucosylates them. Correctly folded
proteins are allowed to exit the ER. Reglucosylated substrates enter again the CNX/CRT
cycle. Substrates eventually exit the CNX/CRT cycle upon demannosylation of N-glycans.
The mechanism for permanent removal of misfolded proteins from the cycle involves active
recognition of demannosylated forms by ERAD components for proteasomal degradation
(adapted by (Ellgaard and Helenius, 2003)).
The removal of misfolded proteins from the ER occurs via the ER-associated
degradation (ERAD) (Olzmann et al., 2013). ERAD is initiated by the ER
degradation-enhancing α-mannosidase-like protein (EDEM) that is able to recognize
and modify the misfolded proteins by trimming the mannose residue of the core
glycan (Ninagawa et al., 2014). Mannose removal requires several proteins, including
ER-α1,2-mannosidase, EDEM 1,2,3 and Golgi-resident mannosidase I (Hosokawa et
al., 2003; Hosokawa et al., 2007; Avezov et al., 2008; Aikawa et al., 2012). ERAD is
a process whereby misfolded proteins are retranslocated back to the cytosol where
they undergo ubiquitination and later degradation by the 26S proteasome (Vembar
and Brodsky, 2008; Christianson and Ye, 2014). These steps are mediated by a
variety of ER and cytoplasmic factors which are organized around the membraneembedded E3 ubiquitin ligase complex (Ruggiano et al., 2014). It has been shown
that the location of the folding defect determines the initial site of ubiquitination and
thereby the specific ERAD-degradation pathway (Briant et al., 2015). Currently, three
different ERAD pathways are described, depending on the ligases and the
chaperone requirements that are necessary during the retranslocation and the
degradation of the misfolded domain (Carvalho et al., 2006).
Correctly folded glycoproteins that pass the ER quality control system, are able to
exit the ER and are further transported to the Golgi apparatus. This process is
mediated by the Golgi-resident mannosidases: Golgi mannosidase I and Golgi
mannosidase II demannosylate the arriving glycoproteins (Moremen, 2002). Only
natively folded glycoproteins are further glycosylated and transported to their final
destinations. Misfolded glycoproteins are recognized by the quality control system of
21
Introduction
the Golgi apparatus and degraded through lysosomal degradation (Arvan et al.,
2002).
The
complex N-glycosylation
in
the Golgi apparatus is initiated by the
demannosylation of up to 3 mannoses, followed by defined elongation and branching
of the core glycan by using N-acetylglucosamine, galactose and sialic acid
monomers (Stanley et al., 2009). In the Golgi apparatus, O-glycosylation may also
take place. Generally, mucin and mucin-like glycoproteins are heavily Oglycosylated, but there are also several types of nonmucin O-glycans, including αlinked O-fucose, β-linked O-xylose, α-linked O-mannose, β-linked O-GlcNAc (Nacetylglucosamine), α- or β-linked O-galactose, and α- or β-linked O-glucose glycans
(Brockhausen et al., 2009). LPH belongs to the class of mucin or mucin-like
glycoprotein. Mucin O-glycans start with a covalently α-linked N-acetylgalactosamine
residue linked to serine or threonine of the nascent protein. In contrast to the Nglycosylation, the target sites for O-glycosylation are not located in a determinate
consensus sequence (Jensen et al., 2010). This reaction is catalyzed by a
polypeptide-N-acetyl-galactosaminyltransferase. The N-acetylgalactosamine may be
extended with sugars including galactose, N-acetylglucosamine, fucose, or sialic acid
in a non-specified way and form thereby, in contrast to the N-glycosylation, a very
heterogeneous population by the different branching and different sequences of the
monosaccharides (Brockhausen et al., 2009). In contrast to the initial reactions of Nglycosylation, no pre-assembled core oligosaccharide is involved in the O-glycan
biosynthesis, and no glucosidases appear to be involved in the processing of Oglycans within the Golgi apparatus.
22
Aim of the dissertation
Aim of the dissertation
The first aim of this dissertation is the biochemical analysis of two novel mutations in
the LCT gene, which were found in a Japanese infant with suspected CLD. Both
mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA (p.D1796fs) in exon
16, are located in domain IV of the extracellular domain of LPH. Furthermore, the
determination of the influence of these pathogenic mutations concerning to the wild
type is of great interest, because the parents of the Japanese infant, suffering from
severe gastrointestinal symptoms, were described as symptom-free.
The second aim is to analyze the structural features of LPH in more detail, because
LPH is a multi-domain protein and the specific function of each domain is not known
yet. This structural analysis is also important in regard to the pathogenesis of certain
mutations, which are associated with CLD. If the role of each domain regarding
function and processing of LPH is understood, it would be much easier to estimate
the severity of certain mutations.
The specific aims of this dissertation are the following two points:
1) Investigation of the influence of two novel mutations in the coding region of
LPH found in a CLD patient on the structure, biosynthesis and function of
LPH.
2) Elucidation of the structural determinants for the transport of the multi-domain
membrane glycoprotein LPH in the early secretory pathway.
Publications
23
Publications
This thesis was prepared as a cumulative dissertation comprising two original articles
and one review article.
Authors´contributions
1) Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is
triggered by severe mutations on both alleles of the lactase gene. BMC
Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.
LD and KP performed the experiments and analyzed the data. LD drafted a
first version of the manuscript. HYN designed the study, analyzed the data
and wrote the final version of the manuscript. All authors read and approved
the final manuscript.
2) Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The
Diverse Forms of Lactose Intolerance and the Putative Linkage to Several
Cancers. Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.
†
These
authors
contributed
equally
to
this
work
MA, LD and MKB drafted a first version of the manuscript. HYN wrote the final
version of the manuscript. All authors read and approved the final manuscript.
3) Diekmann L.+, Behrendt M.+, Amiri M. and Naim H. Y., Structural
determinants for transport of a multi-domain membrane glycoprotein in the
early secretory pathway, J Biol Chem., under revision.
+
Authors contributed equally
24
Publications
LD and MB performed the experiments, analyzed the data and drafted a first
version of the manuscript. MA designed the study, analyzed the data and
contributed to drafting the manuscript. HYN designed the study, analyzed the
data and wrote the final version of the manuscript. All authors read and
approved the final manuscript.
Publications
25
Congenital lactose intolerance is triggered by severe mutations on
both alleles of the lactase gene
Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is
triggered by severe mutations on both alleles of the lactase gene. BMC
Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.
Abstract
Background: Congenital lactase deficiency (CLD) is a rare severe autosomal
recessive disorder, with symptoms like watery diarrhea, meteorism and malnutrition,
which start a few days after birth by the onset of nursing. The most common
rationales identified for this disorder are missense mutations or premature stop
codons in the coding region of the lactase-phlorizin hydrolase (LPH) gene. Recently,
two heterozygous mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA
(p.D1796fs) in exon 16, have been identified within the coding region of LPH in a
Japanese infant with CLD.
Methods: Here, we investigate the influence of these mutations on the structure,
biosynthesis and function of LPH. Therefore the mutant genes were transiently
expressed in COS-1 cells.
Results: We show that both mutant proteins are mannose-rich glycosylated proteins
that are not capable of exiting the endoplasmic reticulum. These mutant proteins are
misfolded and turnover studies show that they are ultimately degraded. The
enzymatic activities of these mutant forms are not detectable, despite the presence
of lactase and phlorizin active sites in the polypeptide backbone of LPH-D1796fs and
LPH-Y1473X respectively. Interestingly, wild type LPH retains its complete enzymatic
activity and intracellular transport competence in the presence of the pathogenic
mutants suggesting that heterozygote carriers presumably do not show symptoms
related to CLD.
26
Publications
Conclusions: Our study strongly suggests that the onset of severe forms of CLD is
elicited by mutations in the LPH gene that occur in either a compound heterozygous
or homozygous pattern of inheritance.
Publications
27
The Diverse Forms of Lactose Intolerance and the Putative Linkage
to Several Cancers
Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The Diverse
Forms of Lactose Intolerance and the Putative Linkage to Several Cancers.
Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.
†
These authors contributed equally to this
Abstract
Lactase-phlorizin hydrolase (LPH) is a membrane glycoprotein and the only βgalactosidase of the brush border membrane of the intestinal epithelium. Besides
active transcription, expression of the active LPH requires different maturation steps
of the pro-peptide through the secretory pathway, including N- and O-glycosylation,
dimerization and proteolytic cleavage steps. The inability to digest lactose due to
insufficient lactase activity results in gastrointestinal symptoms known as lactose
intolerance. In this review, we will concentrate on the structural and functional
features of LPH protein and summarize the cellular and molecular mechanism
required for its maturation and trafficking. Then, different types of lactose intolerance
are discussed, and the molecular aspects of lactase persistence/non-persistence
phenotypes are investigated. Finally, we will review the literature focusing on the
lactase persistence/non-persistence populations as a comparative model in order to
determine the protective or adverse effects of milk and dairy foods on the incidence
of colorectal, ovarian and prostate cancers.
28
Publications
Structural Determinants for transport of a multi-domain membrane
glycoprotein in the early secretory pathway
Lena Diekmann+, Marc Behrendt+, Mahdi Amiri and Hassan Y. Naim*
Department of Physiological Chemistry, University of Veterinary Medicine Hannover,
Hannover, Germany.
+Authors contributed equally.
*To whom correspondence should be addressed: Department of Physiological
Chemistry, University of Veterinary Medicine Hannover, Bünteweg 17, D-30559
Hannover, Germany,
Tel.: 49 511 9538780, Fax: 49 511 9538585, E-mail: [email protected]
Abstract
LPH is a membrane anchored type I glycoprotein of the intestinal epithelium that is
composed of four homologous structural domains. The role of each distinct domain in
the intramolecular organization and function of LPH is not completely understood.
Here, we analyzed the early events of LPH biosynthesis and trafficking by directed
restructuring of the domain compositions. Removal of domain I (LPH∆1) results in a
malfolded ER-localized protein. By contrast, LPH without domain II (LPH∆2) is
normally transported along the secretory pathway, but does not dimerize nor is
enzymatically active. Interestingly a polypeptide stretch in domain II between L735R868 exerts an intriguing role in modulating the trafficking behavior of LPH and its
biological function. In fact, association of this stretch with transport-competent LPH
chimeras results in their ER-arrest or aberrant trafficking. This stretch harbors a
unique N-glycosylation site that is responsible for LPH retention in the ER via
association with calnexin and facilitates proper folding of domains I and III before ER
Publications
29
exit of LPH. Notably, a similar N-glycosylation site is also found in domain IV with
comparable effects on the trafficking of LPH-derived molecules. Our study provides
novel insights into the intramolecular interactions and the sequence of events
involved in the folding, dimerization and transport of LPH. Furthermore, these
findings can explain the phenotypic diversity of clinical symptoms in congenital
lactase deficiency, particularly in the heterozygote cases where heterodimerization
can influence the trafficking and function of LPH.
Introduction
Many secreted and membrane proteins are synthesized with prodomains that appear
as clearly outlined regions with distinct boundaries (1,2). Prodomains can be
compact globule modules or linking domains (3) and are proteolytically cleaved along
the secretory pathway, oftentimes in the Golgi apparatus (1). The removal of the
prodomains can be implicated in the functional activation, intracellular trafficking and
sorting of the final mature protein product (2). In addition, it has been postulated that
they can also act as intramolecular chaperones (4), which support or regulate the
folding process of other domains (5,6). Prodomains with assigned intramolecular
chaperone function can be part of the mature protein (7) or can be cleaved from the
maturing protein to yield the final functionally active form of the protein (4) The
immature form of human small intestinal lactase-phlorizin hydrolase (LPH), an
essential brush border enzyme, comprises an N-terminal cleavable signal peptide,
four homologous domains, a transmembrane domain and a cytoplasmic domain ((8)
and Fig. 1A). The pro-peptide Ser20-Arg734 (LPHα) comprising the entire
homologous domain I and more than two thirds of domain II is proteolytically
removed in the trans-Golgi network (TGN) by a trypsin-like protease (9) LPHα is
subsequently degraded (6) and the remaining protein, indicated LPHβinitial, is targeted
to the apical surface of intestinal epithelial cells. In the intestinal lumen pancreatic
trypsin generates the mature form of the polypeptide (LPHβ final) via removal of the
polypeptide stretch Leu735-Arg868 (indicated LPHstretch) (10).
30
Publications
LPHα is devoid of sorting signals and catalytic activity (11,12) as well as detectable
complex N- or O-glycans (6); however it is rich in cysteine and hydrophobic amino
acid residues suggesting a rapid folding to a compact globular domain that is
stabilized by disulfide bonds (13) and facilitates the formation of a correctly folded
LPHβinitial domain. The chaperone function of LPHα is a particular event in the folding
events of LPH that cannot be compensated by ER-molecular chaperones such as
calnexin or BiP (13). Together with LPHα it can be postulated that the LPH stretch
(Leu735-Arg868) exerts an important role in the correct folding of the pro-LPH.
Recently, we analyzed the roles of homologous domains comprised by mature
LPHβfinal (domains III and IV) (14). Surprisingly, domain III per se revealed transportand sorting-competence without the need for the remaining domains. By contrast,
homologous domain IV is neither properly transported nor enzymatically active per
se. Nevertheless, open questions remain to be answered concerning the role of the
synthesized part of nascent LPH, its profragment, in the context of topological
organization, folding cooperativity, and function of the whole protein (15). Moreover,
the fact that the theoretical boundary between homologous domains I and II revealed
by intramolecular sequence alignment and in silico analysis does not correspond to
the cleavage site between LPHα and LPHβ initial (Arg734/Leu735) (8) suggests that
the folding of the LPH profragment is not a simple linear process. Therefore, we set
forth to decipher the impact of homologous domains I and II on the generation of a
transport-competent and enzymatically active configuration of LPH as well as to
study the contribution of each domain to the folding process.
Experimental procedures
Materials and Reagents – DEAE-dextran, pepstatin, leupeptin, antipain, aprotinin,
trypsin inhibitor, phenylmethanesulfonyl fluoride, trypsin, Triton X-100, sodium
dodecyl sulfate (SDS), molecular weight standards for SDS-PAGE, Dulbecco’s
modified Eagle’s medium (DMEM), minimum essential medium (MEM), streptomycin,
penicillin, glutamine, fetal calf serum (FCS), and trypsin-EDTA were acquired from
Publications
31
Sigma-Aldrich (Munich, Germany). Isis DNA polymerase was purchased from
Qbiogene (Heidelberg, Germany). Tissue culture dishes were obtained from Sarstedt
(Nümbrecht, Germany). L-[35S] methionine (>1000 Ci/mmol) and protein ASepharose were obtained from Amersham Biosciences Inc. (Freiburg, Germany).
Acrylamide, N,N’-methylenebisacrylamide, TEMED, ammonium persulfate, and
dithiothreitol were purchased from Carl Roth GmbH (Karlsruhe, Germany).
Restriction enzymes, secondary horseradish peroxidase-conjugated anti-mouse
antibody/Streptavidin were purchased from Thermo Fisher Scientific (Bonn,
Germany). The secondary antibodies coupled to Alexa Fluor® dyes were obtained
from Invitrogen (Karlsruhe, Germany).
Construction of cDNA clones – pΔ1, pΔ2, pLPHβinitial, pLPHβfinal, pDomain-3stretch,
pLPH-N821Q, pLPH-N1340Q and pLPH-N1814Q were generated by loopout/mutagenesis PCR using pSG5-LPH and pcDNA3-LPH (14) plasmids as the
template. LPH domains were dissected as described previously (14). The applied
oligonucleotides were obtained from Sigma-Aldrich and are listed in Table 1.
Transient
Transfection
of
COS-1
Cells,
Metabolic
Labeling,
Immunoprecipitation and SDS-PAGE – COS-1 cells were cultured and transfected
using DEAE-dextran as described previously (14). When indicated the cells were
biosynthetically labeled with [35S] methionine as described previously (14).
Immunoprecipitation and Western Blotting of LPH or the deletion variants from
detergent extracts of the cells was performed according to Naim et al. (16). Coimmunoprecipitation of LPH with calnexin was performed as reported previously (17).
A panel of monoclonal antibodies (mAbs) against human intestinal LPH (HBB 1/909
(18) and mLac1, mLac2, mLac4, mLac6 and mLac10 (19) was used to detect
different conformations of LPH (6). Where indicated treatment with endoglycosydase
H (endo H) or Peptide -N-Glycosidase F (PNGase F) (both from Roche Diagnostics,
Mannheim, Germany) was performed according to Naim et al. (16), and followed by
32
Publications
SDS-PAGE analysis. The protein bands were visualized using BioRad Molecular
Imager® FX facility. Tryptic protein structure analysis was performed as described
previously (20).
Cell Lysate Fractionation on Sucrose Density Gradients – In order to investigate
the quaternary structure of wild type and variants LPH, fractionation of cell lysates on
sucrose gradients was performed as described previously (14). Transiently
transfected COS-1 cells expressing wild type LPH or chimeric variants were labeled
with [35S] methionine for 6 h, solubilized in 50 mM Tris-HCl buffer pH 7.5 containing
6 mM n-Dodecyl β-D-maltoside, 150 mM NaCl, and protease inhibitors. After precentrifugation, the supernatant was loaded on a 10-30% (w/v) continuous sucrose
gradient and subjected to ultracentrifugation at 100000 x g for 18 h at 4°C.
Afterwards 18 fractions were collected, LPH was immunoprecipitated and analyzed
by SDS-PAGE.
Immunofluorescence and Confocal Fluorescence Microscopy – Subcellular
localization of LPH in transiently transfected COS-1 cells was determined using
indirect immunofluorescence as described previously (21). The primary antibody was
HBB 1/909 for LPH. Detection of the cell surface localized LPH was achieved by
treatment of the live cells with the primary antibody on 4°C, followed by extensive
wash, fixation and exposure to the Alexa Fluor® -coupled secondary antibody.
Confocal laser microscopy was performed with the Leica TCS SP5 microscope using
the 63x oil planachromat lens (Leica Microsystems, Germany).
Biotin assay – Transiently transfected COS-1 cells were treated with Sulfo-NHS-LCBiotin (1.5 mg/ ml) for 30 min at 4°C and quenched two times with 0.1% BSA for 10
min at 4°C. The cells were then solubilized with 1% Triton X-100 and LPH was
immunoprecipitated. Each immunoprecipitate was equally splitted into two parts, one
Publications
33
for immunoblotting against total LPH and the other for immunoblotting in nonreducing conditions followed by detection of the biotin-labeled LPH by the
horseradish
peroxidase-conjugated
streptavidin.
The
amount
of
quantified
biotinylated LPH was related to the amount of total LPH on the corresponding blot.
In silico analysis, quantifications and statistical analysis – Homology-based
multiple sequence alignment of the primary structure of LPH domain was performed
with PRALINE (22). The quantification of the protein bands was performed by
Quantity One® software (BioRad, Munich, Germany). Statistical significance was
determined according to student’s t-test, paired, one-directional with * p ≤ 0.05, ** p ≤
0.01 and *** p ≤ 0,001. Error bars are represented as SEM.
Results
The presence of homologous domain I is crucial for the attainment of transport
competence - To investigate the role of LPH pro-fragment on its folding and
transport events we aimed to construct a deletion variant by removing this part from
the wild-type LPH (Fig. 1). To achieve this purpose, an in silico analysis was
conducted to determine the potential domain boundaries as basis for site-directed
loop-out PCR. cDNA constructs, each lacking the coding region of one homologous
domain (LPHΔ1 and LPHΔ2), were generated (Fig. 2A) and expressed in COS-1
cells. The contribution of each of the two homologous domains was then deciphered
by comparing the outcome of their deletion on the structure, enzymatic function and
trafficking of the truncated protein forms (Fig. 2). The trafficking competence of the
variants from ER to Golgi was assessed by the acquisition insensitivity towards endo
H. As shown in Fig. 2B, LPHΔ2 acquired endo H-resistance indicating that this
deletion variant is properly transported from ER to the Golgi apparatus with a
processing rate comparable to the wild type. Likewise the turnover rates of both LPH
forms were similar as demonstrated in pulse-chase experiments up to 42h (Fig. 2C).
By contrast, truncation of the homologous domain I (LPHΔ1) elicited substantial
34
Publications
effects on the trafficking kinetics and behavior of the variant, which persisted as an
endo H-sensitive ER arrested and transport-incompetent form (Fig. 2B-2C). To
substantiate the biochemical data we addressed the cellular localization of the LPH
variants by indirect immunofluorescence under permeabilized and non-permeabilized
conditions. Fluorescence images obtained by confocal microscopy shown in Fig. 3A
demonstrate an exclusive intracellular localization of LPHΔ1, while LPHΔ2 was
detected intracellularly as well as at the cell surface. We further compared the level
of cell surface expression of the deletion variants versus that of the wild type protein
by cell surface biotinylation of COS-1 cells expressing these proteins. Western
blotting revealed that LPHΔ2 was found at almost similar expression levels at the cell
surface as its wild type counterpart, while LPH∆1 was not detected at the cell surface
(Fig. 3B). Collectively, these data indicate that the presence of the homologous
domain I is essential for the trafficking of LPH, since its deletion resulted in a
transport-incompetent ER-arrested immature protein. On the other hand, domain II is
neither rate-limiting along the early secretory pathway nor decisive in the maturation
of LPH in the Golgi apparatus.
Altered quaternary structure and folding of LPHΔ1 and LPHΔ2 relative to wild
type LPH - We have previously shown that homodimerization of LPH takes place
before LPH exits the ER and matures in the Golgi apparatus (20). Given that the
trafficking and maturation of the truncated form LPHΔ2 are essentially similar to
those of wild type LPH (vide supra), we asked whether LPHΔ2 acquires a quaternary
structure similar to the wild type. For this purpose, cell lysates from transiently
expressing COS-1 cells were subjected to sucrose density gradient followed by
immunoprecipitation and SDS-PAGE analysis and the band intensities were
quantified. As shown in Fig. 4A the mannose-rich form of LPHΔ2 was detected
predominantly as a monomeric form which apparently does not require dimerization
prior to ER egress, where the majority of the complex glycosylated molecules were
mainly found in the denser gradient fractions. The control wild type LPH displayed
two major peaks revealing the mannose-rich form in both of them, while the complex
Publications
35
glycosylated protein was found mainly in the peak that corresponds to the denser
fractions of the gradient. This is in accordance with previous data (20,23). LPHΔ1,
which persists as a mannose-rich glycoprotein in the ER, was found to be exclusively
detected in the lighter fractions of the gradient consistent with its retention in the ER
as a monomeric protein.
Assessment of the folding and functional structure of the deletion variants were
compared to the wild type protein using tryptic structural analysis and measurement
of the enzymatic activities. In tryptic analysis properly folded wild type LPH presents
normally two cleavage sites for trypsin at R734/L735 and R868/A869 positions (Fig.
1) which are subjected to sequential cleavage events during LPH maturation and cell
surface expression. (12,24). As shown in Fig. 4B the digestion profile of LPHΔ2 with
trypsin differed from that of the wild type during the early digestion time points. Here,
a smear of bands appeared that gradually converted to a predominant double band.
Given that both exposed trypsin-cleavage sites in the wild type LPH are located
within the homologous domain II and are thus eliminated in LPHΔ2 (compare Fig.
2A) we conclude that the new trypsin cleavage sites presented in LPHΔ2 are
concomitant with an altered folding pattern than the wild type LPH. Persistence of a
trypsin-resistant domain in both wild type and LPHΔ2 may indicate presence of an
autonomously folded region in both forms, fitting the most to the properties of the
domain III of LPH (14). LPHΔ1, by contrast to wild type LPH and LPHΔ2, was
completely degraded by trypsin already after 1 min of treatment reflecting exposure
of multiple trypsin cleavage sites and causal altered folding in comparison to wild
type LPH and LPHΔ2 (Fig. 4B).
We further determined the enzymatic activities of the immunoprecipitated variants
towards lactose and phlorizin in comparison to the wild type activities. The lactase
activity was not detectable in LPHΔ1 and LPHΔ2. Phlorizin hydrolase activity was
only detectable in LPHΔ2, albeit at substantially reduced levels of 4.3% (Fig. S1,
supplementary data). Since both catalytic sites are present in LPHΔ1 and LPHΔ2,
absence of the enzyme activities in line with the tryptic structural analyses indicate
36
Publications
altered folding of these two isoforms in such a way that affects the functional
domains.
Influence of LPHstretch on the transport competence of LPHβ and domain III The transport-competence of LPHΔ2 clearly indicates that domain II of pro-LPH is
not an essential component in the context of trafficking and efficient maturation of
LPH. However, the persistence of LPHΔ2 as a monomeric protein in its mannose-rich
and mature glycoforms, proposes a role for domain II in the dimerization event of
LPH. Of particular interest is a small domain that is composed of 134 amino acids,
later referred to as stretch that corresponds to the difference between LPHβ initial and
LPHβfinal and spans residues L735 to R868. The first of these two forms, LPHβ initial, is
generated from pro-LPH by proteolytic cleavage in the Golgi apparatus after its
complete maturation. The second form, LPHβ final, is cleaved from LPHβinitial by trypsin
at the apical surface and represents the enzymatic active form of LPH that is
implicated in its digestive function. The role and the requirement for the 134 residues
stretch in the trafficking and function of LPH has not been resolved yet. We
compared the biosynthesis and processing of LPHβ initial, with LPHβfinal (Fig. 5A). As
shown in Fig. 5B, LPHβfinal acquires endo H-resistant complex glycosylated form in a
similar way compared to its wild type counterpart indicating that it is trafficked at
nearly the same rate. However, LPHβinitial appears exclusively as a mannose-rich
protein (see also (13)). Immunofluorescence labeling revealed exclusive localization
of LPHβinitial in the ER and cell surface biotinylation confirmed that LPHβinitial is not
expressed the cell surface (Fig. 6A, 6B). LPHβfinal on the other hand was additionally
localized in the Golgi apparatus and at the cell surface (Fig. 6A, 6B), yet to a lesser
extent as compared to pro-LPH. Interestingly, the cell surface form of LPHβfinal had a
higher molecular weight than expected and even higher than the wild type (Fig. 6B).
The dimerization of pro-LPH has been shown to precede its exit from the ER (20).
We therefore investigated the potential dimerization of these LPH variants as a
potential mechanism responsible for their different trafficking behavior. Fig. 7
demonstrates that the mannose-rich forms of both LPHβinitial and LPHβfinal were
Publications
37
predominantly retained in gradient fractions that peaked in fractions 9. Besides the
peak of the band intensities for the dimeric LPH at fraction 12 (Fig. 4A), identification
of another peak for mature LPH at fraction 14 suggests presence of LPHβfinal in
oligomeric form at the cell surface (Fig. 6B). Overall, the results demonstrate that
both forms do not dimerize in the ER excluding therefore dimerization as a
prerequisite for ER exit of LPH. Given that the sequence difference between the two
LPH forms is limited to the L735-R868 stretch we assumed that this stretch contains
signals that retain LPHβinitial in the ER. To address this possibility we fused the stretch
to the transport-competent and autonomously folded core domain of LPH (LPH-D3)
(14) and examined the trafficking and functional properties of this chimera (LPHD3stretch)(Fig. 8A). As demonstrated in Fig. 8B the presence of the LPH stretch in LPHD3stretch resulted in a substantial reduction in the trafficking and maturation behavior
of this chimera. In fact, only a small proportion of a mature endo H-resistant LPHD3stretch was secreted into the cell culture medium.
The trafficking competence of LPH forms lacking domain II, such as LPH∆2, LPHβ final
and LPH-D3 supports the view that this domain contains proteinaceous signals that
lead to the retention of LPH or its trafficking delay when made accessible. On the
other hand, wild type LPH and LPH∆4 (14) contain domain II and yet both of them
are transport-competent. We assumed therefore that domain I and domain II could
form pseudodimers within the LPH molecule that mask potential retention signals in
domain II enabling thus LPH to exit the ER. This can explain why those LPH forms or
chimeras that contain domains I and II (wild type LPH, LPH∆3, LPH∆4 (14) or those
that are devoid of domain II (LPH∆2, LPHβfinal) are trafficking-competent. However,
the transport-competence of LPHβfinal is slightly reduced compared to the wild type,
despite the absence of domain II. It is likely that domain IV itself is rate-limiting in the
trafficking of this chimera, given that domain III per se is transport-competent and its
deletion elicits transport block of LPH (14). Moreover, deletion of domain IV
generates a protein that is more rapidly trafficked from the ER (14). Previous studies
have shown that deletion of the membrane domain while keeping the entire
homologous domains results in a transport-incompetent LPH (20).
38
Publications
Influence of LPHstretch on the interaction of different LPH variants with the ERlocalized chaperone calnexin - The observed ER retention led us to explore the
potential retention signal within the stretch of LPH and its counterpart in domain IV. In
silico analysis and sequence alignments predicted a unique and highly potent Nglycosylation site at Asn821 of domain II and Asn1814 of domain IV that is present in
a conserved region between these two domains (Fig. 9A). Based on the homological
sequence alignment, the equivalent position in domain III is Asp1338. N-glycosylation
at these sites can potentially trigger association of ER chaperone calnexin with
domains II and IV, providing a specific checkpoint for the quality control of the LPH
folding state before leaving the ER. To assess this hypothesis, LPH in wild type or
chimeric forms was immunoprecipitated from transiently transfected COS-1 cell
lysate and the ratio of co-immunoprecipitated calnexin in each sample was
determined by Western blot analysis. As shown in Fig. 9B, LPHβ initial that lacks
domain I and a major part of domain II except the stretch region associates with
calnexin to a comparable extent as the wild type LPH. On the other hand, the
absence of the stretch region in LPH∆2 and LPHβfinal results in a clear reduction in
the association with calnexin in these variants supporting the notion that at least one
calnexin binding site does exist within this stretch region. Altogether, the association
with calnexin reveals an immediate reverse correlation with the maturation rate of the
LPH-derived molecules, so that less transport-competent LPH forms associate more
avidly with calnexin (Fig. 9B). A similar experiment was performed using LPH-N821Q
and LPH-N1814Q variants which lack the hypothesized N-glycosylation site in the
domains II and IV respectively as well as LPH-N1340Q in which the closest potential
N-glycosylation site to Asp1338 is removed. The results clearly indicate that both
mutants, LPH-N821Q and LPH-N1814Q, interact to a lesser extent with calnexin
compared to the wild type, but yet are blocked in the ER likely due to misfolding (Fig.
9C). The mutation N1340Q in domain III results in a similar interaction of LPH with
calnexin compared to the wild type, indicating that this position is not implicated in
the interaction of LPH with calnexin (Fig. 9C).
These findings establish a hierarchical trafficking pattern between wild type LPH and
several non-trafficked chimeras. Thus, wild type LPH, LPH∆2, and LPH-D3 are
Publications
39
transport-competent proteins in contrast to LPH∆1 and LPHβinitial, while only a small
proportion of LPH-D3stretch is transported and secreted into the external medium.
Together with the data on the association of wild type LPH wild type and the various
LPH chimeras with calnexin, we can conclude that exposure or masking of certain Nglycosylation sites within the LPH act as a quality control measure and can regulate
further trafficking. In the partially folded wild type LPH these glycosylation sites in
domains II and IV are accessible for association with calnexin in order to ensure
proper folding of the entire protein. In the correctly folded protein these sites are
possibly masked by the neighboring domain.
Discussion
Folding of multi-domain proteins is achieved by synchronized interactions established
among different structural domains with each other and with the molecular
chaperones in order to obtain the native functional conformation (14). The capability
of actual advanced methods including ultrafast NMR (25) for studying the structure
and dynamics of nascent proteins is restricted to small soluble proteins and cannot
be applied to multi-domain gross proteins. Therefore, other approaches are needed
to elucidate early events in the biosynthesis of more complex proteins.
With its unique β-galactosidase function, LPH has an indispensable role in the
maintenance of the normal intestinal function. This protein is a multi-domain
membrane anchored glycoprotein for which functional expression at the intestinal
lumen requires proper post-translational modifications, including N- and Oglycosylation, dimerization and proteolytic cleavage, a complex intramolecular
organization and a targeted apical sorting. Intracellular maturation of LPH illustrates a
high order of domain-domain interactions. Firstly, two domains (LPHα and domain III)
act as intramolecular chaperones for the folding of the entire protein (13,14).
Secondly, the membrane anchor, the cytoplasmic domain and a stretch in domain IV
contribute to attainment of a transport-competent enzyme by contributing to the dimer
formation in the ER (19,20). And thirdly, despite a very high homology to the
40
Publications
functional domains, LPHα consisting of domain I and a major part of domain II has no
enzymatic activity, is cleaved off and ultimately is degraded in the Golgi apparatus.
With the lack of three dimensional structural analysis of LPH we generated a library
of LPH-derived proteins with the ultimate goal of elucidating the domains interaction
and identification of key elements in the overall LPH structure. A central piece of
knowledge that came out of these studies is that domain II contains potential
retention signals that prevent LPH from exiting the ER until it has acquired its proper
folding. This notion is supported by the observations that fusion of domain II or the
LPHstretch to any transport-competent LPH domain renders the generated chimeras
either transport-incompetent (e.g. LPHβinitial) or reduces substantially their trafficking
efficiency (LPH-D3stretch). Along supportive lines is that elimination of domain II from
LPH (LPHΔ2) has no marked effects on the transport of this LPH form out of the ER.
A similar retention mechanism is also detectable for domain IV, so that the single
expressed fully transport competent domain III has a substantially higher trafficking
rate in comparison to the domain III-domain IV chimera. When expressed collaterally,
domain I has the capability to suppress potential retention signals in domain II. The
presence of domain I is sufficient to restore trafficking of chimeras that contained
domain II and are arrested in the ER. Domain I is a part of the intramolecular
chaperone LPHα and its deletion in LPHΔ1 results in a malfolded protein that has lost
its enzymatic activity and is not transported out of the ER. A scenario of the
trafficking of pro-LPH proposes that (a) the correct folding of homologous domain I is
an early and crucial step for the attainment of the profragment chaperone function
and (b) homodimerization, the late ER event, is a crucial step in acquisition of the
functional capacity of LPH. Interestingly, LPHΔ2 is trafficked with almost similar
efficiency to the cell surface as wild type pro-LPH, but without acquisition of a dimeric
form in the ER clearly indicating that this event in contrast to pro-LPH is not required
for ER-exit. Furthermore, it proposes that domain II, perhaps in association with
domain I, contributes to the dimeric formation, otherwise LPHΔ2 would also form
dimers as pro-LPH. Indeed none of the transport-competent deletion variants or
chimeras acquires a dimeric structure. However, neither one of these monomeric and
Publications
41
transport-competent LPH forms are enzymatically-active. In light of all these findings
a new role of dimerization in the function and life cycle of LPH can be proposed.
The view that dimerization is a necessary and sufficient condition for pro-LPH to exit
the ER (20,26) is absolutely valid when the membrane anchoring domain, domain I,
domain II and domain IV are present to establish the dimerization event (14,20). In
fact, deletion of domain II or IV leads to an increased trafficking rate of the LPH
chimera without dimerization in the ER. Higher order multimeric forms can be
detected for the mature LPH (14). It is obvious therefore that these forms which all
are correctly trafficked and folded require all three domains for dimerization. Despite
the strong structural homologies and the anticipated autonomous nature of each of
the domains, their interaction creates a trafficking behavior of the various chimeras
that can be accommodated within a hierarchical concept. Our results suggest that
Asn821 in domain II and Asn1814 in domain IV are potential interaction sites of LPH
with the ER chaperone calnexin. These interactions promote folding of the partially
folded pro-LPH molecule on the expense of a longer processing and residence time
in the ER. We propose a model in which the folding and assembly of pro-LPH occurs
through two similar phases implicating domains I and II on one hand and III and IV on
the other (Fig. 10). Along this, domains II and IV through their potential retention
signals retain pro-LPH until domains I and III have properly folded and are thereafter
capable of interacting simultaneously with domains II and IV. Domains II and IV, now
in their proper conformation facilitate together with the membrane anchoring domain
the dimerization of pro-LPH.
Elucidation of the structural-functional relevance of the domains in pro-LPH is crucial
in unravelling and understanding the molecular basis of carbohydrate malabsorption
disorders that are associated with lactase deficiency or lactase malfunction.
Nevertheless, the concept that emerges from these studies is that the unique
structural arrangement of the homologous domains in pro-LPH may be immediately
associated with the pathogenesis of congenital lactase deficiency. The requirements
for the formation of homodimerization of LPH wild type molecules in the ER are
important to further investigate the possibility of heterodimer formation in a
42
Publications
heterozygote inheritance trait. Thus, the elucidation of the early events in the
biosynthesis of nascent LPH is not only of crucial relevance to intestinal cell
physiology, but it also provides an example on how the interaction of homologous
and autonomous domains affects the functional and trafficking properties of multidomain membrane-anchored proteins.
Acknowledgments
The authors thank Dr. Hans-Peter Hauri, formerly University of Basel, Switzerland,
Dr. Erwin Sterchi, formerly University of Bern, Switzerland, and Dr. Dallas Swallow,
University College London, UK, for generous gifts of monoclonal anti-LPH antibodies.
This work has been supported by SFB 621 (HYN).
Conflict of interest
The authors confirm that they have no conflict of interest.
Author contribution
LD and MB performed the experiments, analyzed the data and drafted a first version
of the manuscript. MA designed the study, analyzed the data and contributed to
drafting the manuscript. HYN designed the study, analyzed the data and wrote the
final version of the manuscript. All authors read and approved the final manuscript.
Publications
43
References
1.
Reines, A., Bernier, L. P., McAdam, R., Belkaid, W., Shan, W., Koch, A. W.,
Seguela, P., Colman, D. R., and Dhaunchak, A. S. (2012) N-cadherin
prodomain processing regulates synaptogenesis. J Neurosci 32, 6323-6334
2.
Ozawa, M., and Kemler, R. (1990) Correct proteolytic cleavage is required for
the cell adhesive function of uvomorulin. J Cell Biol 111, 1645-1650
3.
Brunger, A. T. (2001) Structure of proteins involved in synaptic vesicle fusion
in neurons. Annu Rev Biophys Biomol Struct 30, 157-171
4.
Inouye, M. (1991) Intramolecular chaperone: the role of the pro-peptide in
protein folding. Enzyme 45, 314-321
5.
Oberholzer, T., Mantei, N., and Semenza, G. (1993) The pro sequence of
lactase-phlorizin hydrolase is required for the enzyme to reach the plasma
membrane. An intramolecular chaperone? FEBS Lett 333, 127-131
6.
Naim, H. Y., Jacob, R., Naim, H., Sambrook, J. F., and Gething, M. J. (1994)
The pro region of human intestinal lactase-phlorizin hydrolase. J Biol Chem
269, 26933-26943
7.
Jacob, R., Purschel, B., and Naim, H. Y. (2002) Sucrase is an intramolecular
chaperone located at the C-terminal end of the sucrase-isomaltase enzyme
complex. J Biol Chem 277, 32141-32148
8.
Mantei, N., Villa, M., Enzler, T., Wacker, H., Boll, W., James, P., Hunziker, W.,
and Semenza, G. (1988) Complete primary structure of human and rabbit
lactase-phlorizin hydrolase: implications for biosynthesis, membrane anchoring
and evolution of the enzyme. Embo J 7, 2705-2713
9.
Naim, H. Y. (1992) Processing of human pro-lactase-phlorizin hydrolase at
reduced temperatures: cleavage is preceded by complex glycosylation.
Biochem J 285 ( Pt 1), 13-16
44
10.
Publications
Jacob, R., Radebach, I., Wuthrich, M., Grunberg, J., Sterchi, E. E., and Naim,
H. Y. (1996) Maturation of human intestinal lactase-phlorizin hydrolase:
generation of the brush border form of the enzyme involves at least two
proteolytic cleavage steps. Eur J Biochem 236, 789-795
11.
Jacob, R., Brewer, C., Fransen, J. A., and Naim, H. Y. (1994) Transport,
function, and sorting of lactase-phlorizin hydrolase in Madin-Darby canine
kidney cells. J Biol Chem 269, 2712-2721
12.
Grunberg, J., Luginbuhl, U., and Sterchi, E. E. (1992) Proteolytic processing of
human intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for
correct sorting in Madin Darby canine kidney (MDCK) cells. FEBS Lett 314,
224-228
13.
Jacob, R., Peters, K., and Naim, H. Y. (2002) The prosequence of human
lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J Biol
Chem 277, 8217-8225
14.
Behrendt, M., Polaina, J., and Naim, H. Y. (2010) Structural hierarchy of
regulatory elements in the folding and transport of an intestinal multidomain
protein. J Biol Chem 285, 4143-4152
15.
Wu, L., Li, W. F., Liu, F., Zhang, J., Wang, J., and Wang, W. (2009)
Understanding
protein
folding
cooperativity
based
on
topological
consideration. J Chem Phys 131, 065105
16.
Naim, H. Y., Sterchi, E.E., Lentze, M.J. (1987) Biosynthesis and maturation of
lactase-phlorizin hydrolase in the human small intestinal epithelial cells.
Biochemical Journal 241, 427-434
17.
Amiri, M., and Naim, H. Y. (2014) Long term differential consequences of
miglustat therapy on intestinal disaccharidases. J. Inherit. Metab. Dis. 37, 929937
Publications
18.
45
Ouwendijk, J., Peters, W. J., van de Vorstenbosch, R. A., Ginsel, L. A., Naim,
H. Y., and Fransen, J. A. (1998) Routing and processing of lactase-phlorizin
hydrolase in transfected Caco-2 cells. J Biol Chem 273, 6650-6655
19.
Panzer, P., Preuss, U., Joberty, G., and Naim, H. Y. (1998) Protein domains
implicated in intracellular transport and sorting of lactase-phlorizin hydrolase. J
Biol Chem 273, 13861-13869
20.
Naim, H. Y., and Naim, H. (1996) Dimerization of lactase-phlorizin hydrolase
occurs in the endoplasmic reticulum, involves the putative membrane
spanning domain and is required for an efficient transport of the enzyme to the
cell surface. Eur J Cell Biol 70, 198-208
21.
Behrendt, M., Keiser, M., Hoch, M., and Naim, H. Y. (2009) Impaired trafficking
and subcellular localization of a mutant lactase associated with congenital
lactase deficiency. Gastroenterology 136, 2295-2303
22.
Simossis, V. A., and Heringa, J. (2005) PRALINE: a multiple sequence
alignment toolbox that integrates homology-extended and secondary structure
information. Nucleic Acids Res 33, W289-294
23.
Jacob, R., Weiner, J. R., Stadge, S., and Naim, H. Y. (2000) Additional Nglycosylation and its impact on the folding of intestinal lactase-phlorizin
hydrolase. J Biol Chem 275, 10630-10637
24.
Jacob, R., Bulleid, N. J., and Naim, H. Y. (1995) Folding of human intestinal
lactase-phlorizin hydrolase. J Biol Chem 270, 18678-18684
25.
Hsu, S. T., Fucini, P., Cabrita, L. D., Launay, H., Dobson, C. M., and
Christodoulou, J. (2007) Structure and dynamics of a ribosome-bound nascent
chain by NMR spectroscopy. Proc Natl Acad Sci U S A 104, 16516-16521
26.
Danielsen, E. M. (1990) Biosynthesis of intestinal microvillar proteins.
Dimerization
of
aminopeptidase
Biochemistry 29, 305-308
N
and
lactase-phlorizin
hydrolase.
46
Publications
Footnotes
This work was funded by the German Research Foundation (DFG) (SFB 621 to
HYN).
Abbreviations: PNGase F, Peptide -N-Glycosidase F; endo H, endoglycosidase H;
ER, endoplasmic reticulum; LPH, lactase-phlorizin hydrolase (all forms); LPHh,
mannose-rich precursor; LPHc, complex glycosylated precursor; TGN, trans-Golgi
network
Figure legends
Fig. 1: Schematic presentation of wild type and LPH deletion variants. A) Main
features of intestinal LPH structure. pro-LPH consists of a cleavable signal sequence
(SS; Met1-Gly19) and an extracellular region comprising homologous domains I–IV
(Ser20-Thr1882). The initial cleavage step takes place between Arg734 and Leu735
generating LPHβinitial; removal of the polypeptide stretch Leu735/Arg868 occurs by
luminal trypsin creating LPHβfinal. Cleavage sites are indicated by asterisks; location
of the phlorizin hydrolase (E1273) and lactase (E1749) activities, respectively, are
indicated by triangles. MA refers to the membrane anchor and Cyt refers to the
cytoplasmic tail.
Fig. 2: Glycosylation pattern and trafficking of LPH wild type and domain
deletion variants in COS-1 cells. A) Schematic representation of the domain
deletion variants generated by loop-out mutagenesis. B) Transiently transfected
COS-1 cells were biosynthetically labeled for 6 h, LPH was immunoprecipitated and
treated with/without endo H. Quantification of four independent experiments is
Publications
47
presented. C) Turnover of LPH variants determined by biosynthetic labelling of
transiently expressing COS-1 cells for 2 h (pulse) followed by chase time points as
indicated periods (in hours) with cold methionine.
Fig. 3: Subcellular distribution and cell surface localization of LPH wild type
and domain deletion variants in COS-1 cells. A) Indirect immunofluorescence for
transiently transfected COS-1 cells with permeabilization for intracellular staining or
without permeabilization for extracellular staining. B) COS-1 cells transiently
expressing
LPH
were
treated
with
biotin,
lysed
and
immunoprecipitated.
Immunoprecipitates were divided into two equal aliquots and used for LPH or
Streptavidin blotting.
Fig. 4: Structural features of LPH deletion variants in COS-1 cells. A) For
assessment of the quaternary structure of LPH, transiently transfected COS-1 cells
were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell
lysates were fractionated on a sucrose density gradient, immunoprecipitated and
analyzed by SDS-PAGE. For quantification the intensities of all bands of one gradient
were set as 100% and each band is diagrammed as a percentage value compared to
the total protein amount. B) Trypsin sensitivity assay of wild type and LPH variants
from
transiently
transfected
COS-1
cells
after
biosynthetic
labelling
and
immunoprecipitation. 100 BAEE units of trypsin were used for different time points.
Fig.5: Glycosylation pattern, structural features and subcellular distribution of
LPH wild type, LPHβinitial and LPHβfinal in COS-1 cells. A) Schematic presentation
of the LPHβfinal and LPHβinitial generated by loop-out mutagenesis. B) Transiently
transfected COS-1 cells were biosynthetically labeled for 6 h, immunoprecipitated
and resolved on SDS-PAGE. Intensities of mannose-rich and complex N- and Oglycosylated forms are calculated from three independent experiments. C) Turnover
48
Publications
of LPH variants determined by biosynthetic labelling of transiently expressing COS-1
cells for 2 h (pulse) followed by chase time points (in hours) as indicated with cold
methionine.
Fig. 6: Subcellular distribution and cell surface localization of LPHβ initial and
LPHβfinal in COS-1 cells. A) Indirect immunofluorescence for transiently transfected
COS-1 cells with permeabilization for intracellular staining or without permeabilization
for extracellular staining. B) COS-1 cells transiently expressing LPH were treated
with biotin, lysed and immunoprecipitated. Immunoprecipitates were divided into two
equal aliquots and used for LPH or Streptavidin blotting.
Fig. 7: Structural features of LPHβinitial and LPHβfinal in COS-1 cells. For
assessment of the quaternary structure of LPH, transiently transfected COS-1 cells
were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell
lysates were fractionated on a sucrose density gradient, immunoprecipitated and
analyzed by SDS-PAGE. For quantification, intensities of all bands of one gradient
were set as 100% and each band is diagrammed as a percentage value compared to
the total protein amount.
.
Fig. 8: Expression of LPH-D3 and LPH-D3stretch in COS-1 cells. A) Schematic
representation of the LPH-D3 and LPH-D3stretch constructs. B) COS-1 cells were
biosynthetically labeled for 6 h, proteins were immunoprecipitated from cell lysates
and - where indicated - from cell culture media, treated with endo H or PNGase F, or
not treated and analyzed by SDS-PAGE.
Fig. 9: Comparison of a potential calnexin binding motif within different
domains of LPH. A) Homology-extended multiple sequence alignment of domains II,
Publications
49
III and IV of LPH. The arrow shows the position of Asn821 in domain II and Asn1814
in domain IV of LPH. Asn1340 in domain III is indicated by an asterisk. B) To
determine the ratio of calnexin association with different LPH variants, COS-1 cells
transiently expressing LPH-WT, LPH∆2, LPHβinitial and LPHβfinal were lysed, LPH was
immunoprecipitated and subjected to anti-LPH and anti-Calnexin immunoblotting.
The ratio of calnexin association with each variant was rated by the amount of coimmunoprecipitated calnexin versus the mannose-rich glycosylated ER form of LPH.
Quantification is presented from three independent experiments. C) Calnexin
associated with LPH-N821Q, LPH-N1340Q and LPH-N1814Q was similarly detected.
As a control untransfected COS-1 cells were used. The ratio of calnexin association
with each mutant was rated by the amount of co-immunoprecipitated calnexin versus
the mannose-rich glycosylated ER form of LPH. Quantification is presented from four
independent experiments.
Fig. 10: Proposed model for the folding events of nascent LPH. In the ER,
partially folded LPH is interacting with calnexin/calreticulin chaperone system at
domains II and IV. This interaction promotes functional folding of the whole protein
which can then be arranged in a dimeric conformation mediated by regions in
cytoplasmic and transmembrane sections as well as domains II and IV. The dimeric
structure will then leave the ER to the Golgi apparatus.
50
Publications
Tables
Table I. A list of the wild type and variant constructs used in this study
Protein
Plasmid for
biochemical/
Oligonucleotides 5’-3’
confocal analysis
LPH-WT
pcDNA3-LPH
(Behrendt et al.,
2010)
-
LPHΔ1
pΔ1
ctaagtttttcatgctgggggttcctgcaggatactttccctg*
LPHΔ2
pΔ2
gtccagggcggaaagggatgccttctaccacgggacgtttcgg*
LPHβfinal
pJB20-LPHβfinal
(Jacob et al.,
2002)
-
LPHβinitial
pLPHβinitial
gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*
LPH-D3
pD3 (Behrendt et
al., 2010)
-
LPHD3stretch
pDomain-3stretch
gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*
LPH-D123
pDomain-123
gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*
LPH-D1234 pDomain-1234
ggcaccacagaagcacagacatgaattcgctttgtacgttctcttttctc*
LPH-D23
gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*
pDomain-23
*Forward mutagenesis primer. The reverse primer is the complementary sequence of the
forward primer.
Publications
Figures
Figure 1
Figure 2A
Figure 2B
51
52
Publications
relative protein amount %
100
80
60
complex
mannose-rich
40
20
0
LPH-WT
Figure 2C
LPH∆1
LPH∆2
Publications
Figure 3A
Figure 3B
53
54
Figure 4A
Publications
Publications
55
LPH-WT
percentage %
20
15
mannose-rich
10
complex-glycosylated
5
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
fractions
percentage %
LPH∆1
30
25
20
15
10
5
0
mannose-rich
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
fractions
percentage %
LPH∆2
30
25
20
15
10
5
0
mannose-rich
complex glycosylated
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
fractions
56
Figure 4B
Publications
Publications
Figure 5A
Figure 5B
57
58
Publications
relative protein amount %
100
80
60
complex
mannose-rich
40
20
0
LPH-WT
Figure 5C
LPHβinital
LPHβfinal
Publications
Figure 6A
Figure 6B
59
60
Publications
Figure 7A
LPHβinitial
percentage %
25
20
15
mannose-rich
10
5
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
fractions
LPHβfinal
percentage %
15
mannose-rich
10
complex glycosylated
5
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
fractions
Publications
Figure 8A
Figure 8B
61
62
Publications
Figure 9A
*
*
Figure 9B
Publications
Figure 9C
63
64
Publications
Publications
Figure 10
65
66
Discussion
Discussion
Difficulties in the diagnosis and possible molecular causes of the low lactase
activity in CLD patients
Congenital lactase deficiency is an autosomal recessive inherited disease of infants.
The patients suffer from severe gastrointestinal symptoms, due to the lack of lactase
activity (0-10 U/g) shortly after breast-feeding or the introduction of lactose-containing
formulas (Holzel, 1968; Savilahti et al., 1983). Un- or misdiagnosis of CLD is lifethreatening, because the osmotic diarrhea leads to dehydration, acidosis and weight
loss after a few weeks of life. However, duodenal biopsies could show that the
histological characteristics such as microvilli morphology and the activities of the
other disaccharidases, SI and MGAM, are totally normal (Savilahti et al., 1983). After
correctly diagnosis, infants get a lactose-free diet and the children are able to follow
their normal developmental processes (Launiala et al., 1966; Savilahti et al., 1983).
One possible disease that might be associated with CLD is nephrocalcinosis, which
is characterized by elevated calcium concentrations in the blood and low excretion
with urine (Saarela et al., 1995; Fazeli et al., 2015). After the correction of
dehydration and beginning of lactose-free diet it takes months until the problems fully
disappear.
The diagnosis of CLD is difficult, because the gastrointestinal symptoms in infants
can have other causes. Different bacterial infections of the gastrointestinal tract can
cause similar symptoms or the infection with rotavirus or adenovirus. Such
gastrointestinal symptoms can also be caused by cow’s milk protein allergy or by
congenital diarrheal disorders.
There are several congenital diarrheal disorders that manifest in the first few weeks
of life with chronic diarrhea after ingestion. The etiology of these disorders is diverse
including dysregulation of the intestinal immune response, defects in the
enteroendocrine cells or in the predominant intestinal epithelial cells, the enterocytes
(Canani et al., 2015). Examples for the last type are the microvillus inclusion disease,
Discussion
67
congenital tufting enteropathy, familial hemophagocytic lymphohistiocytosis type 5
and trichohepatoenteric syndrome (Muller et al., 2008; Sivagnanam et al., 2008; zur
Stadt et al., 2009; Hartley et al., 2010; Fabre et al., 2012; Wiegerinck et al., 2014).
Those congenital diarrheal disorders are caused by autosomal recessive mutations
in genes of the brush-border enzymes, like LPH or SI in case of CLD/CSID (Ritz et
al., 2003; Kuokkanen et al., 2006) or in genes of transporter proteins, like SLGT1 that
encodes the Na+/glucose cotransporter, which is responsible for the uptake of the
monosaccharides glucose and galactose (Martin et al., 1996). Other mutations
causing congenital diarrhea lead to defects in the intracellular protein or lipid
transport, the lipid metabolism and intestinal barrier function (Overeem et al., 2016).
The identification of these mutations, which are all autosomal recessive inherited, is
important for genetic counseling and prenatal diagnosis for heterozygote carriers.
Most of the diseases causing congenital diarrhea are diagnosed by an intestinal
biopsy to determine the histological characteristics and the enzymatic activities of the
brush border membrane disaccharidases. Such a surgery is an invasive event for an
infant, who suffers from severe gastrointestinal symptoms. Therefore the
identification of genetic defects by sequencing assays is a better and faster
differential diagnostic tool, because the result of the genetic test describes the basic
defect and excludes secondary effects. This test should be used generously in
suspected cases by gastroenterologists, neonatologists and pediatricians. Basic
research is needed to identify further mutations which are associated with the
development of congenital diarrheal disorders.
The origin of CLD is most likely in Finland, because until now 7 out of the 13 known
mutations causing CLD were detected in Finnish patients (Kuokkanen et al., 2006;
Torniainen et al., 2009) and Finland has the highest incidence of CLD with 1:60000
(Peltonen et al., 1999; Norio, 2003; Norio, 2003). In the last few years also cases of
CLD have been reported somewhere else in the world (Uchida et al., 2012; Sala
Coromina et al., 2014; Fazeli et al., 2015), indicating that CLD is not only a Finnish
disease, despite it is one of the rare monogenic disorders, which are enriched in the
Finnish population (Peltonen et al., 1999). Besides CLD, there is another lactase
68
Discussion
deficiency, called adult-type of hypolactasia (ATH), which is also a recessively
inherited disorder and is related to DNA variants affecting the LCT gene. The
molecular mechanisms are very different. CLD is caused by mutations in the LCT
gene, which lead to low activity. One possible explanation for the low or absent
lactase activity is the effect of the mutation on the protein itself by e.g. resulting in
misfolded protein that is ultimately degraded. Another explanation is the nonsensemediated mRNA decay (NMD), a surveillance pathway leading to degradation of
mRNA, induced by premature termination codons, to eliminate the production of
harmful truncated proteins (Maquat, 2005). Previous studies could show that the
NMD modulates human disease phenotypes (Baserga and Benz, 1988; Frischmeyer
and Dietz, 1999; Inoue et al., 2004; Gorbenko del Blanco et al., 2012). In contrast the
molecular mechanism of ATH phenotype is caused by nucleotide variants
representing distal enhancer polymorphisms, which down-regulate developmentally
the transcript levels of the LCT gene. One known polymorphism leading to the
developmental down-regulation of lactase levels is C/T−13910 (Enattah et al., 2002;
Rasinpera et al., 2005). The C−13910 allele typically accounts for 8% of expressed LCT
mRNA (Kuokkanen et al., 2003). Interestingly, one study could show in a duodenal
biopsy from a patient, who was heterozygous for the CLD nonsense mutation
Y1390X and also heterozygous for the ATH SNP C−13910, that both alleles had the
same levels of LCT transcripts (Kuokkanen et al., 2003), confirming the idea that
mRNA, induced by premature termination codons, leads to NMD. This discovery
facilitates a direct genetic test as the best diagnosis of suspected CLD patients.
Previously the diagnosis based on the symptoms and low lactase activity in enzyme
assays from duodenal biopsies.
Identification and molecular analysis of two novel mutations of the LCT gene
causing CLD
The two novel mutations in the LCT gene c.4419C>G (p.Y1473X) in exon 10
transmitted from the mother and c.5387delA (p.D1796fs) in exon 16 transmitted from
Discussion
69
the father were found in a Japanese female infant. Both mutations are located in
domain IV of the extracellular domain of LPH and result in a truncation of domain IV
and complete elimination of the transmembrane domain and the cytosolic tail. The
girl suffered from severe watery diarrhea from the age of two days on breast feeding
and lactose containing cow´s milk formula and lost 13% of her birth weight during two
days. After the implementation of a lactose-free diet, the diarrhea stopped and her
overall condition improved remarkably. At the age of 4 month a lactose challenge test
was performed. The blood glucose level showed no increase during 120 min,
indicating that the suspected CLD could be confirmed (Uchida et al., 2012).
The biochemical analysis of the two mutations in the LCT gene discovered two
mutated proteins, which are blocked in the ER. Determination of the type of Nglycosylation indicated that both mutants are mannose-rich N-glycosylated and
exclusively
endo
H-sensitive.
The
cellular
localization
was
confirmed
by
immunofluorescent analysis. Both mutants are predominantly localized in the ER as
assessed by the ER net-like structures. Further, it could be proven that the mutated
proteins are enzymatically inactive, despite of the presence of the lactase activity site
in the mutant LPH-D1796fs and both are degraded in the ER, probably due to the
ERAD pathway. These results support the view that the lack of lactase activity in
CLD patients is due to the effect of the mutation of the protein itself and disagree with
the opinion that NMD is responsible for the absent lactase activity. Previous studies
suggested that the mutation Finmajor (Y1390X) induces NMD and lead thereby to a
decrease of ~90% of the transcript levels of LCT (Kuokkanen et al., 2006). It is
known that intron-less cDNA normally used in in vitro systems is insensitive to NMD
(Gorbenko del Blanco et al., 2012), therefore biopsy samples from patients would be
needed to clarify the role of NMD in the pathogenesis of CLD. Recently, one study
could prove NMD as a mechanism for protein C deficiency caused by two nonsense
mutations (Luan et al., 2015). Surprisingly, they used recombinant plasmids
expressing the cDNA of the mutant or wild type protein in a transient transfection
system. The increased mRNA levels of the mutants after treatment with UPF1 siRNA,
70
Discussion
which should inhibit NMD, lead to the conclusion that NMD is involved in this
process. These results disagree with previous findings that intron-less cDNA
normally used in in vitro systems is insensitive to NMD (Gorbenko del Blanco et al.,
2012). The biochemical results of the two mutants LPH-Y1473X and LPH-D1796fs
show that the transcriptional products are detectable by immunoprecipitation.
Fluctuations might be possible due to the different binding affinities of the proteins to
the monoclonal antibodies or the utilized transient transfection method. The pulse
chase experiment clearly indicates that the mutants are ultimately degraded in the
ER mostly within the first 4 h of chase, while the wild type is still detectable after 12 h
of chase. The intensity of the fluorescent signal 48 h post transfection confirm that
the mutant proteins have similar protein levels within the cell compared to the wild
type. To definitely prove the hypothesis that the protein levels of the mutants and the
wild type are comparable, it would need the generation of stable cell lines to avoid
the overexpression system in COS-1 cells. One possible experiment to clarify if
degradation takes place via the ERAD pathway would be the usage of a proteasomal
inhibitor.
The results of the biochemical analysis of the two mutants are similar to a previous
study, which analyzed the mutation G1363S that was found in two cases of CLD with
Finnish and Turkish origin (Kuokkanen et al., 2006; Torniainen et al., 2009). This
mutation results also in an ER-blocked and mannose-rich N-glycosylated protein,
which has no detectable lactase activity (Behrendt et al., 2009). The LPH-G1363S
mutant is a temperature-sensitive protein, which exits the ER to the Golgi apparatus
by lowering the temperature to 20°C (Behrendt et al., 2009). This effect could be
detected in several protein folding diseases that are caused by mutations in the
respective proteins (Cheng et al., 1990; Propsting et al., 2003). The mutants LPHY1473X and LPH-D1796fs are also blocked in the ER by 20°C, which usually leads
to a accumulation of the proteins in the Golgi apparatus (Mottet et al., 1986).
Interestingly, the protein amounts of the mutated proteins are detectable after 18 h of
Discussion
71
chase. This result can be a result of improved folding of the mutants in the ER via
chaperones or due to a reduced degradation ratio at lower temperatures.
In general, it is strikingly that 9 out of 13 known mutations in the LCT gene causing
CLD are either frameshift- or nonsense-mutations, which introduce a premature
truncation of the protein (Table 2). Taken together with the results of the biochemical
analysis of the mutation Y1390X, it can be hypothesized that premature truncation of
LPH leads to a mannose-rich N-glycosylated protein that is enzymatically inactive. A
previous study could define the presence of the transmembrane domain as a crucial
criterion for the
maturation
of
LPH. While
the
construct containing the
transmembrane domain was normally glycosylated and transported along the
secretory pathway, its anchorless counterpart was blocked in the ER as a monomeric
mannose-rich N-glycosylated protein (Panzer et al., 1998). Not only mutations in the
lactase gene lead to gastrointestinal disorders by disrupting the normal trafficking
and function of an enzyme of the brush border membrane. CLD belongs to the
congenital diarrheal disorders, a group of enteropathies with a typical onset early in
life and with similar gastrointestinal symptoms, often caused by autosomal recessive
mutations. Besides the brush border membrane enzymes, transporter proteins,
proteins which are important for protein or lipid transport, lipid metabolism or
intestinal barrier function can be affected (Overeem et al., 2016). Among the brush
border membrane enzymes, sucrase-isomaltase (SI) and maltase-glucoamylase
(MGAM) are well-characterized proteins that are associated to congenital sucraseisomaltase deficiency and congenital maltase-glucoamylase deficiency, respectively
(Terrin et al., 2012). Pathogenic mutations causing CSID have been analyzed in
more detail and one of the identified phenotypes, phenotype 1, also lead to a
retention of SI in the ER (Naim et al., 2012). These results are in line with the
biochemical results for the mutants LPH-Y1473X and LPH-D1796fs.
The final experimental setup for the complete biochemical analysis was the
investigation of the potential effects of the pathogenic mutants LPH-Y1473X and
LPH-D1796fs on the function of the wild type LPH in a heterozygote background,
72
Discussion
mimicking the situation in the parents of the compound heterozygous CLD patient.
The above mentioned study only obtained a monomeric mannose-rich Nglycosylated protein in case of anchorless expressed protein (Panzer et al., 1998).
The question is whether the fulfillment of minimal folding requirements, such as
correct folding of the domains, which are important for dimerization, is sufficient for
the formation of heterodimers. The dimerization step of LPH takes place in the ER
and it is known that the presence of the transmembrane domain and the stretch
region of 87 amino acids in the ectodomain between position 1646 and position 1559
in domain IV are required for the formation of homodimers (Danielsen, 1990; Naim
and Naim, 1996; Panzer et al., 1998). The mutant LPH-Y1473X does not contain any
of these criteria, but the mutant LPH-D1786fs includes the stretch region in domain
IV. The results of the co-immunoprecipitation experiments offered that neither the
mutant LPH-Y1473X nor the mutant LPH-D1796fs interact with the wild type in a cotransfection setup. The enzymatic activity of the wild type does not differ in the single
or the co-transfected samples indicating that no interaction has taken place and that
the wild type retains unaffected also in the presence of the pathogenic mutants.
These data support the hypothesis that dimerization only happens if both criteria are
fulfilled or at least that those criteria play an important role in the process of
heterodimerization. To further prove if heterodimerization per se is possible, the
mutant form should contain the transmembrane domain and the stretch region in
domain IV. Adequate candidates for this experiment would be e.g. the LPH-G1363S,
LPH-R1587H or LPH-Q268H mutant. Figure 4 summaries the knowledge about
heterodimerization of LPH wild type and a mutant form. The criteria for
homodimerization (Figure 4A) will be taken under closer consideration in the next
paragraph of the discussion.
Discussion
73
Figure 4: Potential requirements for heterodimerization of LPH wild type with a
pathogenic mutant. A) LPH normally forms homodimers in the ER before the further
transport along the secretory pathway to the Golgi apparatus. Mutant forms of LPH (orange
circles), which are anchorless due to the missing transmembrane domain and with B) the
lacking or C) consisting the stretch region in domain IV (light blue balk). Possible
heterodimers of the wild type LPH (blue circles) and mutated forms of LPH build of the full
length pro-LPH D) only missing the stretch region in domain IV or E) consisting both the
transmembrane region and the stretch region in domain IV.
The potential heterodimerization could lead to protein complexes with altered
functional or trafficking characteristics of either one of them and could thereby
explain the wide range of normal enzymatic activity levels. Previous studies have
shown that the maximum levels of enzymatic activities of the disaccharidases in the
intestine are often two-fold higher than the minimal recognized normal levels (Alfalah
et al., 2009; Naim et al., 2012). A recent study identified an intermediate
physiological phenotype of lactose intolerance caused by nucleotide variants
influencing the transcript levels of the LCT gene, which may explain the range of
normal lactase activity (Dzialanski et al., 2015). This intermediate physiological
phenotype is caused by the heterozygous state CT −13910, while the homozygotes
either lead to lactose intolerance in case of CC−13910 or to lactose tolerance in case of
74
Discussion
TT−13910 (Dzialanski et al., 2015) Those heterodimeric interactions have been
described already for many proteins, such as connexin, G-protein-coupled receptors
or GABA receptors (Doms et al., 1987; Jordan and Devi, 1999; Maza et al., 2003). In
case LPH would exclusively forms homodimers in the presence of other pathogenic
mutations, which fulfill the known requirements for dimerization, this could be one
possible explanation why heterozygous carriers of one mutation underlying CLD are
symptom-free and show normal lactase activity levels. Another possible theory why
heterozygous carriers of certain diseases are symptom-free is a translation-coupled
mechanism (NMD) that eliminates mRNA containing premature termination codons
and thus limiting the synthesis of abnormal proteins (Palacios, 2013). NMD accounts
for genotypic/phenotypic differences and has a protective function, which sometimes
benefits for heterozygous carriers. Recently, a group could show that the phenotypic
variability in heterozygous carriers of mutations causing growth hormone insensitivity
syndrome (GHIS) is moderated by NMD (Gorbenko del Blanco et al., 2012).
Characterization and implication of the subdomains of LPH, a multi-domain
protein, on its function and folding
Proteins have to fulfill a wide spectrum of functions, ranging from binding molecules
(from simple ions to large molecules like fats, sugars, nucleic acids and other
proteins) to catalyzing an extraordinary range of chemical reactions, providing
structural rigidity to the cell, controlling flow of material through membranes,
regulating the concentrations of metabolites, acting as sensors and switches, causing
motion and controlling gene function (Lodish H, 2000). The three-dimensional
structures of proteins have been identified to play a crucial role for these functions
and their precise control. The spatial organization is a key player in the
understanding of protein structure and functioning.
Proteins are constructed from only 20 different amino acids, which form single,
unbranched polypeptide chains. Their unique spatial confirmation arises from
Discussion
75
noncovalent interactions between regions in the linear amino acid sequence. Only
correctly folded proteins are able to fulfill their physiological functions. Besides the
class of cell signaling and ligand binding, proteins may act as structural elements or
enzymes by catalyzing chemical reactions.
In general, the International Union of Biochemistry and Molecular Biology (IUBMB)
has developed a nomenclature for enzymes, containing oxireductases (EC 1),
transferases (EC 2), hydrolases (EC 3), lysases (EC 4), isomerases (EC 5) and
ligases (EC 6). One class of hydrolases, the glycoside hydrolases (GHs, EC 3.2.1)
are a widespread group of enzymes that hydrolase glycosidic linkages between two
or more carbohydrates. LPH is grouped with other β-galactosidases in a few families
of GHs, which are responsible for the hydrolysis of terminal non-reducing β-Dgalactose residues in β-D-galactosides (Henrissat and Davies, 2000). Human
lactase-phlorizin hydrolase belongs to the protein family GH 1. While most members
of the GH 1 family consist of only a single domain, LPH is synthesized in the ER as a
multi-domain pro-LPH (Naim et al., 1991). While the three-dimensional structure for
many members of the GH 1 family is identified, the one for LPH is still undiscovered.
The first three-dimensional structure solved for the GH 1 family is those of a
cyanogenic β-glucosidase from the white clover (Trifolium repens), a single-domain
protein (Barrett et al., 1995). The actual advanced method using NMR spectroscopy
for determining membrane protein structures, has the limitation that only small
soluble proteins can be analysed (Hong, 2006). For large multi-domain membrane
proteins electron crystallography represents the best approach to understand
membrane protein structures in the context of a lipid bilayer (Ubarretxena-Belandia
and Stokes, 2010). Another approach for extraction and purification of functional
protein is the X-ray crystallization, which was used to solve the first crystal structures
of mammalian proteins e.g. the rabbit Ca2+-ATPase SERCA1a (Jidenko et al., 2005)
and the rat voltage-dependent potassium ion channel Kv1.2 (Long et al., 2005).
Nevertheless, all these methods cannot display the structural changes during the
biosynthesis of the protein and therefore it is important to use other approaches as
well.
76
Discussion
During its transport along the secretory pathway, LPH is post-translationally modified
by N- and O-glycosylation, it dimerizes in the ER, is proteolytically cleaved in the
Golgi apparatus and at the apical membrane (Naim and Lentze, 1992; Jacob et al.,
1996; Wuthrich et al., 1996). The mature LPH consists only of domain III and domain
IV of the extracellular domain, which comprise the phlorizin hydrolase activity and the
lactase activity, respectively (Zecca et al., 1998). Domains I and II are defined as the
profragment LPHα, which acts as an intramolecular chaperone for the rest of the
protein (Jacob et al., 2002). Domain III also fulfills an intramolecular chaperone
function (Behrendt et al., 2010).
Previous studies could give first insights into the intramolecular organization of LPH.
The membrane anchor and the 87 amino acid long sequence in domain IV are crucial
for the attainment of a transport-competent homodimer in the ER (Naim and Naim,
1996; Panzer et al., 1998). Further studies identified the function of each domain of
the extracellular domain by utilizing deletion mutants of each domain. The deletion of
domain IV, which contains the lactase activity site, leads to the formation of a
transport-competent, correctly folded protein, which fails to dimerize in the ER and
reveals slightly reduced phlorizin hydrolase activity. In contrast, the deletion of
domain III, which harbors the phlorizin hydrolase activity site, results in a mannoserich N-glycosylated misfolded monomeric protein with absent lactase activity.
Interestingly, the same study disclosed that domain III alone expressed is transportcompetent per se, despite it neither dimerizes nor acquires complete phlorizin
hydrolase activity (Behrendt et al., 2010), indicating that dimerization is not, as
previously described (Naim and Naim, 1996), essential for transport competence and
acquisition of enzymatic activity. These data revealed an intramolecular chaperone
function of domain III besides the profragment LPHα (Naim et al., 1994). LPHα,
consisting of domain I and part of domain II, is proteolytically cleaved off during the
first cleavage step in the Golgi apparatus before LPH is further transported to the
apical membrane where it is finally cleaved to the mature form (Wuthrich et al.,
1996). These cleavage steps are not essential for the acquisition of an enzymatically
active molecule, because expressed pro-LPH in COS-1 cells does not undergo
Discussion
77
intramolecular proteolytic cleavage, but is enzymatic as active as the isolated LPH
from the brush border membrane (Naim et al., 1991).
The role of each domain of the profragment LPHα on the function of LPH was
determined by utilizing again deletion mutants. Deletion of domain II leads to a
transport-competent protein, which fails to dimerize in the ER and its enzymatic
activities are substantially reduced. On the other hand, the deletion of domain I
results in a mannose-rich N-glycosylated misfolded monomeric molecule, which is
enzymatically inactive (Behrendt, 2010). These results underline the hypothesis that
LPH might have arisen from two subsequent duplications (Wacker et al., 1992),
because the function of domain I is similar to that of domain III by acting as an
intramolecular chaperone and their deletion lead to a malfolded protein, which is
blocked in the ER and degraded. Comparably, domain II and domain IV are not
essential for the acquisition of transport competence or the correct folding of LPH,
but influencing partially the dimerization step in the ER.
A previous study could detect an 87 amino acid long sequence in domain IV to be
essential for the dimerization step in the ER in addition to the presence of the
transmembrane domain (Naim and Naim, 1996; Panzer et al., 1998). Interestingly,
domain II also contains a stretch region of 134 amino acids in its C-terminal region,
which distinguishes LPHβinitial from LPHβfinal. The intramolecular role of these
stretches is conflictive. The presence of the stretch in domain IV leads to transport
competence and dimerization of LPH in the ER (Panzer et al., 1998), while the
stretch in domain II leads to a retention of the protein in the ER as a monomer even if
it is linked to the autonomous domain III (Behrendt et al., 2010). The data presented
here assign that the presence of the stretch in domain II, either in LPH∆1 or in
LPHβinitial, results in a failure of the protein to dimerize in the ER, while its deletion in
LPHβfinal leads to the formation of oligomeric structures, which are probably build later
along the secretory pathway in the Golgi apparatus. The formation of higher
oligomeric structures like tetramers is confirmed by a cell surface biotinylation
experiment, which shows a band for LPHβfinal with a definitely higher molecular
weight compared to the wild type. One possible explanation of the ER retention of
78
Discussion
LPHβinitial is the misfolding of the protein due to the missing domain I. Domain I is
normally responsible for the correct folding of the protein and especially of domain II,
because LPHβfinal is transport competent without domain I and domain II.
Closer sequence analysis of this stretch region offered a unique N-glycosylation site
at position Asn821, which could be responsible for the retention of LPH in the ER by
interacting with an ER-resident chaperone. Notably, a similar N-glycosylation site
was also found in domain IV at position Asn1814. The ER-resident chaperone BiP has
been identified to interact with LPH and thereby to improve the folding of LPH (Jacob
et al., 1995). To prove if the different LPH variants also interact with calnexin, a coimmunoprecipitation experiment was performed, because the mono-glycosylated Nglycans at the above mentioned N-glycosylation sites may serve as sites for the
association with calnexin. Interestingly, the constructs containing the stretch region in
domain II, like LPH wild type or LPHβinitial, show increased association with calnexin
compared to those constructs lacking the stretch like LPH∆2 or LPHβfinal. The fact
that both, LPH wild type or LPHβinitial, interact more intensive with the ER chaperone,
but LPH wild type is completely transport-competent, while LPHβinitial is mannose-rich
N-glycosylated and degraded in the ER. These results confirm the hypothesis that
domain I is required for the folding of domain II and due to its absence in LPHβinitial
the protein is misfolded and thereby degraded during the ERAD pathway. Possibly,
the wild type is able to mask this interaction site with calnexin by its correct folding
and the formation of homodimers, while LPHβinitial remains as a monomer. The
distinct role of individual N-linked glycans in CNX/CRT binding and in co- and posttranslational folding was also established in a previous study using influenza virus
hemagglutinin as a model protein (Hebert et al., 1997).
Conclusion
79
Conclusion
To sum up: I) Domain I and domain III of the extracellular domain of LPH act as
intramolecular chaperones, while domain II and domain IV are not essential for the
transport competence. II) LPH interacts with calnexin due to its possible Nglycosylation sites in domain II and domain IV. III) The transmembrane domain,
domain II and the stretch region in domain IV are essential for the homodimerization
of LPH in the ER (Naim and Naim, 1996; Panzer et al., 1998). IV) The
homodimerization of LPH in the ER is required for the acquisition of enzymatic
lactase activity (Naim and Naim, 1996), but not for the attainment of transport
competence.
All of these structural requirements, which need to be fulfilled to obtain a transportcompetent and functional protein, are important in regard to the complete
understanding of the development of severe pathogenic mutations in the gene of
LPH causing CLD. The best experimental setup would be either protein
crystallization or the use of 3D protein structure prediction tools to unravel the spatial
confirmation of LPH to determine the influence of specific mutations. The results from
this dissertation give insights into the function of each single domain and the situation
in heterozygote carriers. The first part of this dissertation analyzed two pathogenic
mutants in the coding region of LPH causing CLD. Both are located in domain IV of
the extracellular domain of LPH, resulting in a premature truncation of LPH. Those
anchorless mutants do not interact with the wild type and thereby leading to the
formation of full functional wild type homodimers in a co-transfection setup. The
presence of the transmembrane domain seems to be one requirement for the
formation of heterodimers. The presence of the stretch in domain IV, which is
necessary for homodimerization, has to be taken under closer consideration for the
formation of heterodimers. The second part of this dissertation detected the stretch
region in domain II of the extracellular domain of LPH as an important structural
element and showed that LPH interacts due to possible N-glycosylation site in this
stretch region with calnexin.
80
References
References
Aikawa J., Matsuo I.,Ito Y. (2012). "In vitro mannose trimming property of human ER
alpha-1,2 mannosidase I." Glycoconj J 29(1): 35-45.
Alfalah M., Jacob R., Preuss U., Zimmer K.P., Naim H.,Naim H.Y. (1999). "O-linked
glycans mediate apical sorting of human intestinal sucrase-isomaltase through
association with lipid rafts." Curr Biol 9(11): 593-6.
Alfalah M., Keiser M., Leeb T., Zimmer K.P.,Naim H.Y. (2009). "Compound
heterozygous mutations affect protein folding and function in patients with
congenital sucrase-isomaltase deficiency." Gastroenterology 136(3): 883-92.
Almeida C.C., Lorena S.L., Pavan C.R., Akasaka H.M.,Mesquita M.A. (2012).
"Beneficial effects of long-term consumption of a probiotic combination of
Lactobacillus casei Shirota and Bifidobacterium breve Yakult may persist after
suspension of therapy in lactose-intolerant patients." Nutr Clin Pract 27(2):
247-51.
Amiri M., Diekmann L., von Kockritz-Blickwede M.,Naim H.Y. (2015). "The Diverse
Forms of Lactose Intolerance and the Putative Linkage to Several Cancers."
Nutrients 7(9): 7209-30.
Antonowicz I.,Lebenthal E. (1977). "Developmental pattern of small intestinal
enterokinase and disaccharidase activities in the human fetus."
Gastroenterology 72(6): 1299-303.
Apweiler R., Hermjakob H.,Sharon N. (1999). "On the frequency of protein
glycosylation, as deduced from analysis of the SWISS-PROT database."
Biochim Biophys Acta 1473(1): 4-8.
Arola H. (1994). "Diagnosis of hypolactasia and lactose malabsorption." Scand J
Gastroenterol Suppl 202: 26-35.
References
81
Arvan P., Zhao X., Ramos-Castaneda J.,Chang A. (2002). "Secretory pathway
quality control operating in Golgi, plasmalemmal, and endosomal systems."
Traffic 3(11): 771-80.
Asp N.G., Dahlqvist A., Kuitunen P., Launiala K.,Visakorpi J.K. (1973). "Complete
deficiency of brush-border lactase in congenital lactose malabsorption."
Lancet 2(7824): 329-30.
Avezov E., Frenkel Z., Ehrlich M., Herscovics A.,Lederkremer G.Z. (2008).
"Endoplasmic reticulum (ER) mannosidase I is compartmentalized and
required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ERassociated degradation." Mol Biol Cell 19(1): 216-25.
Balmana M., Gimenez E., Puerta A. et al (2016). "Increased alpha1-3 fucosylation of
alpha-1-acid glycoprotein (AGP) in pancreatic cancer." J Proteomics 132: 14454.
Barrett T., Suresh C.G., Tolley S.P., Dodson E.J.,Hughes M.A. (1995). "The crystal
structure of a cyanogenic beta-glucosidase from white clover, a family 1
glycosyl hydrolase." Structure 3(9): 951-60.
Baserga S.J.,Benz E.J., Jr. (1988). "Nonsense mutations in the human beta-globin
gene affect mRNA metabolism." Proc Natl Acad Sci U S A 85(7): 2056-60.
Behrendt M. (2010). "Characterization of natural and artificial mutants of human
intestinal lactase phlorizin hydrolase." Gottfried Wilhelm Leibniz Universität
Hannover.
Behrendt M., Keiser M., Hoch M.,Naim H.Y. (2009). "Impaired trafficking and
subcellular localization of a mutant lactase associated with congenital lactase
deficiency." Gastroenterology 136(7): 2295-303.
Behrendt M., Polaina J.,Naim H.Y. (2010). "Structural hierarchy of regulatory
elements in the folding and transport of an intestinal multidomain protein." J
Biol Chem 285(6): 4143-52.
82
References
Berg N.O., Dahlqvist A., Lindberg T.,Studnitz W. (1969). "Severe familial lactose
intolerance--a gastrogen disorder?" Acta Paediatr Scand 58(5): 525-7.
Boll W., Wagner P.,Mantei N. (1991). "Structure of the chromosomal gene and
cDNAs coding for lactase-phlorizin hydrolase in humans with adult-type
hypolactasia or persistence of lactase." Am J Hum Genet 48(5): 889-902.
Boukamel R.,Freund J.N. (1992). "The rat LPH gene 5' region: comparative structure
with the human gene." DNA Seq 3(2): 119-21.
Braakman I.,Hebert D.N. (2013). "Protein folding in the endoplasmic reticulum." Cold
Spring Harb Perspect Biol 5(5): a013201.
Briant K., Koay Y.H., Otsuka Y.,Swanton E. (2015). "ERAD of proteins containing
aberrant transmembrane domains requires ubiquitylation of cytoplasmic lysine
residues." J Cell Sci 128(22): 4112-25.
Brockhausen I., Schachter H.,Stanley P. (2009). O-GalNAc Glycans. Essentials of
Glycobiology. A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor
Laboratory Press.
Brown D.A.,Rose J.K. (1992). "Sorting of GPI-anchored proteins to glycolipidenriched membrane subdomains during transport to the apical cell surface."
Cell 68(3): 533-44.
Brussow H. (2013). "Nutrition, population growth and disease: a short history of
lactose." Environ Microbiol 15(8): 2154-61.
Bukau B., Weissman J.,Horwich A. (2006). "Molecular chaperones and protein
quality control." Cell 125(3): 443-51.
Bull C., Boltje T.J., Wassink M. et al (2013). "Targeting aberrant sialylation in cancer
cells using a fluorinated sialic acid analog impairs adhesion, migration, and in
vivo tumor growth." Mol Cancer Ther 12(10): 1935-46.
References
83
Caballero B., Solomons N.W.,Torun B. (1983). "Fecal reducing substances and
breath hydrogen excretion as indicators of carbohydrate malabsorption." J
Pediatr Gastroenterol Nutr 2(3): 487-90.
Canani R.B., Castaldo G., Bacchetta R., Martin M.G.,Goulet O. (2015). "Congenital
diarrhoeal disorders: advances in this evolving web of inherited
enteropathies." Nat Rev Gastroenterol Hepatol 12(5): 293-302.
Carvalho P., Goder V.,Rapoport T.A. (2006). "Distinct ubiquitin-ligase complexes
define convergent pathways for the degradation of ER proteins." Cell 126(2):
361-73.
Cederlund A., Kai-Larsen Y., Printz G. et al (2013). "Lactose in human breast milk an
inducer of innate immunity with implications for a role in intestinal
homeostasis." PLoS One 8(1): e53876.
Cheng S.H., Gregory R.J., Marshall J. et al (1990). "Defective intracellular transport
and processing of CFTR is the molecular basis of most cystic fibrosis." Cell
63(4): 827-34.
Christianson J.C.,Ye Y. (2014). "Cleaning up in the endoplasmic reticulum: ubiquitin
in charge." Nat Struct Mol Biol 21(4): 325-35.
Coelho M., Sequeira F., Luiselli D., Beleza S.,Rocha J. (2009). "On the edge of
Bantu expansions: mtDNA, Y chromosome and lactase persistence genetic
variation in southwestern Angola." BMC Evol Biol 9: 80.
Cox J.S., Shamu C.E.,Walter P. (1993). "Transcriptional induction of genes encoding
endoplasmic reticulum resident proteins requires a transmembrane protein
kinase." Cell 73(6): 1197-206.
Danielsen E.M. (1990). "Biosynthesis of intestinal microvillar proteins. Dimerization of
aminopeptidase N and lactase-phlorizin hydrolase." Biochemistry 29(1): 305-8.
84
References
Danielsen E.M. (1995). "Involvement of detergent-insoluble complexes in the
intracellular transport of intestinal brush border enzymes." Biochemistry 34(5):
1596-605.
Danielsen E.M., Skovbjerg H., Noren O.,Sjostrom H. (1984). "Biosynthesis of
intestinal microvillar proteins. Intracellular processing of lactase-phlorizin
hydrolase." Biochem Biophys Res Commun 122(1): 82-90.
Day A.J., Canada F.J., Diaz J.C. et al (2000). "Dietary flavonoid and isoflavone
glycosides are hydrolysed by the lactase site of lactase phlorizin hydrolase."
FEBS Lett 468(2-3): 166-70.
Dejgaard K., Theberge J.F., Heath-Engel H., Chevet E., Tremblay M.L.,Thomas D.Y.
(2010). "Organization of the Sec61 translocon, studied by high resolution
native electrophoresis." J Proteome Res 9(4): 1763-71.
Delacour D., Cramm-Behrens C.I., Drobecq H., Le Bivic A., Naim H.Y.,Jacob R.
(2006). "Requirement for galectin-3 in apical protein sorting." Curr Biol 16(4):
408-14.
Delacour D., Greb C., Koch A. et al (2007). "Apical sorting by galectin-3-dependent
glycoprotein clustering." Traffic 8(4): 379-88.
Delacour D., Koch A.,Jacob R. (2009). "The role of galectins in protein trafficking."
Traffic 10(10): 1405-13.
Doms R.W., Keller D.S., Helenius A.,Balch W.E. (1987). "Role for adenosine
triphosphate in regulating the assembly and transport of vesicular stomatitis
virus G protein trimers." J Cell Biol 105(5): 1957-69.
Dzialanski Z., Barany M., Engfeldt P., Magnuson A., Olsson L.A.,Nilsson T.K. (2015).
"Lactase persistence versus lactose intolerance: Is there an intermediate
phenotype?" Clin Biochem.
References
85
Ellgaard L.,Helenius A. (2003). "Quality control in the endoplasmic reticulum." Nat
Rev Mol Cell Biol 4(3): 181-91.
Enattah N.S., Jensen T.G., Nielsen M. et al (2008). "Independent introduction of two
lactase-persistence alleles into human populations reflects different history of
adaptation to milk culture." Am J Hum Genet 82(1): 57-72.
Enattah N.S., Sahi T., Savilahti E., Terwilliger J.D., Peltonen L.,Jarvela I. (2002).
"Identification of a variant associated with adult-type hypolactasia." Nat Genet
30(2): 233-7.
Erasmus H.D., Ludwig-Auser H.M., Paterson P.G., Sun D.,Sankaran K. (2002).
"Enhanced weight gain in preterm infants receiving lactase-treated feeds: a
randomized, double-blind, controlled trial." J Pediatr 141(4): 532-7.
Evans R.C., Fear S., Ashby D. et al (2002). "Diet and colorectal cancer: an
investigation of the lectin/galactose hypothesis." Gastroenterology 122(7):
1784-92.
Fabre A., Charroux B., Martinez-Vinson C. et al (2012). "SKIV2L mutations cause
syndromic diarrhea, or trichohepatoenteric syndrome." Am J Hum Genet
90(4): 689-92.
Fajardo O., Naim H.Y.,Lacey S.W. (1994). "The polymorphic expression of lactase in
adults is regulated at the messenger RNA level." Gastroenterology 106(5):
1233-41.
Fazeli W., Kaczmarek S., Kirschstein M.,Santer R. (2015). "A novel mutation within
the lactase gene (LCT): the first report of congenital lactase deficiency
diagnosed in Central Europe." BMC Gastroenterol 15(1): 90.
Ferraris R.P. (2001). "Dietary and developmental regulation of intestinal sugar
transport." Biochem J 360(Pt 2): 265-76.
86
References
Ferris S.P., Kodali V.K.,Kaufman R.J. (2014). "Glycoprotein folding and qualitycontrol mechanisms in protein-folding diseases." Dis Model Mech 7(3): 33141.
Fink A.L. (1999). "Chaperone-mediated protein folding." Physiol Rev 79(2): 425-49.
Flynn G.C., Pohl J., Flocco M.T.,Rothman J.E. (1991). "Peptide-binding specificity of
the molecular chaperone BiP." Nature 353(6346): 726-30.
Freedman R.B., Bulleid N.J., Hawkins H.C.,Paver J.L. (1989). "Role of protein
disulphide-isomerase in the expression of native proteins." Biochem Soc
Symp 55: 167-92.
Freiburghaus A.U., Schmitz J., Schindler M. et al (1976). "Protein patterns of brushborder fragments in congenital lactose malabsorption and in specific
hypolactasia of the adult." N Engl J Med 294(19): 1030-2.
Frischmeyer P.A.,Dietz H.C. (1999). "Nonsense-mediated mRNA decay in health and
disease." Hum Mol Genet 8(10): 1893-900.
Gasbarrini A., Corazza G.R., Gasbarrini G. et al (2009). "Methodology and
indications of H2-breath testing in gastrointestinal diseases: the Rome
Consensus Conference." Aliment Pharmacol Ther 29 Suppl 1: 1-49.
Gendrel D., Richard-Lenoble D., Kombila M. et al (1992). "Influence of intestinal
parasitism on lactose absorption in well-nourished African children." Am J
Trop Med Hyg 46(2): 137-40.
Gorbenko del Blanco D., de Graaff L.C., Visser T.J.,Hokken-Koelega A.C. (2012).
"Growth hormone insensitivity syndrome caused by a heterozygous GHR
mutation: phenotypic variability owing to moderation by nonsense-mediated
decay." Clin Endocrinol (Oxf) 76(5): 706-12.
Gornik O.,Lauc G. (2008). "Glycosylation of serum proteins in inflammatory
diseases." Dis Markers 25(4-5): 267-78.
References
87
Grunberg J., Luginbuhl U.,Sterchi E.E. (1992). "Proteolytic processing of human
intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for correct
sorting in Madin Darby canine kidney (MDCK) cells." FEBS Lett 314(3): 224-8.
Hammond C., Braakman I.,Helenius A. (1994). "Role of N-linked oligosaccharide
recognition, glucose trimming, and calnexin in glycoprotein folding and quality
control." Proc Natl Acad Sci U S A 91(3): 913-7.
Harding H.P., Zhang Y.,Ron D. (1999). "Protein translation and folding are coupled
by an endoplasmic-reticulum-resident kinase." Nature 397(6716): 271-4.
Hartley J.L., Zachos N.C., Dawood B. et al (2010). "Mutations in TTC37 cause
trichohepatoenteric
syndrome
(phenotypic
diarrhea
of
infancy)."
Gastroenterology 138(7): 2388-98, 98.e1-2.
Harvey C.B., Wang Y., Hughes L.A. et al (1995). "Studies on the expression of
intestinal lactase in different individuals." Gut 36(1): 28-33.
Hauri H.P., Sterchi E.E., Bienz D., Fransen J.A.,Marxer A. (1985). "Expression and
intracellular transport of microvillus membrane hydrolases in human intestinal
epithelial cells." J Cell Biol 101(3): 838-51.
Hebert D.N., Garman S.C.,Molinari M. (2005). "The glycan code of the endoplasmic
reticulum: asparagine-linked carbohydrates as protein maturation and qualitycontrol tags." Trends Cell Biol 15(7): 364-70.
Hebert D.N.,Molinari M. (2007). "In and out of the ER: protein folding, quality control,
degradation, and related human diseases." Physiol Rev 87(4): 1377-408.
Hebert D.N., Zhang J.X., Chen W., Foellmer B.,Helenius A. (1997). "The Number and
Location of Glycans on Influenza Hemagglutinin Determine Folding and
Association with Calnexin and Calreticulin." J Cell Biol 139(3): 613-23.
Helander H.F.,Fandriks L. (2014). "Surface area of the digestive tract - revisited."
Scand J Gastroenterol 49(6): 681-9.
88
References
Helenius A.,Aebi M. (2004). "Roles of N-linked glycans in the endoplasmic reticulum."
Annu Rev Biochem 73: 1019-49.
Henrissat B.,Davies G.J. (2000). "Glycoside hydrolases and glycosyltransferases.
Families, modules, and implications for genomics." Plant Physiol 124(4): 15159.
Herrinton L.J., Weiss N.S., Beresford S.A. et al (1995). "Lactose and galactose intake
and metabolism in relation to the risk of epithelial ovarian cancer." Am J
Epidemiol 141(5): 407-16.
Heyman M.B. (2006). "Lactose intolerance in infants, children, and adolescents."
Pediatrics 118(3): 1279-86.
Hirschberg C.B.,Snider M.D. (1987). "Topography of glycosylation in the rough
endoplasmic reticulum and Golgi apparatus." Annu Rev Biochem 56: 63-87.
Holden C.,Mace R. (1997). "Phylogenetic analysis of the evolution of lactose
digestion in adults." Hum Biol 69(5): 605-28.
Holzel A. (1967). "Sugar malabsorption due to deficiencies of disaccharidase
activities and of monosaccharide transport." Arch Dis Child 42(224): 341-52.
Holzel A. (1968). "Defects of sugar absorption. Sugar malabsorption and sugar
intolerance in childhood." Proc R Soc Med 61(11 Part 1): 1095-9.
Holzel A., Mereu T.,Thomson M.L. (1962). "Severe lactose intolerance in infancy."
Lancet 2(7270): 1346-8.
Hong M. (2006). "Oligomeric structure, dynamics, and orientation of membrane
proteins from solid-state NMR." Structure 14(12): 1731-40.
Hoskova A., Sabacky J., Mrskos A.,Pospisil R. (1980). "Severe lactose intolerance
with lactosuria and vomiting." Arch Dis Child 55(4): 304-5.
References
89
Hosokawa N., Tremblay L.O., You Z., Herscovics A., Wada I.,Nagata K. (2003).
"Enhancement of endoplasmic reticulum (ER) degradation of misfolded Null
Hong Kong alpha1-antitrypsin by human ER mannosidase I." J Biol Chem
278(28): 26287-94.
Hosokawa N., You Z., Tremblay L.O., Nagata K.,Herscovics A. (2007). "Stimulation
of ERAD of misfolded null Hong Kong alpha1-antitrypsin by Golgi alpha1,2mannosidases." Biochem Biophys Res Commun 362(3): 626-32.
Hutt D.M., Powers E.T.,Balch W.E. (2009). "The proteostasis boundary in misfolding
diseases of membrane traffic." FEBS Lett 583(16): 2639-46.
Ingram C.J., Elamin M.F., Mulcare C.A. et al (2007). "A novel polymorphism
associated with lactose tolerance in Africa: multiple causes for lactase
persistence?" Hum Genet 120(6): 779-88.
Ingram C.J., Raga T.O., Tarekegn A. et al (2009). "Multiple rare variants as a cause
of a common phenotype: several different lactase persistence associated
alleles in a single ethnic group." J Mol Evol 69(6): 579-88.
Inoue K., Khajavi M., Ohyama T. et al (2004). "Molecular mechanism for distinct
neurological phenotypes conveyed by allelic truncating mutations." Nat Genet
36(4): 361-9.
Jacob R., Alfalah M., Grunberg J., Obendorf M.,Naim H.Y. (2000). "Structural
determinants required for apical sorting of an intestinal brush-border
membrane protein." J Biol Chem 275(9): 6566-72.
Jacob R., Brewer C., Fransen J.A.,Naim H.Y. (1994). "Transport, function, and
sorting of lactase-phlorizin hydrolase in Madin-Darby canine kidney cells." J
Biol Chem 269(4): 2712-21.
Jacob R., Bulleid N.J.,Naim H.Y. (1995). "Folding of human intestinal lactasephlorizin hydrolase." J Biol Chem 270(31): 18678-84.
90
References
Jacob R., Heine M., Alfalah M.,Naim H.Y. (2003). "Distinct cytoskeletal tracks direct
individual vesicle populations to the apical membrane of epithelial cells." Curr
Biol 13(7): 607-12.
Jacob R.,Naim H.Y. (2001). "Apical membrane proteins are transported in distinct
vesicular carriers." Curr Biol 11(18): 1444-50.
Jacob R., Peters K.,Naim H.Y. (2002). "The prosequence of human lactase-phlorizin
hydrolase modulates the folding of the mature enzyme." J Biol Chem 277(10):
8217-25.
Jacob R., Preuss U., Panzer P. et al (1999). "Hierarchy of sorting signals in chimeras
of intestinal lactase-phlorizin hydrolase and the influenza virus hemagglutinin."
J Biol Chem 274(12): 8061-7.
Jacob R., Radebach I., Wuthrich M., Grunberg J., Sterchi E.E.,Naim H.Y. (1996).
"Maturation of human intestinal lactase-phlorizin hydrolase: generation of the
brush border form of the enzyme involves at least two proteolytic cleavage
steps." Eur J Biochem 236(3): 789-95.
Jacob R., Weiner J.R., Stadge S.,Naim H.Y. (2000). "Additional N-glycosylation and
its impact on the folding of intestinal lactase-phlorizin hydrolase." J Biol Chem
275(14): 10630-7.
Jacob R., Zimmer K.P., Naim H.,Naim H.Y. (1997). "The apical sorting of lactasephlorizin hydrolase implicates sorting sequences found in the mature domain."
Eur J Cell Biol 72(1): 54-60.
Jarvinen R., Knekt P., Hakulinen T.,Aromaa A. (2001). "Prospective study on milk
products, calcium and cancers of the colon and rectum." Eur J Clin Nutr
55(11): 1000-7.
Jensen P.H., Kolarich D.,Packer N.H. (2010). "Mucin-type O-glycosylation--putting
the pieces together." FEBS J 277(1): 81-94.
References
91
Jensen T.G., Liebert A., Lewinsky R., Swallow D.M., Olsen J.,Troelsen J.T. (2011).
"The -14010*C variant associated with lactase persistence is located between
an Oct-1 and HNF1alpha binding site and increases lactase promoter activity."
Hum Genet 130(4): 483-93.
Jidenko M., Nielsen R.C., Sorensen T.L. et al (2005). "Crystallization of a mammalian
membrane protein overexpressed in Saccharomyces cerevisiae." Proc Natl
Acad Sci U S A 102(33): 11687-91.
Jordan B.A.,Devi L.A. (1999). "G-protein-coupled receptor heterodimerization
modulates receptor function." Nature 399(6737): 697-700.
Kornfeld R.,Kornfeld S. (1985). "Assembly of asparagine-linked oligosaccharides."
Annu Rev Biochem 54: 631-64.
Kruse T.A., Bolund L., Grzeschik K.H. et al (1988). "The human lactase-phlorizin
hydrolase gene is located on chromosome 2." FEBS Lett 240(1-2): 123-6.
Kuhn N.J.,White A. (2009). "The topography of lactose synthesis. 1975." J Mammary
Gland Biol Neoplasia 14(3): 213-20.
Kuokkanen M., Enattah N.S., Oksanen A., Savilahti E., Orpana A.,Jarvela I. (2003).
"Transcriptional regulation of the lactase-phlorizin hydrolase gene by
polymorphisms associated with adult-type hypolactasia." Gut 52(5): 647-52.
Kuokkanen M., Kokkonen J., Enattah N.S. et al (2006). "Mutations in the translated
region of the lactase gene (LCT) underlie congenital lactase deficiency." Am J
Hum Genet 78(2): 339-44.
Kwak H.L., WJ.; Lee, MR. (2012). "Revisiting lactose as an enhancer of calcium
absorption." International Dairy Journal 22(2): 147-51.
Laaksonen M.M., Impivaara O., Sievanen H. et al (2009). "Associations of genetic
lactase non-persistence and sex with bone loss in young adulthood." Bone
44(5): 1003-9.
92
References
Launiala K., Kuitunen P.,Visakorpi J.K. (1966). "Disaccharidases and histology of
duodenal mucosa in congenital lactose malabsorption." Acta Paediatr Scand
55(3): 257-63.
Leese H.J.,Semenza G. (1973). "On the identity between the small intestinal
enzymes phlorizin hydrolase and glycosylceramidase." J Biol Chem 248(23):
8170-3.
Lemus L.,Goder V. (2014). "Regulation of Endoplasmic Reticulum-Associated Protein
Degradation (ERAD) by Ubiquitin." Cells 3(3): 824-47.
Lerchbaum E., Giuliani A., Gruber H.J., Pieber T.R.,Obermayer-Pietsch B. (2012).
"Adult-type hypolactasia and calcium intake in polycystic ovary syndrome."
Clin Endocrinol (Oxf) 77(6): 834-43.
Lewinsky R.H., Jensen T.G., Moller J., Stensballe A., Olsen J.,Troelsen J.T. (2005).
"T-13910 DNA variant associated with lactase persistence interacts with Oct-1
and stimulates lactase promoter activity in vitro." Hum Mol Genet 14(24):
3945-53.
Lobo G.P., Ebke L.A., Au A.,Hagstrom S.A. (2016). "TULP1 Missense Mutations
Induces the Endoplasmic Reticulum Unfolded Protein Response Stress
Complex (ER-UPR)." Adv Exp Med Biol 854: 223-30.
Lodish H B.A., Zipursky SL, et al. (2000). "Molecular Cell Biology." 4th edition.
Lomer M.C., Parkes G.C.,Sanderson J.D. (2008). "Review article: lactose intolerance
in clinical practice--myths and realities." Aliment Pharmacol Ther 27(2): 93103.
Long S.B., Campbell E.B.,Mackinnon R. (2005). "Crystal structure of a mammalian
voltage-dependent Shaker family K+ channel." Science 309(5736): 897-903.
Luan C.J., Shen W., Yu Z. et al (2015). "Two nonsense mutations cause protein C
deficiency by nonsense-mediated mRNA decay." Thromb Res 135(4): 733-8.
References
93
Maffei H.V., Daher S.R.,Moreira F.L. (1984). "Carbohydrate malabsorption in infants
with diarrhea: diagnostic and evolutive aspects." Arq Gastroenterol 21(3): 13642.
Maiuri L., Rossi M., Raia V. et al (1994). "Mosaic regulation of lactase in human
adult-type hypolactasia." Gastroenterology 107(1): 54-60.
Mantei N., Villa M., Enzler T. et al (1988). "Complete primary structure of human and
rabbit lactase-phlorizin hydrolase: implications for biosynthesis, membrane
anchoring and evolution of the enzyme." EMBO J 7(9): 2705-13.
Maquat L.E. (2005). "Nonsense-mediated mRNA decay in mammals." J Cell Sci
118(Pt 9): 1773-6.
Martin M.G., Turk E., Lostao M.P., Kerner C.,Wright E.M. (1996). "Defects in
Na+/glucose cotransporter (SGLT1) trafficking and function cause glucosegalactose malabsorption." Nat Genet 12(2): 216-20.
Matthews S.B., Waud J.P., Roberts A.G.,Campbell A.K. (2005). "Systemic lactose
intolerance: a new perspective on an old problem." Postgrad Med J 81(953):
167-73.
Maza J., Mateescu M., Das Sarma J.,Koval M. (2003). "Differential oligomerization of
endoplasmic reticulum-retained connexin43/connexin32 chimeras." Cell
Commun Adhes 10(4-6): 319-22.
Metz G., Jenkins D.J., Peters T.J., Newman A.,Blendis L.M. (1975). "Breath
hydrogen as a diagnostic method for hypolactasia." Lancet 1(7917): 1155-7.
Miller T.L., Orav E.J., Martin S.R., Cooper E.R., McIntosh K.,Winter H.S. (1991).
"Malnutrition and carbohydrate malabsorption in children with vertically
transmitted human immunodeficiency virus 1 infection." Gastroenterology
100(5 Pt 1): 1296-302.
94
References
Minguez P., Parca L., Diella F. et al (2012). "Deciphering a global network of
functionally associated post-translational modifications." Mol Syst Biol 8: 599.
Misselwitz B., Pohl D., Fruhauf H., Fried M., Vavricka S.R.,Fox M. (2013). "Lactose
malabsorption and intolerance: pathogenesis, diagnosis and treatment."
United European Gastroenterol J 1(3): 151-9.
Miwa H.E., Song Y., Alvarez R., Cummings R.D.,Stanley P. (2012). "The bisecting
GlcNAc in cell growth control and tumor progression." Glycoconj J 29(8-9):
609-18.
Mohorko E., Glockshuber R.,Aebi M. (2011). "Oligosaccharyltransferase: the central
enzyme of N-linked protein glycosylation." J Inherit Metab Dis 34(4): 869-78.
Montalto M., Nucera G., Santoro L. et al (2005). "Effect of exogenous betagalactosidase in patients with lactose malabsorption and intolerance: a
crossover double-blind placebo-controlled study." Eur J Clin Nutr 59(4): 48993.
Moremen K.W. (2002). "Golgi alpha-mannosidase II deficiency in vertebrate systems:
implications for asparagine-linked oligosaccharide processing in mammals."
Biochim Biophys Acta 1573(3): 225-35.
Mottet G., Tuffereau C.,Roux L. (1986). "Reduced temperature can block different
glycoproteins at different steps during transport to the plasma membrane." J
Gen Virol 67 ( Pt 9): 2029-35.
Muller T., Hess M.W., Schiefermeier N. et al (2008). "MYO5B mutations cause
microvillus inclusion disease and disrupt epithelial cell polarity." Nat Genet
40(10): 1163-5.
Munro S.,Pelham H.R. (1986). "An Hsp70-like protein in the ER: identity with the 78
kd glucose-regulated protein and immunoglobulin heavy chain binding
protein." Cell 46(2): 291-300.
References
95
Naim H.Y. (1992). "Processing of human pro-lactase-phlorizin hydrolase at reduced
temperatures: cleavage is preceded by complex glycosylation." Biochem J 285
( Pt 1): 13-6.
Naim H.Y. (1994). "Processing and transport of human small intestinal lactasephlorizin hydrolase (LPH). Role of N-linked oligosaccharide modification."
FEBS Lett 342(3): 302-7.
Naim H.Y., Heine M.,Zimmer K.P. (2012). "Congenital sucrase-isomaltase deficiency:
heterogeneity of inheritance, trafficking, and function of an intestinal enzyme
complex." J Pediatr Gastroenterol Nutr 55 Suppl 2: S13-20.
Naim H.Y., Jacob R., Naim H., Sambrook J.F.,Gething M.J. (1994). "The pro region
of human intestinal lactase-phlorizin hydrolase." J Biol Chem 269(43): 2693343.
Naim H.Y., Lacey S.W., Sambrook J.F.,Gething M.J. (1991). "Expression of a fulllength cDNA coding for human intestinal lactase-phlorizin hydrolase reveals
an uncleaved, enzymatically active, and transport-competent protein." J Biol
Chem 266(19): 12313-20.
Naim H.Y.,Lentze M.J. (1992). "Impact of O-glycosylation on the function of human
intestinal lactase-phlorizin hydrolase. Characterization of glycoforms varying in
enzyme activity and localization of O-glycoside addition." J Biol Chem 267(35):
25494-504.
Naim H.Y.,Naim H. (1996). "Dimerization of lactase-phlorizin hydrolase occurs in the
endoplasmic reticulum, involves the putative membrane spanning domain and
is required for an efficient transport of the enzyme to the cell surface." Eur J
Cell Biol 70(3): 198-208.
Naim H.Y., Sterchi E.E.,Lentze M.J. (1987). "Biosynthesis and maturation of lactasephlorizin hydrolase in the human small intestinal epithelial cells." Biochem J
241(2): 427-34.
96
References
Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Biosynthesis of the human sucraseisomaltase complex. Differential O-glycosylation of the sucrase subunit
correlates with its position within the enzyme complex." J Biol Chem 263(15):
7242-53.
Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Structure, biosynthesis, and
glycosylation of human small intestinal maltase-glucoamylase." J Biol Chem
263(36): 19709-17.
Nemeth K., Plumb G.W., Berrin J.G. et al (2003). "Deglycosylation by small intestinal
epithelial cell beta-glucosidases is a critical step in the absorption and
metabolism of dietary flavonoid glycosides in humans." Eur J Nutr 42(1): 2942.
Newcomer A.D., McGill D.B., Thomas P.J.,Hofmann A.F. (1975). "Prospective
comparison of indirect methods for detecting lactase deficiency." N Engl J Med
293(24): 1232-6.
Ng D.P., Poulsen B.E.,Deber C.M. (2012). "Membrane protein misassembly in
disease." Biochim Biophys Acta 1818(4): 1115-22.
Nichols B.L., Avery S.E., Karnsakul W. et al (2002). "Congenital maltaseglucoamylase deficiency associated with lactase and sucrase deficiencies." J
Pediatr Gastroenterol Nutr 35(4): 573-9.
Ninagawa S., Okada T., Sumitomo Y. et al (2014). "EDEM2 initiates mammalian
glycoprotein ERAD by catalyzing the first mannose trimming step." J Cell Biol
206(3): 347-56.
Norio R. (2003). "Finnish Disease Heritage I: characteristics, causes, background."
Hum Genet 112(5-6): 441-56.
Norio R. (2003). "Finnish Disease Heritage II: population prehistory and genetic roots
of Finns." Hum Genet 112(5-6): 457-69.
References
97
Obermayer-Pietsch B.M., Bonelli C.M., Walter D.E. et al (2004). "Genetic
predisposition for adult lactose intolerance and relation to diet, bone density,
and bone fractures." J Bone Miner Res 19(1): 42-7.
Olds L.C.,Sibley E. (2003). "Lactase persistence DNA variant enhances lactase
promoter activity in vitro: functional role as a cis regulatory element." Hum Mol
Genet 12(18): 2333-40.
Olzmann J.A., Kopito R.R.,Christianson J.C. (2013). "The mammalian endoplasmic
reticulum-associated degradation system." Cold Spring Harb Perspect Biol
5(9).
Overeem A.W., Posovszky C., Rings E.H., Giepmans B.N.,van I.S.C. (2016). "The
role of enterocyte defects in the pathogenesis of congenital diarrheal
disorders." Dis Model Mech 9(1): 1-12.
Oyadomari S., Araki E.,Mori M. (2002). "Endoplasmic reticulum stress-mediated
apoptosis in pancreatic beta-cells." Apoptosis 7(4): 335-45.
Ozdemir O., Mete E., Catal F.,Ozol D. (2009). "Food intolerances and eosinophilic
esophagitis in childhood." Dig Dis Sci 54(1): 8-14.
Palacios I.M. (2013). "Nonsense-mediated mRNA decay: from mechanistic insights
to impacts on human health." Brief Funct Genomics 12(1): 25-36.
Panzer P., Preuss U., Joberty G.,Naim H.Y. (1998). "Protein domains implicated in
intracellular transport and sorting of lactase-phlorizin hydrolase." J Biol Chem
273(22): 13861-9.
Pelletier M.F., Marcil A., Sevigny G. et al (2000). "The heterodimeric structure of
glucosidase II is required for its activity, solubility, and localization in vivo."
Glycobiology 10(8): 815-27.
Peltonen L., Jalanko A.,Varilo T. (1999). "Molecular genetics of the Finnish disease
heritage." Hum Mol Genet 8(10): 1913-23.
98
References
Petrescu A.J., Milac A.L., Petrescu S.M., Dwek R.A.,Wormald M.R. (2004).
"Statistical analysis of the protein environment of N-glycosylation sites:
implications for occupancy, structure, and folding." Glycobiology 14(2): 10314.
Pfeffer S., Dudek J., Gogala M. et al (2014). "Structure of the mammalian
oligosaccharyl-transferase complex in the native ER protein translocon." Nat
Commun 5: 3072.
Pramoud D. (1997). "Blood Brain Barrier and Cerebral Metabolism." Neuroscience
Online(4).
Propsting M.J., Jacob R.,Naim H.Y. (2003). "A glutamine to proline exchange at
amino acid residue 1098 in sucrase causes a temperature-sensitive arrest of
sucrase-isomaltase in the endoplasmic reticulum and cis-Golgi." J Biol Chem
278(18): 16310-4.
Rasinpera H., Kuokkanen M., Kolho K.L. et al (2005). "Transcriptional
downregulation of the lactase (LCT) gene during childhood." Gut 54(11): 16601.
Rasinpera H., Savilahti E., Enattah N.S. et al (2004). "A genetic test which can be
used to diagnose adult-type hypolactasia in children." Gut 53(11): 1571-6.
Rhim A.D., Stoykova L.I., Trindade A.J., Glick M.C.,Scanlin T.F. (2004). "Altered
terminal glycosylation and the pathophysiology of CF lung disease." J Cyst
Fibros 3 Suppl 2: 95-6.
Rings E.H., de Boer P.A., Moorman A.F. et al (1992). "Lactase gene expression
during early development of rat small intestine." Gastroenterology 103(4):
1154-61.
Ritz V., Alfalah M., Zimmer K.P., Schmitz J., Jacob R.,Naim H.Y. (2003). "Congenital
sucrase-isomaltase deficiency because of an accumulation of the mutant
enzyme in the endoplasmic reticulum." Gastroenterology 125(6): 1678-85.
References
99
Rock C.L. (2011). "Milk and the risk and progression of cancer." Nestlé Nutrition
workshop series. Paediatric programme 67: 173-85.
Ron D.,Walter P. (2007). "Signal integration in the endoplasmic reticulum unfolded
protein response." Nat Rev Mol Cell Biol 8(7): 519-29.
Ruchkina I.N., Fadeeva N.A., Parfenov A.I. et al (2013). "[The role of small bowel
microflora in the development of secondary lactase deficiency and the
possibilities of its treatment with probiotics]." Ter Arkh 85(2): 21-6.
Ruggiano A., Foresti O.,Carvalho P. (2014). "Quality control: ER-associated
degradation: protein quality control and beyond." J Cell Biol 204(6): 869-79.
Saarela T., Simila S.,Koivisto M. (1995). "Hypercalcemia and nephrocalcinosis in
patients with congenital lactase deficiency." J Pediatr 127(6): 920-3.
Sahi T. (1994). "Genetics and epidemiology of adult-type hypolactasia." Scand J
Gastroenterol Suppl 202: 7-20.
Sahi T. (1994). "Hypolactasia and lactase persistence. Historical review and the
terminology." Scand J Gastroenterol Suppl 202: 1-6.
Sala Coromina J., Vinaixa Verges A.,Garcia Puig R. (2014). "[Congenital lactase
deficiency: Identification of a new mutation.]." An Pediatr (Barc).
Saldova R., Reuben J.M., Abd Hamid U.M., Rudd P.M.,Cristofanilli M. (2011).
"Levels of specific serum N-glycans identify breast cancer patients with higher
circulating tumor cell counts." Ann Oncol 22(5): 1113-9.
Savaiano D.A. (2014). "Lactose digestion from yogurt: mechanism and relevance."
Am J Clin Nutr 99(5 Suppl): 1251S-5S.
100
References
Savaiano D.A., Boushey C.J.,McCabe G.P. (2006). "Lactose intolerance symptoms
assessed by meta-analysis: a grain of truth that leads to exaggeration." J Nutr
136(4): 1107-13.
Savilahti E., Launiala K.,Kuitunen P. (1983). "Congenital lactase deficiency. A clinical
study on 16 patients." Arch Dis Child 58(4): 246-52.
Schedin-Weiss S., Winblad B.,Tjernberg L.O. (2014). "The role of protein
glycosylation in Alzheimer disease." Febs j 281(1): 46-62.
Scholz-Ahrens K.E.,Schrezenmeir J. (2000). "Effects of bioactive substances in milk
on mineral and trace element metabolism with special reference to casein
phosphopeptides." Br J Nutr 84 Suppl 1: S147-53.
Schroder M. (2008). "Endoplasmic reticulum stress responses." Cell Mol Life Sci
65(6): 862-94.
Scrimshaw N.S.,Murray E.B. (1988). "The acceptability of milk and milk products in
populations with a high prevalence of lactose intolerance." Am J Clin Nutr 48(4
Suppl): 1079-159.
Semenza G. (1986). "Anchoring and biosynthesis of stalked brush border membrane
proteins: glycosidases and peptidases of enterocytes and renal tubuli." Annu
Rev Cell Biol 2: 255-313.
Shailubhai K., Pukazhenthi B.S., Saxena E.S., Varma G.M.,Vijay I.K. (1991).
"Glucosidase I, a transmembrane endoplasmic reticular glycoprotein with a
luminal catalytic domain." J Biol Chem 266(25): 16587-93.
Shaukat A., Levitt M.D., Taylor B.C. et al (2010). "Systematic review: effective
management strategies for lactose intolerance." Ann Intern Med 152(12): 797803.
References
101
Sim L., Willemsma C., Mohan S., Naim H.Y., Pinto B.M.,Rose D.R. (2010).
"Structural basis for substrate selectivity in human maltase-glucoamylase and
sucrase-isomaltase N-terminal domains." J Biol Chem 285(23): 17763-70.
Simons K.,Ikonen E. (1997). "Functional rafts in cell membranes." Nature 387(6633):
569-72.
Simoons F.J. (1969). "Primary adult lactose intolerance and the milking habit: a
problem in biological and cultural interrelations. I. Review of the medical
research." Am J Dig Dis 14(12): 819-36.
Simoons F.J. (1970). "Primary adult lactose intolerance and the milking habit: a
problem in biologic and cultural interrelations. II. A culture historical
hypothesis." Am J Dig Dis 15(8): 695-710.
Sivagnanam M., Mueller J.L., Lee H. et al (2008). "Identification of EpCAM as the
gene for congenital tufting enteropathy." Gastroenterology 135(2): 429-37.
Slemenda C.W., Christian J.C., Hui S., Fitzgerald J.,Johnston C.C., Jr. (1991). "No
evidence for an effect of lactase deficiency on bone mass in pre- or
postmenopausal women." J Bone Miner Res 6(12): 1367-71.
Solomons N.W. (2002). "Fermentation, fermented foods and lactose intolerance." Eur
J Clin Nutr 56 Suppl 4: S50-5.
Stallings V.A., Oddleifson N.W., Negrini B.Y., Zemel B.S.,Wellens R. (1994). "Bone
mineral content and dietary calcium intake in children prescribed a low-lactose
diet." J Pediatr Gastroenterol Nutr 18(4): 440-5.
Stanley P., Schachter H.,Taniguchi N. (2009). N-Glycans. Essentials of Glycobiology.
A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor Laboratory
Press.
102
References
Suarez F.L., Savaiano D.A.,Levitt M.D. (1995). "A comparison of symptoms after the
consumption of milk or lactose-hydrolyzed milk by people with self-reported
severe lactose intolerance." N Engl J Med 333(1): 1-4.
Swallow D.M. (2003). "Genetics of lactase persistence and lactose intolerance."
Annu Rev Genet 37: 197-219.
Terrin G., Tomaiuolo R., Passariello A. et al (2012). "Congenital diarrheal disorders:
an updated diagnostic approach." Int J Mol Sci 13(4): 4168-85.
Thanabalasingham G., Huffman J.E., Kattla J.J. et al (2013). "Mutations in HNF1A
result in marked alterations of plasma glycan profile." Diabetes 62(4): 1329-37.
Tishkoff S.A., Reed F.A., Ranciaro A. et al (2007). "Convergent adaptation of human
lactase persistence in Africa and Europe." Nat Genet 39(1): 31-40.
Tomar B.S. (2014). "Lactose intolerance and other disaccharidase deficiency." Indian
J Pediatr 81(9): 876-80.
Torniainen S., Freddara R., Routi T. et al (2009). "Four novel mutations in the lactase
gene (LCT) underlying congenital lactase deficiency (CLD)." BMC
Gastroenterol 9: 8.
Travers K.J., Patil C.K., Wodicka L., Lockhart D.J., Weissman J.S.,Walter P. (2000).
"Functional and genomic analyses reveal an essential coordination between
the unfolded protein response and ER-associated degradation." Cell 101(3):
249-58.
Triadou N., Bataille J.,Schmitz J. (1983). "Longitudinal study of the human intestinal
brush border membrane proteins. Distribution of the main disaccharidases and
peptidases." Gastroenterology 85(6): 1326-32.
Troelsen J.T., Mehlum A., Olsen J. et al (1994). "1 kb of the lactase-phlorizin
hydrolase promoter directs post-weaning decline and small intestinal-specific
expression in transgenic mice." FEBS Lett 342(3): 291-6.
References
103
Troelsen J.T., Mitchelmore C., Spodsberg N., Jensen A.M., Noren O.,Sjostrom H.
(1997). "Regulation of lactase-phlorizin hydrolase gene expression by the
caudal-related homoeodomain protein Cdx-2." Biochem J 322 ( Pt 3): 833-8.
Troelsen J.T., Olsen J., Mitchelmore C., Hansen G.H., Sjostrom H.,Noren O. (1994).
"Two intestinal specific nuclear factors binding to the lactase-phlorizin
hydrolase and sucrase-isomaltase promoters are functionally related
oligomeric molecules." FEBS Lett 342(3): 297-301.
Troelsen J.T., Olsen J., Noren O.,Sjostrom H. (1992). "A novel intestinal trans-factor
(NF-LPH1) interacts with the lactase-phlorizin hydrolase promoter and covaries with the enzymatic activity." J Biol Chem 267(28): 20407-11.
Trombetta E.S.,Parodi A.J. (2003). "Quality control and protein folding in the
secretory pathway." Annu Rev Cell Dev Biol 19: 649-76.
Ubarretxena-Belandia I.,Stokes D.L. (2010). "Present and future of membrane
protein structure determination by electron crystallography." Adv Protein Chem
Struct Biol 81: 33-60.
Uchida N., Sakamoto O., Irie M. et al (2012). "Two novel mutations in the lactase
gene in a Japanese infant with congenital lactase deficiency." Tohoku J Exp
Med 227(1): 69-72.
Usai-Satta P., Scarpa M., Oppia F.,Cabras F. (2012). "Lactose malabsorption and
intolerance: What should be the best clinical management?" World J
Gastrointest Pharmacol Ther 3(3): 29-33.
Varki A., Freeze H.H.,Manzi A.E. (2009). "Overview of glycoconjugate analysis." Curr
Protoc Protein Sci Chapter 12: Unit 12 1 1 1-8.
Varki A.,Lowe J.B. (2009). Biological Roles of Glycans. Essentials of Glycobiology. A.
Varki, R. D. Cummings, J. D. Eskoet al. Cold Spring Harbor (NY), Cold Spring
Harbor Laboratory Press, The Consortium of Glycobiology Editors, La Jolla,
California.
104
References
Vembar S.S.,Brodsky J.L. (2008). "One step at a time: endoplasmic reticulumassociated degradation." Nat Rev Mol Cell Biol 9(12): 944-57.
Venema K. (2012). "Intestinal fermentation of lactose and prebiotic lactose
derivatives, including human milk oligosaccharides." International Dairy
Journal 22(2): 123-40.
Vesa T.H., Marteau P.,Korpela R. (2000). "Lactose intolerance." J Am Coll Nutr 19(2
Suppl): 165s-75s.
Wacker H., Keller P., Falchetto R., Legler G.,Semenza G. (1992). "Location of the
two catalytic sites in intestinal lactase-phlorizin hydrolase. Comparison with
sucrase-isomaltase and with other glycosidases, the membrane anchor of
lactase-phlorizin hydrolase." J Biol Chem 267(26): 18744-52.
Wahlqvist M.L. (2015). "Lactose nutrition in lactase nonpersisters." Asia Pac J Clin
Nutr 24 Suppl 1: S21-5.
Wang B.,Brand-Miller J. (2003). "The role and potential of sialic acid in human
nutrition." Eur J Clin Nutr 57(11): 1351-69.
Wiegerinck C.L., Janecke A.R., Schneeberger K. et al (2014). "Loss of syntaxin 3
causes variant microvillus inclusion disease." Gastroenterology 147(1): 658.e10.
Williams D.B. (2006). "Beyond lectins: the calnexin/calreticulin chaperone system of
the endoplasmic reticulum." J Cell Sci 119(Pt 4): 615-23.
Wuthrich M., Grunberg J., Hahn D. et al (1996). "Proteolytic processing of human
lactase-phlorizin hydrolase is a two-step event: identification of the cleavage
sites." Arch Biochem Biophys 336(1): 27-34.
Yang J., Deng Y., Chu H. et al (2013). "Prevalence and presentation of lactose
intolerance and effects on dairy product intake in healthy subjects and patients
with irritable bowel syndrome." Clin Gastroenterol Hepatol 11(3): 262-8 e1.
References
105
Ye J., Rawson R.B., Komuro R. et al (2000). "ER stress induces cleavage of
membrane-bound ATF6 by the same proteases that process SREBPs." Mol
Cell 6(6): 1355-64.
Zecca L., Mesonero J.E., Stutz A. et al (1998). "Intestinal lactase-phlorizin hydrolase
(LPH): the two catalytic sites; the role of the pancreas in pro-LPH maturation."
FEBS Lett 435(2-3): 225-8.
Zhang K.,Kaufman R.J. (2006). "Protein folding in the endoplasmic reticulum and the
unfolded protein response." Handb Exp Pharmacol(172): 69-91.
Zhao J., Fox M., Cong Y. et al (2010). "Lactose intolerance in patients with chronic
functional diarrhoea: the role of small intestinal bacterial overgrowth." Aliment
Pharmacol Ther 31(8): 892-900.
Zheng X., Chu H., Cong Y. et al (2015). "Self-reported lactose intolerance in clinic
patients with functional gastrointestinal symptoms: prevalence, risk factors,
and impact on food choices." Neurogastroenterol Motil 27(8): 1138-46.
Zhong Y., Priebe M.G., Vonk R.J. et al (2004). "The role of colonic microbiota in
lactose intolerance." Dig Dis Sci 49(1): 78-83.
zur Stadt U., Rohr J., Seifert W. et al (2009). "Familial hemophagocytic
lymphohistiocytosis type 5 (FHL-5) is caused by mutations in Munc18-2 and
impaired binding to syntaxin 11." Am J Hum Genet 85(4): 482-92.
Zurawska-Plaksej E., Kratz E.M., Ferens-Sieczkowska M., Knapik-Kordecka
M.,Piwowar A. (2015). "Changes in glycosylation of human blood plasma
chitotriosidase in patients with type 2 diabetes." Glycoconj J.
106
Acknowledgements
Acknowledgements
First, I thank my supervisor Prof. Dr. Hassan Y. Naim who offered me the opportunity
to work on very challenging projects during my Master studies and my doctoral time.
Furthermore, I appreciate his support and guidance as well as his demanding
attitude. I learned a lot from you, not only as a scientist but also for life.
Secondly, I thank Prof. Dr. Rita Gerardy-Schahn who kindly agreed to review my
doctoral thesis.
Special thanks are addressed to my second supervisor Prof. Dr. Georg Herrler for his
contribution as a member of my supervision group.
I thank all present and former members of the Department of Physiological
Chemistry, but especially Gabriele Wetzel, Birthe Gericke and Friederike Reuner.
Gabi, thank you for teaching me a lot of techniques and making daily lab work so
easy. Birthe and Rike, thank you for having always open ears and making the last
years to such a good time in my life.
Finally, I thank my family for their never ending mental support, their love and
confidence. Thank you, Mum and Dad, for always being there for me and believing in
me in every stage of my life. Special big thanks to Stefan for being my haven of
peace. I am grateful for your confidence and love.
Eidesstattliche Erklärung
107
Eidesstattliche Erklärung
Hiermit erkläre ich, dass ich die Dissertation „The concerted action of multiple posttranslational events regulates the trafficking and function of wild type and mutant
disaccharidases” selbstständig verfasst habe. Ich habe keine entgeltliche Hilfe von
Vermittlungs- bzw. Beratungsdiensten (Promotionsberater oder anderer Personen) in
Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar entgeltliche
Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der
vorgelegten Dissertation stehen.
Ich habe die Dissertation an folgenden Institutionen angefertigt:
Stiftung Tierärztliche Hochschule Hannover
Institut für Physiologische Chemie
Bünteweg 17/218, 30559 Hannover
Die Dissertation wurde bisher nicht für eine Prüfung oder Promotion oder für einen
ähnlichen Zweck zur Beurteilung eingereicht. Ich versichere, dass ich die
vorstehenden Angaben nach bestem Wissen vollständig und der Wahrheit
entsprechend gemacht habe.
Hannover, den 3. März 2016
____________________
(Lena Diekmann)